![[ChimeraX Issue Tracking System]](/trac/ChimeraX/chrome/site/ChimeraX-icon.svg){kind=icon}
Opened 2 years ago
Closed 2 years ago
#9120 closed defect (can't reproduce)
Crashed in QTabBar::paintEvent(), QPainter::begin: Paint device returned engine == 0
| Reported by: | Owned by: | Eric Pettersen | |
|---|---|---|---|
| Priority: | normal | Milestone: | |
| Component: | Window Toolkit | Version: | |
| Keywords: | Cc: | Tom Goddard | |
| Blocked By: | Blocking: | ||
| Notify when closed: | Platform: | all | |
| Project: | ChimeraX |
Description
The following bug report has been submitted:
Platform: macOS-10.16-x86_64-i386-64bit
ChimeraX Version: 1.6.1 (2023-05-09 17:57:07 UTC)
Description
Last time you used ChimeraX it crashed.
Please describe steps that led to the crash here.
Fatal Python error: Segmentation fault
Current thread 0x00007ff84c2cd340 (most recent call first):
File "/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-packages/chimerax/ui/gui.py", line 275 in event_loop
File "/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-packages/chimerax/core/__main__.py", line 892 in init
File "/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-packages/chimerax/core/__main__.py", line 1043 in
File "/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/runpy.py", line 87 in _run_code
File "/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/runpy.py", line 197 in _run_module_as_main
{"app_name":"ChimeraX","timestamp":"2023-06-02 16:17:27.00 -0700","app_version":"1.6.1","slice_uuid":"5df621ee-554e-36a8-b448-93b2334e5480","build_version":"1.6.1.0","platform":1,"bundleID":"edu.ucsf.cgl.ChimeraX","share_with_app_devs":0,"is_first_party":0,"bug_type":"309","os_version":"macOS 13.3.1 (22E772610a)","roots_installed":0,"name":"ChimeraX","incident_id":"2FB68AB3-5FAB-41CC-A4CD-AA444D3B003A"}
{
"uptime" : 230000,
"procRole" : "Background",
"version" : 2,
"userID" : 545168783,
"deployVersion" : 210,
"modelCode" : "MacBookPro16,1",
"coalitionID" : 3637,
"osVersion" : {
"train" : "macOS 13.3.1",
"build" : "22E772610a",
"releaseType" : "User"
},
"captureTime" : "2023-06-02 16:17:15.7434 -0700",
"incident" : "2FB68AB3-5FAB-41CC-A4CD-AA444D3B003A",
"pid" : 85247,
"cpuType" : "X86-64",
"roots_installed" : 0,
"bug_type" : "309",
"procLaunch" : "2023-06-02 14:38:32.3003 -0700",
"procStartAbsTime" : 234754679377386,
"procExitAbsTime" : 239689387167714,
"procName" : "ChimeraX",
"procPath" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/MacOS\/ChimeraX",
"bundleInfo" : {"CFBundleShortVersionString":"1.6.1","CFBundleVersion":"1.6.1.0","CFBundleIdentifier":"edu.ucsf.cgl.ChimeraX"},
"storeInfo" : {"deviceIdentifierForVendor":"38B4B509-A108-52E3-81C7-B2A6BA96518B","thirdParty":true},
"parentProc" : "launchd",
"parentPid" : 1,
"coalitionName" : "edu.ucsf.cgl.ChimeraX",
"crashReporterKey" : "9B18D030-B306-6304-2536-D0F294D493BC",
"throttleTimeout" : 2147483647,
"codeSigningID" : "edu.ucsf.cgl.ChimeraX",
"codeSigningTeamID" : "LWV8X224YF",
"codeSigningFlags" : 570491649,
"codeSigningValidationCategory" : 6,
"codeSigningTrustLevel" : 0,
"wakeTime" : 6,
"bridgeVersion" : {"build":"20P4252","train":"7.4"},
"sleepWakeUUID" : "5251B313-BAFA-491A-A1D7-6A82D80F0C46",
"sip" : "enabled",
"vmRegionInfo" : "0x18 is not in any region. Bytes before following region: 140737487937512\n REGION TYPE START - END [ VSIZE] PRT\/MAX SHRMOD REGION DETAIL\n UNUSED SPACE AT START\n---> \n shared memory 7ffffff9a000-7ffffff9b000 [ 4K] r-x\/r-x SM=SHM ",
"exception" : {"codes":"0x0000000000000001, 0x0000000000000018","rawCodes":[1,24],"type":"EXC_BAD_ACCESS","signal":"SIGSEGV","subtype":"KERN_INVALID_ADDRESS at 0x0000000000000018"},
"vmregioninfo" : "0x18 is not in any region. Bytes before following region: 140737487937512\n REGION TYPE START - END [ VSIZE] PRT\/MAX SHRMOD REGION DETAIL\n UNUSED SPACE AT START\n---> \n shared memory 7ffffff9a000-7ffffff9b000 [ 4K] r-x\/r-x SM=SHM ",
"extMods" : {"caller":{"thread_create":0,"thread_set_state":0,"task_for_pid":0},"system":{"thread_create":0,"thread_set_state":0,"task_for_pid":0},"targeted":{"thread_create":0,"thread_set_state":0,"task_for_pid":0},"warnings":0},
"faultingThread" : 0,
"threads" : [{"queue":"com.apple.main-thread","instructionState":{"instructionStream":{"bytes":[102,231,255,235,7,235,2,235,0,72,137,195,72,131,125,192,0,116,9,72,139,125,192,232,199,36,41,0,72,137,223,232,249,38,41,0,102,15,31,132,0,0,0,0,0,85,72,137,229,65,87,65,86,65,84,83,72,131,236,64,73,137,247,73,137,254,72,199,7,0,0,0,0,72,137,247,232,172,255,223,255,102,46,15,31,132,0,0,0,0,0,102,144,72,137,195,72,139,120,24,72,139,7,255,80,24,72,133,192,117,238,72,137,223,232,6,124,221,255,72,139,123,24,72,139,7,255,80,32,72,133,192,116,32,73,139,62,73,137,6,72,133,255,15,132,204,1,0,0,72,131,196,64,91,65,92,65,94,65,95,93,233,61,36,41,0,72,139,3,72,137,223,255,144,168,0,0,0,131,248,9,117,61,76,137,255,232,254,254,223,255,72],"offset":96}},"frames":[{"imageOffset":33266,"symbol":"__pthread_kill","symbolLocation":10,"imageIndex":146},{"imageOffset":24294,"symbol":"pthread_kill","symbolLocation":263,"imageIndex":147},{"imageOffset":271873,"symbol":"raise","symbolLocation":26,"imageIndex":148},{"imageOffset":13805,"symbol":"_sigtramp","symbolLocation":29,"imageIndex":149},{"imageOffset":0,"imageIndex":150},{"imageOffset":48058,"imageIndex":70},{"imageOffset":87816,"imageIndex":70},{"imageOffset":504101,"symbol":"QCommonStyle::drawControl(QStyle::ControlElement, QStyleOption const*, QPainter*, QWidget const*) const","symbolLocation":1845,"imageIndex":48},{"imageOffset":74236,"imageIndex":70},{"imageOffset":2137620,"symbol":"QTabBar::paintEvent(QPaintEvent*)","symbolLocation":1700,"imageIndex":48},{"imageOffset":372014,"symbol":"QWidget::event(QEvent*)","symbolLocation":1262,"imageIndex":48},{"imageOffset":2135124,"symbol":"QTabBar::event(QEvent*)","symbolLocation":980,"imageIndex":48},{"imageOffset":43463,"symbol":"QApplicationPrivate::notify_helper(QObject*, QEvent*)","symbolLocation":247,"imageIndex":48},{"imageOffset":47372,"symbol":"QApplication::notify(QObject*, QEvent*)","symbolLocation":508,"imageIndex":48},{"imageOffset":1282438,"symbol":"sipQApplication::notify(QObject*, QEvent*)","symbolLocation":230,"imageIndex":47},{"imageOffset":450858,"symbol":"QCoreApplication::notifyInternal2(QObject*, QEvent*)","symbolLocation":170,"imageIndex":45},{"imageOffset":315357,"symbol":"QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":3981,"imageIndex":48},{"imageOffset":347167,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":1007,"imageIndex":48},{"imageOffset":315672,"symbol":"QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":4296,"imageIndex":48},{"imageOffset":347167,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":1007,"imageIndex":48},{"imageOffset":346842,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":682,"imageIndex":48},{"imageOffset":315672,"symbol":"QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":4296,"imageIndex":48},{"imageOffset":446749,"symbol":"QWidgetRepaintManager::paintAndFlush()","symbolLocation":5085,"imageIndex":48},{"imageOffset":447487,"symbol":"QWidgetRepaintManager::sync()","symbolLocation":255,"imageIndex":48},{"imageOffset":372565,"symbol":"QWidget::event(QEvent*)","symbolLocation":1813,"imageIndex":48},{"imageOffset":1207663,"symbol":"sipQDialog::event(QEvent*)","symbolLocation":191,"imageIndex":47},{"imageOffset":43463,"symbol":"QApplicationPrivate::notify_helper(QObject*, QEvent*)","symbolLocation":247,"imageIndex":48},{"imageOffset":47372,"symbol":"QApplication::notify(QObject*, QEvent*)","symbolLocation":508,"imageIndex":48},{"imageOffset":1282438,"symbol":"sipQApplication::notify(QObject*, QEvent*)","symbolLocation":230,"imageIndex":47},{"imageOffset":450858,"symbol":"QCoreApplication::notifyInternal2(QObject*, QEvent*)","symbolLocation":170,"imageIndex":45},{"imageOffset":431989,"symbol":"QWidgetRepaintManager::sendUpdateRequest(QWidget*, QWidgetRepaintManager::UpdateTime)","symbolLocation":629,"imageIndex":48},{"imageOffset":431267,"symbol":"void QWidgetRepaintManager::markDirty(QRect const&, QWidget*, QWidgetRepaintManager::UpdateTime, QWidgetRepaintManager::BufferState)","symbolLocation":2163,"imageIndex":48},{"imageOffset":475377,"imageIndex":48},{"imageOffset":775594,"imageIndex":45},{"imageOffset":855085,"symbol":"QWindowPrivate::emitScreenChangedRecursion(QScreen*)","symbolLocation":77,"imageIndex":49},{"imageOffset":813514,"symbol":"QScreen::~QScreen()","symbolLocation":682,"imageIndex":49},{"imageOffset":813630,"symbol":"QScreen::~QScreen()","symbolLocation":14,"imageIndex":49},{"imageOffset":895932,"symbol":"QWindowSystemInterface::handleScreenRemoved(QPlatformScreen*)","symbolLocation":28,"imageIndex":49},{"imageOffset":211027,"imageIndex":68},{"imageOffset":203752,"imageIndex":68},{"imageOffset":298930,"imageIndex":68},{"imageOffset":514196,"symbol":"QMetaMethod::invoke(QObject*, Qt::ConnectionType, QGenericReturnArgument, QGenericArgument, QGenericArgument, QGenericArgument, QGenericArgument, QGenericArgument, QGenericArgument, QGenericArgument, QGenericArgument, QGenericArgument, QGenericArgument) const","symbolLocation":1284,"imageIndex":45},{"imageOffset":314978,"imageIndex":68},{"imageOffset":469031,"symbol":"__CFNOTIFICATIONCENTER_IS_CALLING_OUT_TO_AN_OBSERVER__","symbolLocation":120,"imageIndex":151},{"imageOffset":1094766,"symbol":"___CFXRegistrationPost_block_invoke","symbolLocation":88,"imageIndex":151},{"imageOffset":1094595,"symbol":"_CFXRegistrationPost","symbolLocation":536,"imageIndex":151},{"imageOffset":285367,"symbol":"_CFXNotificationPost","symbolLocation":729,"imageIndex":151},{"imageOffset":40208,"symbol":"-[NSNotificationCenter postNotificationName:object:userInfo:]","symbolLocation":82,"imageIndex":152},{"imageOffset":2453746,"symbol":"__67-[NSWindow _updateSettingsSendingScreenChangeNotificationToScreen:]_block_invoke","symbolLocation":589,"imageIndex":153},{"imageOffset":566423,"symbol":"NSPerformVisuallyAtomicChange","symbolLocation":132,"imageIndex":153},{"imageOffset":2453151,"symbol":"-[NSWindow _updateSettingsSendingScreenChangeNotificationToScreen:]","symbolLocation":69,"imageIndex":153},{"imageOffset":4008906,"symbol":"-[NSWindow _screenChanged:]","symbolLocation":176,"imageIndex":153},{"imageOffset":4008708,"symbol":"-[NSWindow _displayChangedSoAdjustWindows:]","symbolLocation":120,"imageIndex":153},{"imageOffset":13136302,"symbol":"___NSApplicationPerformScreenInvalidationReactions_block_invoke","symbolLocation":69,"imageIndex":153},{"imageOffset":233560,"symbol":"-[NSApplication enumerateWindowsWithOptions:usingBlock:]","symbolLocation":274,"imageIndex":153},{"imageOffset":13134611,"symbol":"___NSApplicationReactToScreenInvalidation_block_invoke","symbolLocation":979,"imageIndex":153},{"imageOffset":13132796,"symbol":"_NSApplicationReactToScreenInvalidation","symbolLocation":129,"imageIndex":153},{"imageOffset":1723794,"symbol":"-[NSApplication(ScreenHandling) _reactToDockChanged]","symbolLocation":142,"imageIndex":153},{"imageOffset":1721817,"symbol":"_NSCGSDockMessageReceive","symbolLocation":266,"imageIndex":153},{"imageOffset":342330,"symbol":"DockCallback(unsigned int, unsigned int, void*, void*)","symbolLocation":1941,"imageIndex":154},{"imageOffset":47693,"symbol":"dockClientNotificationProc","symbolLocation":204,"imageIndex":155},{"imageOffset":45932,"symbol":"(anonymous namespace)::notify_datagram_handler(unsigned int, CGSDatagramType, void*, unsigned long, void*)","symbolLocation":1018,"imageIndex":156},{"imageOffset":3312444,"symbol":"CGSDatagramReadStream::dispatchMainQueueDatagrams()","symbolLocation":202,"imageIndex":156},{"imageOffset":3312227,"symbol":"invocation function for block in CGSDatagramReadStream::mainQueueWakeup()","symbolLocation":18,"imageIndex":156},{"imageOffset":7569,"symbol":"_dispatch_call_block_and_release","symbolLocation":12,"imageIndex":157},{"imageOffset":12339,"symbol":"_dispatch_client_callout","symbolLocation":8,"imageIndex":157},{"imageOffset":65487,"symbol":"_dispatch_main_queue_drain","symbolLocation":954,"imageIndex":157},{"imageOffset":64519,"symbol":"_dispatch_main_queue_callback_4CF","symbolLocation":31,"imageIndex":157},{"imageOffset":770613,"symbol":"__CFRUNLOOP_IS_SERVICING_THE_MAIN_DISPATCH_QUEUE__","symbolLocation":9,"imageIndex":151},{"imageOffset":508015,"symbol":"__CFRunLoopRun","symbolLocation":2452,"imageIndex":151},{"imageOffset":503921,"symbol":"CFRunLoopRunSpecific","symbolLocation":560,"imageIndex":151},{"imageOffset":192461,"symbol":"RunCurrentEventLoopInMode","symbolLocation":292,"imageIndex":154},{"imageOffset":191966,"symbol":"ReceiveNextEventCommon","symbolLocation":657,"imageIndex":154},{"imageOffset":191288,"symbol":"_BlockUntilNextEventMatchingListInModeWithFilter","symbolLocation":64,"imageIndex":154},{"imageOffset":255904,"symbol":"_DPSNextEvent","symbolLocation":858,"imageIndex":153},{"imageOffset":251466,"symbol":"-[NSApplication(NSEvent) _nextEventMatchingEventMask:untilDate:inMode:dequeue:]","symbolLocation":1214,"imageIndex":153},{"imageOffset":195768,"symbol":"-[NSApplication run]","symbolLocation":586,"imageIndex":153},{"imageOffset":91987,"imageIndex":68},{"imageOffset":488630,"symbol":"QEventLoop::exec(QFlags)","symbolLocation":486,"imageIndex":45},{"imageOffset":452389,"symbol":"QCoreApplication::exec()","symbolLocation":133,"imageIndex":45},{"imageOffset":2250058,"symbol":"meth_QApplication_exec(_object*, _object*)","symbolLocation":90,"imageIndex":47},{"imageOffset":517917,"symbol":"cfunction_call","symbolLocation":125,"imageIndex":1},{"imageOffset":259511,"symbol":"_PyObject_MakeTpCall","symbolLocation":359,"imageIndex":1},{"imageOffset":1146524,"symbol":"call_function","symbolLocation":876,"imageIndex":1},{"imageOffset":1135266,"symbol":"_PyEval_EvalFrameDefault","symbolLocation":25554,"imageIndex":1},{"imageOffset":261416,"symbol":"function_code_fastcall","symbolLocation":104,"imageIndex":1},{"imageOffset":269674,"symbol":"method_vectorcall","symbolLocation":202,"imageIndex":1},{"imageOffset":1146380,"symbol":"call_function","symbolLocation":732,"imageIndex":1},{"imageOffset":1135266,"symbol":"_PyEval_EvalFrameDefault","symbolLocation":25554,"imageIndex":1},{"imageOffset":1149699,"symbol":"_PyEval_EvalCode","symbolLocation":2611,"imageIndex":1},{"imageOffset":261297,"symbol":"_PyFunction_Vectorcall","symbolLocation":289,"imageIndex":1},{"imageOffset":1146380,"symbol":"call_function","symbolLocation":732,"imageIndex":1},{"imageOffset":1135435,"symbol":"_PyEval_EvalFrameDefault","symbolLocation":25723,"imageIndex":1},{"imageOffset":1149699,"symbol":"_PyEval_EvalCode","symbolLocation":2611,"imageIndex":1},{"imageOffset":1109419,"symbol":"PyEval_EvalCode","symbolLocation":139,"imageIndex":1},{"imageOffset":1096722,"symbol":"builtin_exec","symbolLocation":626,"imageIndex":1},{"imageOffset":516131,"symbol":"cfunction_vectorcall_FASTCALL","symbolLocation":195,"imageIndex":1},{"imageOffset":1146380,"symbol":"call_function","symbolLocation":732,"imageIndex":1},{"imageOffset":1135435,"symbol":"_PyEval_EvalFrameDefault","symbolLocation":25723,"imageIndex":1},{"imageOffset":1149699,"symbol":"_PyEval_EvalCode","symbolLocation":2611,"imageIndex":1},{"imageOffset":261297,"symbol":"_PyFunction_Vectorcall","symbolLocation":289,"imageIndex":1},{"imageOffset":1146380,"symbol":"call_function","symbolLocation":732,"imageIndex":1},{"imageOffset":1135435,"symbol":"_PyEval_EvalFrameDefault","symbolLocation":25723,"imageIndex":1},{"imageOffset":1149699,"symbol":"_PyEval_EvalCode","symbolLocation":2611,"imageIndex":1},{"imageOffset":261297,"symbol":"_PyFunction_Vectorcall","symbolLocation":289,"imageIndex":1},{"imageOffset":1566832,"symbol":"pymain_run_module","symbolLocation":208,"imageIndex":1},{"imageOffset":1564551,"symbol":"Py_RunMain","symbolLocation":1431,"imageIndex":1},{"imageOffset":1566095,"symbol":"pymain_main","symbolLocation":223,"imageIndex":1},{"imageOffset":1565851,"symbol":"Py_Main","symbolLocation":43,"imageIndex":1},{"imageOffset":3528,"symbol":"main","symbolLocation":120,"imageIndex":0},{"imageOffset":25631,"symbol":"start","symbolLocation":1903,"imageIndex":158}],"id":2747566,"triggered":true,"threadState":{"r13":{"value":140412621439616},"rax":{"value":0},"rflags":{"value":582},"cpu":{"value":0},"r14":{"value":11},"rsi":{"value":11},"r8":{"value":140412617842504},"cr2":{"value":140412616676744},"rdx":{"value":0},"r10":{"value":140704406623040,"symbolLocation":0,"symbol":"_main_thread"},"r9":{"value":17435502146352432844},"r15":{"value":22},"rbx":{"value":140704406623040,"symbolLocation":0,"symbol":"_main_thread"},"trap":{"value":133},"err":{"value":33554760},"r11":{"value":582},"rip":{"value":140703275164146,"matchesCrashFrame":1},"rbp":{"value":140412617841280},"rsp":{"value":140412617841240},"r12":{"value":259},"rcx":{"value":140412617841240},"flavor":"x86_THREAD_STATE","rdi":{"value":259}},"name":"CrBrowserMain"},{"id":2747659,"name":"ThreadPoolServiceThread","frames":[{"imageOffset":44566,"symbol":"kevent64","symbolLocation":10,"imageIndex":146},{"imageOffset":72176586,"imageIndex":55},{"imageOffset":72176239,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71838381,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747660,"name":"ThreadPoolForegroundWorker","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71890095,"imageIndex":55},{"imageOffset":71893079,"imageIndex":55},{"imageOffset":71891853,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747662,"name":"Chrome_IOThread","frames":[{"imageOffset":44566,"symbol":"kevent64","symbolLocation":10,"imageIndex":146},{"imageOffset":72176586,"imageIndex":55},{"imageOffset":72176239,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":30119282,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747663,"name":"NetworkConfigWatcher","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":72148767,"imageIndex":55},{"imageOffset":71278185,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747666,"name":"Chrome_InProcGpuThread","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71278088,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747667,"name":"Chrome_ChildIOThread","frames":[{"imageOffset":44566,"symbol":"kevent64","symbolLocation":10,"imageIndex":146},{"imageOffset":72176586,"imageIndex":55},{"imageOffset":72176239,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":118470786,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747668,"name":"CompositorTileWorker1","frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":146},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":147},{"imageOffset":72117794,"imageIndex":55},{"imageOffset":108041477,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747669,"name":"ThreadPoolSingleThreadSharedForeground0","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71890095,"imageIndex":55},{"imageOffset":71893079,"imageIndex":55},{"imageOffset":71891901,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747670,"name":"NetworkConfigWatcher","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":72148767,"imageIndex":55},{"imageOffset":71278185,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747671,"name":"VizCompositorThread","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71278088,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747673,"name":"NetworkService","frames":[{"imageOffset":44566,"symbol":"kevent64","symbolLocation":10,"imageIndex":146},{"imageOffset":72176586,"imageIndex":55},{"imageOffset":72176239,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747674,"name":"NetworkConfigWatcher","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":72148767,"imageIndex":55},{"imageOffset":71278185,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747675,"name":"ThreadPoolSingleThreadForegroundBlocking1","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71890095,"imageIndex":55},{"imageOffset":71893079,"imageIndex":55},{"imageOffset":71891949,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747706,"name":"NetworkConfigWatcher","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":72148767,"imageIndex":55},{"imageOffset":71278185,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747744,"name":"com.apple.NSEventThread","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":512431,"symbol":"__CFRunLoopServiceMachPort","symbolLocation":145,"imageIndex":151},{"imageOffset":506928,"symbol":"__CFRunLoopRun","symbolLocation":1365,"imageIndex":151},{"imageOffset":503921,"symbol":"CFRunLoopRunSpecific","symbolLocation":560,"imageIndex":151},{"imageOffset":1698057,"symbol":"_NSEventThread","symbolLocation":132,"imageIndex":153},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747885,"name":"ThreadPoolBackgroundWorker","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71890095,"imageIndex":55},{"imageOffset":71893079,"imageIndex":55},{"imageOffset":71891709,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747891,"name":"MemoryInfra","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":72148767,"imageIndex":55},{"imageOffset":71278185,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747892,"name":"ThreadPoolSingleThreadSharedBackgroundBlocking2","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71890095,"imageIndex":55},{"imageOffset":71892236,"imageIndex":55},{"imageOffset":71891757,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747914,"frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":146},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":147},{"imageOffset":3445311,"symbol":"blas_thread_server","symbolLocation":207,"imageIndex":17},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747915,"frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":146},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":147},{"imageOffset":3445311,"symbol":"blas_thread_server","symbolLocation":207,"imageIndex":17},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747916,"frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":146},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":147},{"imageOffset":3445311,"symbol":"blas_thread_server","symbolLocation":207,"imageIndex":17},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747917,"frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":146},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":147},{"imageOffset":3445311,"symbol":"blas_thread_server","symbolLocation":207,"imageIndex":17},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2747918,"frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":146},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":147},{"imageOffset":3445311,"symbol":"blas_thread_server","symbolLocation":207,"imageIndex":17},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]},{"id":2787256,"frames":[{"imageOffset":7088,"symbol":"start_wqthread","symbolLocation":0,"imageIndex":147}]},{"id":2787902,"frames":[{"imageOffset":7088,"symbol":"start_wqthread","symbolLocation":0,"imageIndex":147}]},{"id":2788619,"frames":[{"imageOffset":7088,"symbol":"start_wqthread","symbolLocation":0,"imageIndex":147}]},{"id":2788630,"frames":[{"imageOffset":7088,"symbol":"start_wqthread","symbolLocation":0,"imageIndex":147}]},{"id":2788642,"frames":[{"imageOffset":7088,"symbol":"start_wqthread","symbolLocation":0,"imageIndex":147}]},{"id":2788671,"name":"ThreadPoolBackgroundWorker","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":146},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":146},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":146},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":146},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71890095,"imageIndex":55},{"imageOffset":71892236,"imageIndex":55},{"imageOffset":71891709,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":147},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":147}]}],
"usedImages" : [
{
"source" : "P",
"arch" : "x86_64",
"base" : 4552077312,
"CFBundleShortVersionString" : "1.6.1",
"CFBundleIdentifier" : "edu.ucsf.cgl.ChimeraX",
"size" : 4096,
"uuid" : "5df621ee-554e-36a8-b448-93b2334e5480",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/MacOS\/ChimeraX",
"name" : "ChimeraX",
"CFBundleVersion" : "1.6.1.0"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4556115968,
"CFBundleShortVersionString" : "3.9.11, (c) 2001-2021 Python Software Foundation.",
"CFBundleIdentifier" : "org.python.python",
"size" : 2527232,
"uuid" : "ef9cc1f4-5991-3213-9a9e-e68c578b6c1b",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/Python",
"name" : "Python",
"CFBundleVersion" : "3.9.11"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4552585216,
"size" : 12288,
"uuid" : "26e2211d-6e3c-34a0-9ef2-e395ec9e55ec",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_heapq.cpython-39-darwin.so",
"name" : "_heapq.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4552691712,
"size" : 20480,
"uuid" : "0d397cb0-ba52-314e-bd56-863340384c78",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/binascii.cpython-39-darwin.so",
"name" : "binascii.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4552810496,
"size" : 24576,
"uuid" : "b9299f10-06ed-376d-94f7-5f40a9a019ce",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/zlib.cpython-39-darwin.so",
"name" : "zlib.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4552749056,
"size" : 12288,
"uuid" : "acea136f-27d9-3006-b785-f415ed7c491c",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_bz2.cpython-39-darwin.so",
"name" : "_bz2.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4553134080,
"size" : 204800,
"uuid" : "d7e1b7aa-2530-3908-b749-1ddf8aad37bb",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_lzma.cpython-39-darwin.so",
"name" : "_lzma.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4552634368,
"size" : 8192,
"uuid" : "eba0bbb2-1ee4-33c8-b2c3-e0ca34b5efb2",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/grp.cpython-39-darwin.so",
"name" : "grp.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4552945664,
"size" : 24576,
"uuid" : "5f0c5830-adfd-3807-a69b-3ac334660886",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_struct.cpython-39-darwin.so",
"name" : "_struct.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4553408512,
"size" : 36864,
"uuid" : "87ed7f18-fdc5-3cc8-97f0-ee393ee6ab9f",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/math.cpython-39-darwin.so",
"name" : "math.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4552871936,
"size" : 8192,
"uuid" : "9e551319-6228-323e-961d-0102241059ad",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_bisect.cpython-39-darwin.so",
"name" : "_bisect.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4553027584,
"size" : 8192,
"uuid" : "d7ea60e7-dc7b-30c1-968b-07c80dec058e",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_random.cpython-39-darwin.so",
"name" : "_random.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4553498624,
"size" : 20480,
"uuid" : "dcac7b53-ad00-326b-86a5-ab8ee3c866b3",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_sha512.cpython-39-darwin.so",
"name" : "_sha512.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4552916992,
"size" : 4096,
"uuid" : "260d58a8-ac64-3d93-ad4e-8e24c7ed2c7a",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/arrays\/_arrays.cpython-39-darwin.so",
"name" : "_arrays.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4554362880,
"size" : 663552,
"uuid" : "7e891c56-f468-3ac7-926a-b3efe3e69557",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/arrays\/lib\/libarrays.dylib",
"name" : "libarrays.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4553555968,
"size" : 24576,
"uuid" : "548d7da5-6a01-3908-b0e7-cf52811a65eb",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_json.cpython-39-darwin.so",
"name" : "_json.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4565757952,
"size" : 4489216,
"uuid" : "3c57f0c7-97af-382e-bdaf-5b192a395a0c",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/core\/_multiarray_umath.cpython-39-darwin.so",
"name" : "_multiarray_umath.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4638498816,
"size" : 64028672,
"uuid" : "24c9d5c5-4854-3af4-9550-cb0204044dfa",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/.dylibs\/libopenblas64_.0.dylib",
"name" : "libopenblas64_.0.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4561596416,
"size" : 1146880,
"uuid" : "9abe5ede-ad43-391a-9e54-866711fac32a",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/.dylibs\/libgfortran.3.dylib",
"name" : "libgfortran.3.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4553920512,
"size" : 225280,
"uuid" : "7ffa409f-fb04-3b64-be9a-3e3a494c975e",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/.dylibs\/libquadmath.0.dylib",
"name" : "libquadmath.0.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4553617408,
"size" : 90112,
"uuid" : "7c6d7cb7-82db-3290-8181-07646fea1f80",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/.dylibs\/libgcc_s.1.dylib",
"name" : "libgcc_s.1.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4555169792,
"size" : 65536,
"uuid" : "b167e339-2809-37ba-8e75-5887037a5a03",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_datetime.cpython-39-darwin.so",
"name" : "_datetime.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4555472896,
"size" : 98304,
"uuid" : "a0f1736c-019e-304a-831b-33c61292773f",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_pickle.cpython-39-darwin.so",
"name" : "_pickle.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4555829248,
"size" : 81920,
"uuid" : "19fff319-9db7-3f06-86fd-431cf039cbdd",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/core\/_multiarray_tests.cpython-39-darwin.so",
"name" : "_multiarray_tests.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4553768960,
"size" : 12288,
"uuid" : "14c199de-bb55-3957-b5e3-5186e436f6f7",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_posixsubprocess.cpython-39-darwin.so",
"name" : "_posixsubprocess.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4553818112,
"size" : 20480,
"uuid" : "2f042ce6-bef0-3ad9-97f5-2da7655122a4",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/select.cpython-39-darwin.so",
"name" : "select.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4560003072,
"size" : 73728,
"uuid" : "865f1d2b-bb7c-3188-a588-737beec80b87",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_ctypes.cpython-39-darwin.so",
"name" : "_ctypes.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4560392192,
"size" : 114688,
"uuid" : "e0295914-340c-31b8-90e3-ab43913e9c42",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/linalg\/_umath_linalg.cpython-39-darwin.so",
"name" : "_umath_linalg.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4555313152,
"size" : 81920,
"uuid" : "8f950734-eaf8-30d8-90fa-19315f9e3cb1",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/fft\/_pocketfft_internal.cpython-39-darwin.so",
"name" : "_pocketfft_internal.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4563189760,
"size" : 475136,
"uuid" : "78637382-a5da-3b41-80af-140e50bd93f3",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/mtrand.cpython-39-darwin.so",
"name" : "mtrand.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4560891904,
"size" : 131072,
"uuid" : "2bbe12ec-f3f9-3d48-8d9d-5d78fe52a418",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/bit_generator.cpython-39-darwin.so",
"name" : "bit_generator.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4564066304,
"size" : 229376,
"uuid" : "f8b8d031-7753-33cd-93f8-b9ee523054ab",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_common.cpython-39-darwin.so",
"name" : "_common.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4555644928,
"size" : 28672,
"uuid" : "388ef3f8-6fc4-3be1-8cec-68f80b144aa3",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_hashlib.cpython-39-darwin.so",
"name" : "_hashlib.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4564992000,
"size" : 368640,
"uuid" : "9b470578-8ffb-3e67-9fe0-7446a9ba507b",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/libssl.1.1.dylib",
"name" : "libssl.1.1.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4608053248,
"size" : 2195456,
"uuid" : "73600d5b-8efd-3996-af09-e02c28d67dcb",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/libcrypto.1.1.dylib",
"name" : "libcrypto.1.1.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4554289152,
"size" : 28672,
"uuid" : "673b41f3-28be-3326-bbd9-f33c09b2c664",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_blake2.cpython-39-darwin.so",
"name" : "_blake2.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4605210624,
"size" : 344064,
"uuid" : "c031b4b0-9fe6-3f12-b72d-61b1b63fa4f2",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_bounded_integers.cpython-39-darwin.so",
"name" : "_bounded_integers.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4560621568,
"size" : 65536,
"uuid" : "28eb0207-3278-3299-a6e1-af6198c95536",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_mt19937.cpython-39-darwin.so",
"name" : "_mt19937.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4561162240,
"size" : 65536,
"uuid" : "dbeca4b1-3fb3-3a81-a2fe-4ff45340f900",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_philox.cpython-39-darwin.so",
"name" : "_philox.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4561297408,
"size" : 65536,
"uuid" : "d29931bb-5833-38e0-b60c-ec87f9495fa4",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_pcg64.cpython-39-darwin.so",
"name" : "_pcg64.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4556013568,
"size" : 32768,
"uuid" : "e84a3da1-4290-32da-98dc-8d8e708fca1a",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_sfc64.cpython-39-darwin.so",
"name" : "_sfc64.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4606775296,
"size" : 589824,
"uuid" : "793608fd-338f-3f47-abff-e2dc17331adb",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_generator.cpython-39-darwin.so",
"name" : "_generator.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4553072640,
"size" : 4096,
"uuid" : "d0f47093-7e88-3d31-9906-b6b48a0ff811",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_opcode.cpython-39-darwin.so",
"name" : "_opcode.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4564418560,
"size" : 126976,
"uuid" : "75eff895-415d-3be0-9017-952a6d6c54c5",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/geometry\/_geometry.cpython-39-darwin.so",
"name" : "_geometry.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4618067968,
"size" : 1605632,
"uuid" : "5590e5eb-1a53-3bf0-9ffc-71d23992c730",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtCore.abi3.so",
"name" : "QtCore.abi3.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4621606912,
"size" : 5210112,
"uuid" : "6238782e-d1aa-3245-81ef-2925bf1a4c96",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtCore.framework\/Versions\/A\/QtCore",
"name" : "QtCore"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4560175104,
"size" : 98304,
"uuid" : "f511de72-2757-3ff5-8524-716ba83b7953",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/sip.cpython-39-darwin.so",
"name" : "sip.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4610899968,
"size" : 2834432,
"uuid" : "951581e2-ae51-392a-82d9-fdf83e162d11",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtWidgets.abi3.so",
"name" : "QtWidgets.abi3.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4903632896,
"size" : 4931584,
"uuid" : "5bfaef33-ce47-32bf-acb3-03cbe9e68a6f",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtWidgets.framework\/Versions\/A\/QtWidgets",
"name" : "QtWidgets"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4910006272,
"size" : 7094272,
"uuid" : "cf0b9ade-9377-380e-9a84-904983d7bb60",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtGui.framework\/Versions\/A\/QtGui",
"name" : "QtGui"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4617056256,
"size" : 540672,
"uuid" : "d75bc176-b599-346d-9c20-e26d546cecdf",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtDBus.framework\/Versions\/A\/QtDBus",
"name" : "QtDBus"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4634271744,
"size" : 1490944,
"uuid" : "9c3eb0df-69a3-3b03-ab77-80606e4891d2",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtGui.abi3.so",
"name" : "QtGui.abi3.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4561440768,
"size" : 65536,
"uuid" : "8d885ad7-b0a5-3652-95d8-53791eacb3ca",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtWebEngineWidgets.abi3.so",
"name" : "QtWebEngineWidgets.abi3.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4605747200,
"size" : 81920,
"uuid" : "1e9cc466-23ad-39e2-80a4-31ff007d87d5",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtWebEngineWidgets.framework\/Versions\/A\/QtWebEngineWidgets",
"name" : "QtWebEngineWidgets"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4627619840,
"size" : 294912,
"uuid" : "7178d391-3db2-3825-b031-83a02c9069fa",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtPrintSupport.framework\/Versions\/A\/QtPrintSupport",
"name" : "QtPrintSupport"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5103325184,
"size" : 174571520,
"uuid" : "473ca65c-6149-3bfa-a88b-95ac735bcd3b",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtWebEngineCore.framework\/Versions\/A\/QtWebEngineCore",
"name" : "QtWebEngineCore"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4918353920,
"size" : 4194304,
"uuid" : "2320a4ff-4480-3fab-b65e-d0bfa30e7175",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtQuick.framework\/Versions\/A\/QtQuick",
"name" : "QtQuick"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4628111360,
"size" : 425984,
"uuid" : "801f31da-cbeb-31ff-b9cf-f6db264a808b",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtOpenGL.framework\/Versions\/A\/QtOpenGL",
"name" : "QtOpenGL"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4628725760,
"size" : 540672,
"uuid" : "9b2c88ec-5704-30b2-ad3d-1029261e37b3",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtQmlModels.framework\/Versions\/A\/QtQmlModels",
"name" : "QtQmlModels"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4606210048,
"size" : 196608,
"uuid" : "7680348f-ddbb-3d03-b57e-51a794fc69aa",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtWebChannel.framework\/Versions\/A\/QtWebChannel",
"name" : "QtWebChannel"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4928946176,
"size" : 4112384,
"uuid" : "b142d2df-822a-3c32-93f9-9c3a3c116594",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtQml.framework\/Versions\/A\/QtQml",
"name" : "QtQml"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4630937600,
"size" : 1163264,
"uuid" : "4e8fb178-39bd-37fc-92f2-6fbc9d82af88",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtNetwork.framework\/Versions\/A\/QtNetwork",
"name" : "QtNetwork"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4630065152,
"size" : 491520,
"uuid" : "bc6797b4-2790-31eb-91cb-ec099d47f563",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtPositioning.framework\/Versions\/A\/QtPositioning",
"name" : "QtPositioning"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4605927424,
"size" : 81920,
"uuid" : "e7d49a3d-a512-3f57-8fe3-a90e0c97f2c2",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtQuickWidgets.framework\/Versions\/A\/QtQuickWidgets",
"name" : "QtQuickWidgets"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4555730944,
"size" : 32768,
"uuid" : "da4429b4-302e-3d2b-9b06-391152bff6fa",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtWebChannel.abi3.so",
"name" : "QtWebChannel.abi3.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4632436736,
"size" : 458752,
"uuid" : "7dd9c25c-c2a0-3248-8f79-da774e47248d",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtNetwork.abi3.so",
"name" : "QtNetwork.abi3.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4629438464,
"size" : 212992,
"uuid" : "bbba7cd3-3207-3cce-b34b-1c5d98ea53eb",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtWebEngineCore.abi3.so",
"name" : "QtWebEngineCore.abi3.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4637544448,
"size" : 147456,
"uuid" : "8dd82bcd-6f94-324d-b419-e93c71b99376",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtPrintSupport.abi3.so",
"name" : "QtPrintSupport.abi3.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4924928000,
"size" : 638976,
"uuid" : "7175bc4c-ca2f-30b6-9734-062b84bd0ae2",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/platforms\/libqcocoa.dylib",
"name" : "libqcocoa.dylib"
},
{
"source" : "P",
"arch" : "x86_64h",
"base" : 4958957568,
"CFBundleShortVersionString" : "4.10.12",
"CFBundleIdentifier" : "com.apple.AMDRadeonX6000GLDriver",
"size" : 1490944,
"uuid" : "b75df7b7-9e8e-3bb2-a159-9a17d072f65b",
"path" : "\/System\/Library\/Extensions\/AMDRadeonX6000GLDriver.bundle\/Contents\/MacOS\/AMDRadeonX6000GLDriver",
"name" : "AMDRadeonX6000GLDriver",
"CFBundleVersion" : "4.1.0"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4638146560,
"size" : 163840,
"uuid" : "60501060-de6d-35b6-8325-74cf1323cca0",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/styles\/libqmacstyle.dylib",
"name" : "libqmacstyle.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4607881216,
"size" : 12288,
"uuid" : "887805e6-e59a-3c6e-b025-b018d0d5e48b",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/fcntl.cpython-39-darwin.so",
"name" : "fcntl.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4924313600,
"size" : 180224,
"uuid" : "620756c7-4f13-3305-b7e6-2653d410e4a6",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/pyexpat.cpython-39-darwin.so",
"name" : "pyexpat.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4634046464,
"size" : 57344,
"uuid" : "4be1a98e-c179-38fa-854c-0dc2cc23696d",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_socket.cpython-39-darwin.so",
"name" : "_socket.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4630822912,
"size" : 32768,
"uuid" : "7d6b64db-191d-3216-97d9-ac978b08929e",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/array.cpython-39-darwin.so",
"name" : "array.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4607995904,
"size" : 8192,
"uuid" : "1eae6074-8612-3bc6-b16b-c173a995e90c",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_queue.cpython-39-darwin.so",
"name" : "_queue.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4634157056,
"size" : 20480,
"uuid" : "73712781-c20d-3f97-9760-5c95eb030227",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_csv.cpython-39-darwin.so",
"name" : "_csv.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4617986048,
"size" : 4096,
"uuid" : "bf662773-0d04-3254-b643-bbe11593cfbd",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic_lib\/_load_libs.cpython-39-darwin.so",
"name" : "_load_libs.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4974772224,
"size" : 1253376,
"uuid" : "5192d8ff-91ee-3ba1-acbe-0cc0875d9dd3",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic_lib\/lib\/libatomstruct.dylib",
"name" : "libatomstruct.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4637978624,
"size" : 24576,
"uuid" : "40ef14e9-a17d-39b6-be0c-127555677085",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic_lib\/lib\/libelement.dylib",
"name" : "libelement.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4618018816,
"size" : 4096,
"uuid" : "6f0774d3-c270-3d3b-a12f-e63ec563d40d",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic_lib\/lib\/libpyinstance.dylib",
"name" : "libpyinstance.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4957474816,
"size" : 217088,
"uuid" : "7e9191e6-b126-301c-9f6a-d5b23f0013b8",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic\/libmolc.dylib",
"name" : "libmolc.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4976685056,
"size" : 372736,
"uuid" : "95fc95cc-2a76-36f6-b171-503f2c5e75cb",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic\/cymol.cpython-39-darwin.so",
"name" : "cymol.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4924592128,
"size" : 110592,
"uuid" : "3b4799e1-0245-3f6e-9109-a9ac8206aefd",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/tinyarray.cpython-39-darwin.so",
"name" : "tinyarray.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4924137472,
"size" : 36864,
"uuid" : "6ea8e4d1-a62b-3827-9897-2823a0b67614",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic\/cytmpl.cpython-39-darwin.so",
"name" : "cytmpl.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4957224960,
"size" : 151552,
"uuid" : "9a40449f-d479-3ae9-a9d8-3f7a8d89b1ba",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/surface\/_surface.cpython-39-darwin.so",
"name" : "_surface.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4957958144,
"size" : 86016,
"uuid" : "b9c1eb65-29b3-3cc9-87cb-63be7734a3c7",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_ssl.cpython-39-darwin.so",
"name" : "_ssl.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4634214400,
"size" : 4096,
"uuid" : "f905c35e-44ce-3ab4-b790-b5efa6fa95e8",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_scproxy.cpython-39-darwin.so",
"name" : "_scproxy.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4977324032,
"size" : 548864,
"uuid" : "9dcd38a4-f108-3a57-9c0e-954d70f6b885",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/map\/_map.cpython-39-darwin.so",
"name" : "_map.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4638064640,
"size" : 16384,
"uuid" : "e41a65c4-df75-3d5a-890b-9a8577668c95",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/charset_normalizer\/md.cpython-39-darwin.so",
"name" : "md.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4958429184,
"size" : 131072,
"uuid" : "3fdee7fa-47ca-3a24-bdf1-a967c1e82890",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/charset_normalizer\/md__mypyc.cpython-39-darwin.so",
"name" : "md__mypyc.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4979204096,
"size" : 1093632,
"uuid" : "d95f3165-cb18-3268-914d-e0787602c93f",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/unicodedata.cpython-39-darwin.so",
"name" : "unicodedata.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4638400512,
"size" : 20480,
"uuid" : "b6eb0e34-67c7-373c-8f57-ea91e98a9b10",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_multibytecodec.cpython-39-darwin.so",
"name" : "_multibytecodec.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4637892608,
"size" : 4096,
"uuid" : "f5a33081-e839-36e3-aac1-06c51c431620",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_uuid.cpython-39-darwin.so",
"name" : "_uuid.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4978487296,
"size" : 307200,
"uuid" : "859b4edd-8da4-3f22-86e0-07538c7b5aa5",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_decimal.cpython-39-darwin.so",
"name" : "_decimal.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4981391360,
"size" : 819200,
"uuid" : "ec819ef5-b16f-3f6b-b23d-03751398c0a3",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/_imaging.cpython-39-darwin.so",
"name" : "_imaging.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4982439936,
"size" : 557056,
"uuid" : "91766682-e5af-36de-8e46-40aae99e8ebc",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libopenjp2.2.5.0.dylib",
"name" : "libopenjp2.2.5.0.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4958158848,
"size" : 131072,
"uuid" : "b683b844-94c8-3f8a-beb5-91a6d8400c27",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libz.1.2.13.dylib",
"name" : "libz.1.2.13.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4984299520,
"size" : 1081344,
"uuid" : "89eeb1e7-5ff6-38db-8cb6-e21e09420bfe",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libtiff.5.dylib",
"name" : "libtiff.5.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4978921472,
"size" : 163840,
"uuid" : "15c6e7fa-c3e7-3ee3-ae79-9a665bbdde8d",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libxcb.1.1.0.dylib",
"name" : "libxcb.1.1.0.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4980355072,
"size" : 196608,
"uuid" : "b0d3eea1-3ea6-3ee2-bf57-abab390b6e3c",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/liblzma.5.dylib",
"name" : "liblzma.5.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4924239872,
"size" : 16384,
"uuid" : "568add8e-f7cf-38b0-9331-09a426332386",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libXau.6.dylib",
"name" : "libXau.6.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4924821504,
"size" : 16384,
"uuid" : "c019ad02-bd14-398d-a4fd-e9e4afb4b6e0",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libXdmcp.6.dylib",
"name" : "libXdmcp.6.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4924035072,
"size" : 12288,
"uuid" : "16da837b-0859-30b7-ba52-b0f481c0e785",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/termios.cpython-39-darwin.so",
"name" : "termios.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4928860160,
"size" : 16384,
"uuid" : "ade40abc-2f4a-329a-85cd-79f89e46722e",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/matplotlib\/_c_internal_utils.cpython-39-darwin.so",
"name" : "_c_internal_utils.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4958715904,
"size" : 131072,
"uuid" : "15c5112f-e802-397a-ab70-78b767c00ddf",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/matplotlib\/_path.cpython-39-darwin.so",
"name" : "_path.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4985544704,
"size" : 671744,
"uuid" : "e6de4cc7-aef8-3516-9028-7d24011f9a4a",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/matplotlib\/ft2font.cpython-39-darwin.so",
"name" : "ft2font.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4980617216,
"size" : 98304,
"uuid" : "8a1f8383-59fa-3629-9c87-465192203088",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/kiwisolver\/_cext.cpython-39-darwin.so",
"name" : "_cext.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4978057216,
"size" : 163840,
"uuid" : "95976df9-a305-3674-b12c-d53106a0a7fb",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/matplotlib\/_image.cpython-39-darwin.so",
"name" : "_image.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4637933568,
"size" : 4096,
"uuid" : "eb6596f0-6c8e-33b8-a8e2-f6609e0a6d86",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/pdb_lib\/_load_libs.cpython-39-darwin.so",
"name" : "_load_libs.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4957061120,
"size" : 24576,
"uuid" : "f9157b35-e0ad-39d9-a2be-d1613dfc0ba2",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/pdb_lib\/lib\/libpdbconnect.dylib",
"name" : "libpdbconnect.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4978274304,
"size" : 36864,
"uuid" : "4d4d6c45-fa58-3cee-b1fd-935c81b3d0b4",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/errorchecker.cpython-39-darwin.so",
"name" : "errorchecker.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4983078912,
"size" : 176128,
"uuid" : "92179bb5-b1e9-3d74-ab97-1ebb7d7ae1e3",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/arraydatatype.cpython-39-darwin.so",
"name" : "arraydatatype.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4983398400,
"size" : 208896,
"uuid" : "02a51b14-39d5-30d0-a9e7-4a9188d5084b",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/wrapper.cpython-39-darwin.so",
"name" : "wrapper.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4980858880,
"size" : 40960,
"uuid" : "fb5796bc-2097-34fd-aa9e-ac5ec077ef6f",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/formathandler.cpython-39-darwin.so",
"name" : "formathandler.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4958339072,
"size" : 32768,
"uuid" : "1da0fbf1-6658-3ab0-bfaf-3ecde710627d",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/latebind.cpython-39-darwin.so",
"name" : "latebind.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4981166080,
"size" : 106496,
"uuid" : "988c7ab9-57c2-3f1f-81f6-58afbd09155f",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/vbo.cpython-39-darwin.so",
"name" : "vbo.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4981088256,
"size" : 32768,
"uuid" : "2260e39a-f951-3ccb-a3d0-b5a148b476ef",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqgif.dylib",
"name" : "libqgif.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4984217600,
"size" : 32768,
"uuid" : "73d7bcd4-8546-396d-a967-2b785956402a",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqwbmp.dylib",
"name" : "libqwbmp.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5033951232,
"size" : 589824,
"uuid" : "3b229f97-2736-3600-b112-046517b55a28",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqwebp.dylib",
"name" : "libqwebp.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5033299968,
"size" : 32768,
"uuid" : "4d459091-8414-3dd9-a319-ee4211c41c4f",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqico.dylib",
"name" : "libqico.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5033377792,
"size" : 32768,
"uuid" : "b29450f6-8c13-3f1e-9427-b5575bbd2213",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqmacheif.dylib",
"name" : "libqmacheif.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5035118592,
"size" : 458752,
"uuid" : "151efa3b-6415-3f4d-a2cd-0dda27471d74",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqjpeg.dylib",
"name" : "libqjpeg.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5035634688,
"size" : 442368,
"uuid" : "3d7ed307-a3b4-3412-85bb-f5632e4815f1",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqtiff.dylib",
"name" : "libqtiff.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5033459712,
"size" : 32768,
"uuid" : "fd611473-3a96-3452-9f7f-3dda20d00245",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqsvg.dylib",
"name" : "libqsvg.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5034602496,
"size" : 245760,
"uuid" : "0813164b-4492-302c-869b-1216dcde7f80",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtSvg.framework\/Versions\/A\/QtSvg",
"name" : "QtSvg"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5033541632,
"size" : 32768,
"uuid" : "ce0d663c-e2e6-390b-9ac5-39b3a57677d4",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqpdf.dylib",
"name" : "libqpdf.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5044768768,
"size" : 8241152,
"uuid" : "14700322-295c-3fb7-baf2-c550dfb64888",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtPdf.framework\/Versions\/A\/QtPdf",
"name" : "QtPdf"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5033619456,
"size" : 32768,
"uuid" : "8015e3fa-97c4-3f06-b195-f49611fc1bb3",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqicns.dylib",
"name" : "libqicns.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5033701376,
"size" : 32768,
"uuid" : "240d6086-fc62-33e6-ba7a-d165f711e209",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqtga.dylib",
"name" : "libqtga.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5033779200,
"size" : 32768,
"uuid" : "37b5a2dc-1384-3311-8590-292529c94730",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqmacjp2.dylib",
"name" : "libqmacjp2.dylib"
},
{
"source" : "P",
"arch" : "x86_64h",
"base" : 5034971136,
"size" : 65536,
"uuid" : "d2da3b5f-f5ba-3ef1-b99d-bc64a8487401",
"path" : "\/usr\/lib\/libobjc-trampolines.dylib",
"name" : "libobjc-trampolines.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 4957024256,
"size" : 4096,
"uuid" : "176a598c-2a97-38a7-82a0-9cee2f55e0b3",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/core\/_mac_util.cpython-39-darwin.so",
"name" : "_mac_util.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5038960640,
"CFBundleShortVersionString" : "3.0",
"CFBundleIdentifier" : "com.apple.security.csparser",
"size" : 98304,
"uuid" : "26a4d257-e0f8-3d9b-be1c-3346667a17ba",
"path" : "\/System\/Library\/Frameworks\/Security.framework\/Versions\/A\/PlugIns\/csparser.bundle\/Contents\/MacOS\/csparser",
"name" : "csparser",
"CFBundleVersion" : "60420.101.4"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5040988160,
"size" : 69632,
"uuid" : "945a985a-b909-351d-bdab-7b4cc3abe896",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/numpy_formathandler.cpython-39-darwin.so",
"name" : "numpy_formathandler.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5040906240,
"size" : 24576,
"uuid" : "31758f9e-950f-3dd3-aabd-b4f95f7234e3",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/nones_formathandler.cpython-39-darwin.so",
"name" : "nones_formathandler.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5054824448,
"size" : 143360,
"uuid" : "809e113e-a9e6-304f-8c5d-9c998d93032c",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/core\/_serialize.cpython-39-darwin.so",
"name" : "_serialize.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5055102976,
"size" : 98304,
"uuid" : "da802e8c-8946-3174-a88d-c460d9f502f9",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/msgpack\/_cmsgpack.cpython-39-darwin.so",
"name" : "_cmsgpack.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5054611456,
"size" : 16384,
"uuid" : "3b220334-2123-365c-babe-beb387dab5ca",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/linalg\/lapack_lite.cpython-39-darwin.so",
"name" : "lapack_lite.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5055307776,
"size" : 77824,
"uuid" : "45e679b6-43af-3a5e-b39a-4521b5380f01",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic\/_ribbons.cpython-39-darwin.so",
"name" : "_ribbons.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5054676992,
"size" : 20480,
"uuid" : "ba973aa3-7e75-3e17-ba66-60209a667b0d",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/graphics\/_graphics.cpython-39-darwin.so",
"name" : "_graphics.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5084790784,
"size" : 454656,
"uuid" : "5a0f30d4-b4ba-316a-8278-78d0c72f5977",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/mmcif\/mmcif.cpython-39-darwin.so",
"name" : "mmcif.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5086867456,
"size" : 446464,
"uuid" : "363f0a7f-8a13-3465-82ee-3a637fe01cc3",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/mmcif\/_mmcif.cpython-39-darwin.so",
"name" : "_mmcif.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5055741952,
"size" : 176128,
"uuid" : "5e4388ca-929a-385d-8f7e-4a6c443b3eab",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/pdb\/_pdbio.cpython-39-darwin.so",
"name" : "_pdbio.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5090922496,
"size" : 1646592,
"uuid" : "f6715553-8e55-3558-821f-aa3230c76581",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/lxml\/etree.cpython-39-darwin.so",
"name" : "etree.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 5056036864,
"size" : 139264,
"uuid" : "39a3906c-1e68-3b4d-b78b-0ba3a985c514",
"path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/lxml\/_elementpath.cpython-39-darwin.so",
"name" : "_elementpath.cpython-39-darwin.so"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 140703275130880,
"size" : 237560,
"uuid" : "08606a44-7008-3658-9f00-6c250b80e9c3",
"path" : "\/usr\/lib\/system\/libsystem_kernel.dylib",
"name" : "libsystem_kernel.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 140703275368448,
"size" : 49152,
"uuid" : "86dfa543-95fa-36b4-83c6-bf03d01b2aad",
"path" : "\/usr\/lib\/system\/libsystem_pthread.dylib",
"name" : "libsystem_pthread.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 140703273979904,
"size" : 557048,
"uuid" : "0773ddbc-707e-3b56-ad3e-97aaa9b2c3ed",
"path" : "\/usr\/lib\/system\/libsystem_c.dylib",
"name" : "libsystem_c.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 140703275565056,
"size" : 40944,
"uuid" : "c99e2bcf-5fa3-3690-9f4b-5e9a08b57343",
"path" : "\/usr\/lib\/system\/libsystem_platform.dylib",
"name" : "libsystem_platform.dylib"
},
{
"size" : 0,
"source" : "A",
"base" : 0,
"uuid" : "00000000-0000-0000-0000-000000000000"
},
{
"source" : "P",
"arch" : "x86_64h",
"base" : 140703275782144,
"CFBundleShortVersionString" : "6.9",
"CFBundleIdentifier" : "com.apple.CoreFoundation",
"size" : 4837360,
"uuid" : "315a3f65-0954-3635-96dc-2f65c691d074",
"path" : "\/System\/Library\/Frameworks\/CoreFoundation.framework\/Versions\/A\/CoreFoundation",
"name" : "CoreFoundation",
"CFBundleVersion" : "1971"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 140703291146240,
"CFBundleShortVersionString" : "6.9",
"CFBundleIdentifier" : "com.apple.Foundation",
"size" : 9998329,
"uuid" : "b2777f39-79a2-3f29-849d-99acb74e4a12",
"path" : "\/System\/Library\/Frameworks\/Foundation.framework\/Versions\/C\/Foundation",
"name" : "Foundation",
"CFBundleVersion" : "1971"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 140703326961664,
"CFBundleShortVersionString" : "6.9",
"CFBundleIdentifier" : "com.apple.AppKit",
"size" : 16809969,
"uuid" : "af96f40f-d333-3647-9da4-eddc52df4753",
"path" : "\/System\/Library\/Frameworks\/AppKit.framework\/Versions\/C\/AppKit",
"name" : "AppKit",
"CFBundleVersion" : "2299.50.120"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 140703438004224,
"CFBundleShortVersionString" : "2.1.1",
"CFBundleIdentifier" : "com.apple.HIToolbox",
"size" : 3112958,
"uuid" : "a6003e8b-72cc-3d98-b569-26102836c61f",
"path" : "\/System\/Library\/Frameworks\/Carbon.framework\/Versions\/A\/Frameworks\/HIToolbox.framework\/Versions\/A\/HIToolbox",
"name" : "HIToolbox"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 140703368060928,
"CFBundleShortVersionString" : "1.22",
"CFBundleIdentifier" : "com.apple.HIServices",
"size" : 376825,
"uuid" : "d5004cb2-8835-3c33-b7f4-31f2bab369ea",
"path" : "\/System\/Library\/Frameworks\/ApplicationServices.framework\/Versions\/A\/Frameworks\/HIServices.framework\/Versions\/A\/HIServices",
"name" : "HIServices"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 140703355510784,
"CFBundleShortVersionString" : "1.600.0",
"CFBundleIdentifier" : "com.apple.SkyLight",
"size" : 4132859,
"uuid" : "d13830de-e60f-353f-948c-8d4adfdbc698",
"path" : "\/System\/Library\/PrivateFrameworks\/SkyLight.framework\/Versions\/A\/SkyLight",
"name" : "SkyLight"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 140703273672704,
"size" : 294900,
"uuid" : "c03e068c-2b62-3aed-9358-e0aa79ff7851",
"path" : "\/usr\/lib\/system\/libdispatch.dylib",
"name" : "libdispatch.dylib"
},
{
"source" : "P",
"arch" : "x86_64",
"base" : 140703271854080,
"size" : 624040,
"uuid" : "f22a1143-9732-3e23-a8b7-cbade6bb8301",
"path" : "\/usr\/lib\/dyld",
"name" : "dyld"
}
],
"sharedCache" : {
"base" : 140703271231488,
"size" : 21474836480,
"uuid" : "5dd9a20c-1502-31aa-84b0-1cda4c95765b"
},
"vmSummary" : "ReadOnly portion of Libraries: Total=1.1G resident=0K(0%) swapped_out_or_unallocated=1.1G(100%)\nWritable regions: Total=2.3G written=0K(0%) resident=0K(0%) swapped_out=0K(0%) unallocated=2.3G(100%)\n\n VIRTUAL REGION \nREGION TYPE SIZE COUNT (non-coalesced) \n=========== ======= ======= \nAccelerate framework 384K 3 \nActivity Tracing 256K 1 \nCG backing stores 2688K 4 \nCG image 192K 30 \nColorSync 260K 29 \nCoreAnimation 140K 18 \nCoreGraphics 16K 3 \nCoreUI image data 3672K 41 \nFoundation 16K 1 \nIOKit 23.3M 3 \nKernel Alloc Once 8K 1 \nMALLOC 1.8G 1290 \nMALLOC guard page 32K 7 \nMALLOC_LARGE (reserved) 384K 1 reserved VM address space (unallocated)\nMach message 16K 3 \nOpenGL GLSL 256K 3 \nSTACK GUARD 116K 29 \nStack 157.7M 30 \nStack Guard 56.0M 1 \nVM_ALLOCATE 242.1M 222 \nVM_ALLOCATE (reserved) 64.0M 1 reserved VM address space (unallocated)\n__CTF 824 1 \n__DATA 47.1M 750 \n__DATA_CONST 52.1M 382 \n__DATA_DIRTY 1786K 220 \n__FONT_DATA 2352 1 \n__GLSLBUILTINS 5174K 1 \n__INFO_FILTER 8 1 \n__LINKEDIT 202.2M 147 \n__OBJC_RO 66.2M 1 \n__OBJC_RW 2012K 2 \n__TEXT 953.4M 753 \ndyld private memory 292K 3 \nmapped file 220.6M 54 \nshared memory 2996K 30 \n=========== ======= ======= \nTOTAL 3.9G 4067 \nTOTAL, minus reserved VM space 3.8G 4067 \n",
"legacyInfo" : {
"threadTriggered" : {
"name" : "CrBrowserMain",
"queue" : "com.apple.main-thread"
}
},
"logWritingSignature" : "97edc9a1de96bf7e065ee6b87ad2c549cb70bfeb",
"trialInfo" : {
"rollouts" : [
{
"rolloutId" : "5ffde50ce2aacd000d47a95f",
"factorPackIds" : {
},
"deploymentId" : 240000271
},
{
"rolloutId" : "62c751b6bcb0435c2153fe92",
"factorPackIds" : {
"SIRI_UNDERSTANDING_ASR_ASSISTANT" : "6317ae3a3d24842ff84fd83f",
"SIRI_UNDERSTANDING_MORPHUN" : "63f00b1c06644d312600c7bd"
},
"deploymentId" : 240000227
}
],
"experiments" : [
{
"treatmentId" : "6dd670af-0633-45e4-ae5f-122ae4df02be",
"experimentId" : "64406ba83deb637ac8a04419",
"deploymentId" : 900000005
},
{
"treatmentId" : "d28d100b-301c-49ae-b6c9-57930102d4d4",
"experimentId" : "64466b09a3b9440a82a18c34",
"deploymentId" : 400000002
}
]
}
}
===== Log before crash start =====
UCSF ChimeraX version: 1.6.1 (2023-05-09)
© 2016-2023 Regents of the University of California. All rights reserved.
> open "/Users/haoyangli/Google
> Drive/Grants/ReVAMPP_2023/Figures/GPCys_Cav_design/Cavity_filling.cxs"
Log from Mon Apr 10 10:20:23 2023UCSF ChimeraX version: 1.1.1 (2020-10-07)
© 2016-2020 Regents of the University of California. All rights reserved.
> open "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/Arenavirumab_3.cxs" format session
Log from Thu Mar 23 14:45:14 2023UCSF ChimeraX version: 1.1.1 (2020-10-07)
© 2016-2020 Regents of the University of California. All rights reserved.
> open "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022_4NAbgroups.cxs"
Log from Sun Jun 5 17:18:41 2022UCSF ChimeraX version: 1.1.1 (2020-10-07)
© 2016-2020 Regents of the University of California. All rights reserved.
> open "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022_4NAbgroups.cxs" format
> session
Log from Sun Jun 5 15:53:35 2022UCSF ChimeraX version: 1.1.1 (2020-10-07)
© 2016-2020 Regents of the University of California. All rights reserved.
> open "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022.cxs"
Log from Sun May 29 16:57:14 2022UCSF ChimeraX version: 1.1.1 (2020-10-07)
© 2016-2020 Regents of the University of California. All rights reserved.
> open "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022.cxs" format session
Log from Sun May 29 14:30:12 2022UCSF ChimeraX version: 1.1.1 (2020-10-07)
© 2016-2020 Regents of the University of California. All rights reserved.
How to cite UCSF ChimeraX
> open "/Users/haoyangli/Google Drive/LASVGP_Arevirumab/EMmaps/final
> models/89F/GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb"
Chain information for
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1
---
Chain | Description
A B C | No description available
H | No description available
L | No description available
O Q S | No description available
P R T | No description available
a b c | No description available
> open "/Users/haoyangli/Google Drive/LASVGP_Arevirumab/EMmaps/final
> models/121F/GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb"
Chain information for
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb #2
---
Chain | Description
A B C | No description available
D F H | No description available
E G L | No description available
O Q S | No description available
P R T | No description available
a b c | No description available
> lighting soft
> set bgColor white
> hide #!2 models
> show #!2 models
> select #1/a#2/a
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> graphics silhouettes true
> color (#!1-2 & sel) #f6c7e3ff
> select #1/b#2/b
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> color (#!1-2 & sel) #ddd4cfff
> select #1/c#2/c
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> color (#!1-2 & sel) #f2e1ffff
> select #1/b#2/b
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> color (#!1-2 & sel) #f6c7e3ff
> select #1/a#2/a
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> color (#!1-2 & sel) #fd6fcfff
> color (#!1-2 & sel) #fd66ffff
> undo
> undo
> color (#!1-2 & sel) #fd67ffff
> color (#!1-2 & sel) #fd70ffff
> color (#!1-2 & sel) #fd80ffff
> color (#!1-2 & sel) #fd84ffff
> color (#!1-2 & sel) #fd8affff
> color (#!1-2 & sel) #fd91ffff
> color (#!1-2 & sel) #fd9fffff
> color (#!1-2 & sel) #fda1ffff
> color (#!1-2 & sel) #fda1ffff
> color (#!1-2 & sel) #fda4ffff
> color (#!1-2 & sel) #fda6ffff
> color (#!1-2 & sel) #feaaffff
> color (#!1-2 & sel) #feb0ffff
> color (#!1-2 & sel) #feb6ffff
> color (#!1-2 & sel) #feb8ffff
> color (#!1-2 & sel) #febaffff
> color (#!1-2 & sel) #febaffff
> color (#!1-2 & sel) #fec2ffff
> color (#!1-2 & sel) #fecdffff
> color (#!1-2 & sel) #fed2ffff
> color (#!1-2 & sel) #ffd8ffff
> color (#!1-2 & sel) #ffdcffff
> color (#!1-2 & sel) #ffe2ffff
> color (#!1-2 & sel) #ffe3ffff
> color (#!1-2 & sel) #ffe5ffff
> color (#!1-2 & sel) #ffe4ffff
> color (#!1-2 & sel) #ffdeffff
> color (#!1-2 & sel) #fecdffff
> color (#!1-2 & sel) #feb6ffff
> color (#!1-2 & sel) #feabffff
> color (#!1-2 & sel) #fda4ffff
> color (#!1-2 & sel) #fd95ffff
> color (#!1-2 & sel) #fd90ffff
> color (#!1-2 & sel) #fd8dffff
> color (#!1-2 & sel) #fd8bffff
> color (#!1-2 & sel) #fd8affff
> color (#!1-2 & sel) #fd90ffff
> color (#!1-2 & sel) #fd91ffff
> color (#!1-2 & sel) #fd96ffff
> color (#!1-2 & sel) #fd98ffff
> color (#!1-2 & sel) #fd9affff
> color (#!1-2 & sel) #fd9cffff
> color (#!1-2 & sel) #fd9dffff
> color (#!1-2 & sel) #fd9dffff
> color (#!1-2 & sel) #fda0ffff
> color (#!1-2 & sel) #fda0ffff
> color (#!1-2 & sel) #f9a0ffff
> color (#!1-2 & sel) #f5a0ffff
> color (#!1-2 & sel) #efa0ffff
> color (#!1-2 & sel) #e9a0ffff
> color (#!1-2 & sel) #e6a0ffff
> color (#!1-2 & sel) #e3a0ffff
> color (#!1-2 & sel) #e2a0ffff
> color (#!1-2 & sel) #e1a0ffff
> color (#!1-2 & sel) #d9a1ffff
> color (#!1-2 & sel) #d6a1ffff
> color (#!1-2 & sel) #d0a1ffff
> color (#!1-2 & sel) #cfa1ffff
> color (#!1-2 & sel) #cea1ffff
> color (#!1-2 & sel) #cea1ffff
> color (#!1-2 & sel) #d8a1ffff
> color (#!1-2 & sel) #efa0ffff
> color (#!1-2 & sel) #fda0ffff
> color (#!1-2 & sel) #c66467ff
> color (#!1-2 & sel) #f67b7eff
> select #1/O#2/O
1944 atoms, 1996 bonds, 250 residues, 2 models selected
> color sel #fecc66ff
> color sel #fd8008ff
> select #1/P#2/P
1586 atoms, 1624 bonds, 208 residues, 2 models selected
> color sel #ffff66ff
> color sel #ffff0aff
> select #1/O#2/O
1944 atoms, 1996 bonds, 250 residues, 2 models selected
> color sel #fecc66ff
> hide sel atoms
> show sel cartoons
Drag select of 34647 atoms, 250 residues, 30 pseudobonds, 3285 bonds
> show sel cartoons
> select #1/a#2/a
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> color (#!1-2 & sel) #fb7c80ff
> color (#!1-2 & sel) #fb7c81ff
> color (#!1-2 & sel) #fb7c87ff
> color (#!1-2 & sel) #fb7c97ff
> color (#!1-2 & sel) #fb7b9eff
> color (#!1-2 & sel) #fb7ba0ff
> color (#!1-2 & sel) #fb7ab0ff
> color (#!1-2 & sel) #fb7ab9ff
> color (#!1-2 & sel) #fb7abeff
> color (#!1-2 & sel) #fb79c6ff
> color (#!1-2 & sel) #fb79c6ff
> color (#!1-2 & sel) #fb7ac3ff
> color (#!1-2 & sel) #fb7ac2ff
> color (#!1-2 & sel) #fb7ac1ff
> color (#!1-2 & sel) #fb7abbff
> color (#!1-2 & sel) #fb7abbff
> color (#!1-2 & sel) #fb7ebbff
> color (#!1-2 & sel) #fb8cbbff
> color (#!1-2 & sel) #fb9dbbff
> color (#!1-2 & sel) #fba5bbff
> color (#!1-2 & sel) #fcb0bbff
> color (#!1-2 & sel) #fcb9bbff
> color (#!1-2 & sel) #fcb7bbff
> color (#!1-2 & sel) #fcb4bbff
> color (#!1-2 & sel) #fbabbbff
> color (#!1-2 & sel) #fba1bbff
> color (#!1-2 & sel) #fb9dbbff
> select #1/P#2/P
1586 atoms, 1624 bonds, 208 residues, 2 models selected
> hide sel atoms
> select clear
> select #1/O#2/O
1944 atoms, 1996 bonds, 250 residues, 2 models selected
> color sel orange
> select #1/P#2/P
1586 atoms, 1624 bonds, 208 residues, 2 models selected
> color sel yellow
Drag select of 21499 atoms, 4260 residues, 30 pseudobonds, 3285 bonds
> show sel surfaces
> select #1/O#2/O
1944 atoms, 1996 bonds, 250 residues, 2 models selected
> color (#!1-2 & sel) orange
> select #1/P#2/P
1586 atoms, 1624 bonds, 208 residues, 2 models selected
> color (#!1-2 & sel) yellow
> select #1/Q#2/Q
1944 atoms, 1996 bonds, 250 residues, 2 models selected
> color (#!1-2 & sel) orange
> hide sel surfaces
> hide sel cartoons
> show sel cartoons
> hide sel atoms
> select #1/P#2/P
1586 atoms, 1624 bonds, 208 residues, 2 models selected
> hide sel surfaces
> hide sel atoms
> select #1/O#2/O
1944 atoms, 1996 bonds, 250 residues, 2 models selected
> hide sel surfaces
> select #1/R#2/R
1586 atoms, 1624 bonds, 208 residues, 2 models selected
> color (#!1-2 & sel) yellow
> hide sel surfaces
> hide sel atoms
> select #1/S#2/S
1944 atoms, 1996 bonds, 250 residues, 2 models selected
> color (#!1-2 & sel) orange
> hide sel surfaces
> hide sel atoms
> select #1/T#2/T
1586 atoms, 1624 bonds, 208 residues, 2 models selected
> color (#!1-2 & sel) yellow
> hide sel surfaces
> hide sel atoms
> sequence chain #2/D#2/F#2/H
Alignment identifier is 1
> color (#!2 & sel) forest green
> hide sel surfaces
> hide sel atoms
> color (#!2 & sel) #fb9dbbff
> color (#!2 & sel) #146626ff
> show sel surfaces
> show sel atoms
> color (#!2 & sel) #146625ff
> color (#!2 & sel) #146626ff
> hide sel atoms
> hide sel surfaces
> sequence chain #2/E#2/G#2/L
Alignment identifier is 1
> color (#!2 & sel) #389c87ff
> hide sel surfaces
> hide sel atoms
> show sel surfaces
> color (#!2 & sel) #21ff80ff
> color (#!2 & sel) #21ff06ff
> color (#!2 & sel) #80ff07ff
> hide sel surfaces
> select #1/H
1048 atoms, 1077 bonds, 135 residues, 1 model selected
> color (#!1 & sel) #80ff07ff
> color (#!1 & sel) #8000ffff
> color (#!1 & sel) #8000ffff
> hide sel surfaces
> hide sel surfaces
> hide sel atoms
> select #1/L
794 atoms, 811 bonds, 108 residues, 1 model selected
> color (#!1 & sel) #8000ffff
> color (#!1 & sel) #982b87ff
> color (#!1 & sel) #fd6fcfff
> color (#!1 & sel) #fc0280ff
> color (#!1 & sel) #fc02ffff
> color (#!1 & sel) #fd66ffff
> color (#!1 & sel) #cc66ffff
> hide sel surfaces
> hide sel surfaces
> hide sel atoms
> select #1/a#2/a
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> color (#!1-2 & sel) #cc66ffff
> color (#!1-2 & sel) #fb9dbbff
> hide sel atoms
> show sel atoms
> select #1/b#2/b
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> color (#!1-2 & sel) #f3b9ddff
> select #1/c#2/c
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> color (#!1-2 & sel) #efd8ffff
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022.cxs"
> select #1/A#2/A
3584 atoms, 3699 bonds, 6 pseudobonds, 422 residues, 4 models selected
> color (#!1-2 & sel) #47a4e4ff
> color (#!1-2 & sel) #47a4e4ff
> color (#!1-2 & sel) #43a4e4ff
> color (#!1-2 & sel) #35a4e4ff
> color (#!1-2 & sel) #24a4e4ff
> color (#!1-2 & sel) #21a4e4ff
> color (#!1-2 & sel) #1ea4e4ff
> color (#!1-2 & sel) #1aa4e4ff
> color (#!1-2 & sel) #1aa4e4ff
> color (#!1-2 & sel) #15a4e4ff
> color (#!1-2 & sel) #14a4e4ff
> color (#!1-2 & sel) #14a4e4ff
> color (#!1-2 & sel) #14a4ecff
> color (#!1-2 & sel) #14a3ffff
> color (#!1-2 & sel) #14a4ffff
> color (#!1-2 & sel) #18c4ffff
> color (#!1-2 & sel) #18c5ffff
> color (#!1-2 & sel) #19cbffff
> color (#!1-2 & sel) #19caffff
> color (#!1-2 & sel) #1bdbffff
> color (#!1-2 & sel) #1de9ffff
> color (#!1-2 & sel) #1de9ffff
> color (#!1-2 & sel) #1fe9ffff
> color (#!1-2 & sel) #5fe8ffff
> color (#!1-2 & sel) #a7e7ffff
> color (#!1-2 & sel) #afe7ffff
> color (#!1-2 & sel) #afe6ffff
> color (#!1-2 & sel) #aeceffff
> color (#!1-2 & sel) #aeceffff
> color (#!1-2 & sel) #aeccffff
> color (#!1-2 & sel) #aecdffff
> select #1/B#2/B
3565 atoms, 3678 bonds, 6 pseudobonds, 420 residues, 4 models selected
> color (#!1-2 & sel) #aecdffff
> color (#!1-2 & sel) #9bb9ffff
> select #1/A#2/A
3584 atoms, 3699 bonds, 6 pseudobonds, 422 residues, 4 models selected
> color (#!1-2 & sel) #9bb9feff
> color (#!1-2 & sel) #9bb9ffff
> select #1/B#2/B
3565 atoms, 3678 bonds, 6 pseudobonds, 420 residues, 4 models selected
> color (#!1-2 & sel) #a5afc4ff
> color (#!1-2 & sel) #d2d6e1ff
> select #1/C#2/C
3609 atoms, 3726 bonds, 6 pseudobonds, 424 residues, 4 models selected
> color (#!1-2 & sel) #d2d6e0ff
> color (#!1-2 & sel) #d2d6e1ff
> select #1/B#2/B
3565 atoms, 3678 bonds, 6 pseudobonds, 420 residues, 4 models selected
> color (#!1-2 & sel) #d2d6e2ff
> color (#!1-2 & sel) #d2d5f5ff
> color (#!1-2 & sel) #d2d5ffff
> color (#!1-2 & sel) #d1d5ffff
> color (#!1-2 & sel) #bad6ffff
> color (#!1-2 & sel) #b6d6ffff
> color (#!1-2 & sel) #b2d6ffff
> color (#!1-2 & sel) #b1d6ffff
> color (#!1-2 & sel) #b1d6ffff
> color (#!1-2 & sel) #b6d6ffff
> color (#!1-2 & sel) #b9d6ffff
> color (#!1-2 & sel) #b9d6ffff
> color (#!1-2 & sel) #b9dbffff
> color (#!1-2 & sel) #baf0ffff
> color (#!1-2 & sel) #baf5ffff
> color (#!1-2 & sel) #baf6ffff
> color (#!1-2 & sel) #bbf6ffff
> color (#!1-2 & sel) #c1f6ffff
> color (#!1-2 & sel) #c7f6ffff
> color (#!1-2 & sel) #caf6ffff
> color (#!1-2 & sel) #cdf6ffff
> color (#!1-2 & sel) #d1f6ffff
> color (#!1-2 & sel) #d3f6ffff
> color (#!1-2 & sel) #d4f6ffff
> color (#!1-2 & sel) #d8f6ffff
> color (#!1-2 & sel) #e3f5ffff
> color (#!1-2 & sel) #e5f5ffff
> color (#!1-2 & sel) #e9f5ffff
> color (#!1-2 & sel) #e8f5ffff
> color (#!1-2 & sel) #d7f6ffff
> color (#!1-2 & sel) #c6f6ffff
> color (#!1-2 & sel) #c6f6ffff
> color (#!1-2 & sel) #c5f6ffff
> color (#!1-2 & sel) #b9f6ffff
> color (#!1-2 & sel) #b8f6ffff
> color (#!1-2 & sel) #b8f6ffff
> color (#!1-2 & sel) #b8f6fcff
> color (#!1-2 & sel) #b8f6f6ff
> color (#!1-2 & sel) #b8f7e9ff
> color (#!1-2 & sel) #b8f7eaff
> color (#!1-2 & sel) #b8f6ffff
> color (#!1-2 & sel) #b8f6ffff
> color (#!1-2 & sel) #b8f3ffff
> color (#!1-2 & sel) #b8efffff
> color (#!1-2 & sel) #b8e8ffff
> color (#!1-2 & sel) #b8e8ffff
> color (#!1-2 & sel) #bce8ffff
> color (#!1-2 & sel) #c2e8ffff
> color (#!1-2 & sel) #cbe8ffff
> color (#!1-2 & sel) #cfe8ffff
> select clear
> hide #!2 models
> select ::name="BMA"::name="FUC"::name="MAN"::name="NAG"
3042 atoms, 3219 bonds, 243 residues, 2 models selected
> show #!2 models
Drag select of
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_A SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_a SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_B SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_b SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_C SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_c SES surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_A SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_a SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_B SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_b SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_C SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_c SES
surface, 13215 atoms, 4260 residues, 30 pseudobonds, 3285 bonds
> hide sel atoms
> show sel cartoons
> select ::name="BMA"::name="FUC"::name="MAN"::name="NAG"
3042 atoms, 3219 bonds, 243 residues, 2 models selected
> show sel atoms
> show sel surfaces
> select #1/A#2/A
3584 atoms, 3699 bonds, 6 pseudobonds, 422 residues, 4 models selected
> color (#!1-2 & sel) #cfe7ffff
> color (#!1-2 & sel) #9bb9ffff
> select #1/B#2/B
3565 atoms, 3678 bonds, 6 pseudobonds, 420 residues, 4 models selected
> color (#!1-2 & sel) #cfe7ffff
> select #1/C#2/C
3609 atoms, 3726 bonds, 6 pseudobonds, 424 residues, 4 models selected
> color (#!1-2 & sel) #d2d6e1ff
> select #1/a#2/a
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> color (#!1-2 & sel) #fb9dbbff
> select #1/b#2/b
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> color (#!1-2 & sel) #f3b9ddff
> select #1/c#2/c
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> color (#!1-2 & sel) #efd8ffff
> select clear
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022.cxs"
> select ::name="BMA"::name="FUC"::name="MAN"::name="NAG"
3042 atoms, 3219 bonds, 243 residues, 2 models selected
> transparency (#!1-2 & sel) 50
> transparency (#!1-2 & sel) 90
> transparency (#!1-2 & sel) 80
> select clear
> hide #!2 models
> graphics silhouettes false
> graphics silhouettes true
> show #!2 models
> hide #!1 models
> mmaker #2/A to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain A (#1) with
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb, chain
A (#2), sequence alignment score = 951.2
Alignment identifier is 1
Showing conservation header ("seq_conservation" residue attribute) for
alignment 1
Hiding conservation header for alignment 1
Chains used in RMSD evaluation for alignment 1:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb #2/A
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 1
RMSD between 184 pruned atom pairs is 0.396 angstroms; (across all 185 pairs:
0.431)
> show #!1 models
> hide #!2 models
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022.cxs"
> select ::name="BMA"::name="FUC"::name="MAN"::name="NAG"
3042 atoms, 3219 bonds, 243 residues, 2 models selected
> style sel & #!1 sphere
Changed 1462 atom styles
> style sel & #!1 ball
Changed 1462 atom styles
> style sel & #!1 stick
Changed 1462 atom styles
> graphics silhouettes false
> graphics silhouettes true
> lighting full
> lighting shadows false
> lighting simple
> lighting full
> lighting shadows false
> graphics silhouettes false
> graphics silhouettes true
> graphics silhouettes false
> graphics silhouettes true
> graphics silhouettes false
> select clear
> graphics silhouettes true
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022.cxs"
> preset cartoons/nucleotides licorice/ovals
Changed 33549 atom styles
Preset expands to these ChimeraX commands:
show nucleic
hide protein|solvent|H
surf hide
style (protein|nucleic|solvent) & @@draw_mode=0 stick
cartoon
cartoon style modeh def arrows t arrowshelix f arrowscale 2 wid 2 thick 0.4 sides 12 div 20
cartoon style ~(nucleic|strand) x round
cartoon style (nucleic|strand) x rect
cartoon style protein modeh default arrows f x round width 1 thick 1
cartoon style nucleic x round width 1.6 thick 1.6
nucleotides tube/slab shape ellipsoid
> show #!2 models
> hide #!1 models
> show #!1 models
> select #1/a#2/a
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> show sel surfaces
> select #1/A#2/A
3584 atoms, 3699 bonds, 6 pseudobonds, 422 residues, 4 models selected
> show sel surfaces
> select #1/B#2/B
3565 atoms, 3678 bonds, 6 pseudobonds, 420 residues, 4 models selected
> show sel surfaces
> select #1/C#2/C
3609 atoms, 3726 bonds, 6 pseudobonds, 424 residues, 4 models selected
> show sel surfaces
> select #1/b#2/b
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> show sel surfaces
> select #1/c#2/c
2877 atoms, 2968 bonds, 4 pseudobonds, 337 residues, 4 models selected
> show sel surfaces
> select clear
> hide #!2 models
> graphics silhouettes false
> graphics silhouettes true
> lighting soft
> graphics silhouettes false
> lighting full
> lighting shadows false
> lighting flat
> lighting soft
> lighting full
> lighting shadows false
> graphics silhouettes false
> lighting simple
> graphics silhouettes true
> lighting full
> lighting shadows false
> lighting soft
> graphics silhouettes false
> graphics silhouettes true
> show #!2 models
> hide #!1 models
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022.cxs"
opened ChimeraX session
> show #!1 models
> hide #!2 models
> show #!2 models
> hide #!2 models
> show #!2 models
> hide #!1 models
> show #!1 models
> hide #!2 models
> show #!2 models
> hide #!1 models
> show #!1 models
> hide #!1 models
> save /Users/haoyangli/Desktop/image1.png supersample 3
> show #!1 models
> hide #!2 models
> save /Users/haoyangli/Desktop/image2.png supersample 3
> show #!2 models
> hide #!1 models
> show #!1 models
> hide #!2 models
> lighting soft
> lighting full
> lighting soft
> save /Users/haoyangli/Desktop/image3.png supersample 3
> hide #!1 models
> show #!2 models
> save /Users/haoyangli/Desktop/image4.png supersample 3
> show #!1 models
> hide #!2 models
> save /Users/haoyangli/Desktop/image5.png supersample 3
> lighting simple
> lighting full
> lighting shadows false
> show #!2 models
> select ::name="BMA"::name="FUC"::name="MAN"::name="NAG"
3042 atoms, 3219 bonds, 243 residues, 2 models selected
> surface hidePatches (#!1-2 & sel)
> style sel ball
Changed 3042 atom styles
> style sel sphere
Changed 3042 atom styles
> hide #!2 models
> style sel & #!1 ball
Changed 1462 atom styles
> color sel & #!1 byhetero
> style sel & #!1 stick
Changed 1462 atom styles
> undo
> undo
> style sel & #!1 stick
Changed 1462 atom styles
> color sel & #!1 byhetero
> show #!2 models
> style sel stick
Changed 3042 atom styles
> color sel byhetero
> hide #!1 models
> undo
> undo
> undo
> undo
> undo
> select clear
> show #!2 models
> select #2
19757 atoms, 20352 bonds, 18 pseudobonds, 2431 residues, 2 models selected
> style sel stick
Changed 19757 atom styles
> select clear
> hide #!1 models
> open "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/7pvd_matriglycan.pdb"
7pvd_matriglycan.pdb title:
Structure of the membrane soluble spike complex from the lassa virus In A
C1-symmetric map focused on the ectodomain [more info...]
Chain information for 7pvd_matriglycan.pdb #3
---
Chain | Description
A B C | PRE-GP-C
a b c | GP2
Non-standard residues in 7pvd_matriglycan.pdb #3
---
BDP — β-D-glucopyranuronic acid (β-D-glucuronic acid; D-glucuronic acid;
glucuronicacid)
NAG — 2-acetamido-2-deoxy-β-D-glucopyranose (N-acetyl-β-D-glucosamine;
2-acetamido-2-deoxy-β-D-glucose; 2-acetamido-2-deoxy-D-glucose;
2-acetamido-2-deoxy-glucose; N-acetyl-D-glucosamine)
XYS — α-D-xylopyranose (α-D-xylose; D-xylose; xylose; xylopyranose)
> mmaker #3/A to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain A (#1) with 7pvd_matriglycan.pdb, chain A (#3), sequence alignment score
= 938.5
Alignment identifier is 1
Showing conservation header ("seq_conservation" residue attribute) for
alignment 1
Hiding conservation header for alignment 1
Chains used in RMSD evaluation for alignment 1:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
7pvd_matriglycan.pdb #3/A
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 1
RMSD between 164 pruned atom pairs is 0.684 angstroms; (across all 183 pairs:
1.309)
> show #!1 models
> hide #!2 models
> hide #!1 models
Drag select of 8902 atoms, 12 pseudobonds, 450 bonds
> hide sel atoms
> select
> ::name="BDP"::name="BMA"::name="FUC"::name="MAN"::name="NAG"::name="XYS"
3598 atoms, 3796 bonds, 286 residues, 3 models selected
> show sel & #!3 atoms
Drag select of 234 atoms, 239 bonds
> hide sel atoms
Drag select of 32 atoms, 30 bonds
> hide sel atoms
Drag select of 69 atoms, 72 bonds
> hide sel atoms
Drag select of 28 atoms, 29 bonds
> hide sel atoms
Drag select of 1 atoms
> hide sel atoms
Drag select of 28 atoms, 29 bonds
> hide sel atoms
Drag select of 28 atoms, 29 bonds
> hide sel atoms
> show #!1 models
> select #3
8902 atoms, 9139 bonds, 12 pseudobonds, 1078 residues, 2 models selected
> hide #!1 models
Drag select of 136 atoms
> style sel stick
Changed 136 atom styles
> select clear
Drag select of 136 atoms, 148 bonds
> color sel byhetero
> select clear
> show #!1 models
> open "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/7pvd_matriglycan1.pdb"
7pvd_matriglycan1.pdb title:
Structure of the membrane soluble spike complex from the lassa virus In A
C1-symmetric map focused on the ectodomain [more info...]
Chain information for 7pvd_matriglycan1.pdb #4
---
Chain | Description
A B C | PRE-GP-C
a b c | GP2
Non-standard residues in 7pvd_matriglycan1.pdb #4
---
BDP — β-D-glucopyranuronic acid (β-D-glucuronic acid; D-glucuronic acid;
glucuronicacid)
NAG — 2-acetamido-2-deoxy-β-D-glucopyranose (N-acetyl-β-D-glucosamine;
2-acetamido-2-deoxy-β-D-glucose; 2-acetamido-2-deoxy-D-glucose;
2-acetamido-2-deoxy-glucose; N-acetyl-D-glucosamine)
XYS — α-D-xylopyranose (α-D-xylose; D-xylose; xylose; xylopyranose)
Associated 7pvd_matriglycan1.pdb chain A to 7pvd_matriglycan.pdb, chain A with
0 mismatches
Associated 7pvd_matriglycan1.pdb chain B to 7pvd_matriglycan.pdb, chain A with
0 mismatches
Associated 7pvd_matriglycan1.pdb chain C to 7pvd_matriglycan.pdb, chain A with
0 mismatches
Chains used in RMSD evaluation for alignment 1:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
7pvd_matriglycan.pdb #3/A, 7pvd_matriglycan1.pdb #4/C
> mmaker #4/A to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain A (#1) with 7pvd_matriglycan1.pdb, chain A (#4), sequence alignment
score = 938.5
Alignment identifier is 2
Showing conservation header ("seq_conservation" residue attribute) for
alignment 2
Hiding conservation header for alignment 2
Chains used in RMSD evaluation for alignment 2:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
7pvd_matriglycan1.pdb #4/A
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 2
RMSD between 164 pruned atom pairs is 0.684 angstroms; (across all 183 pairs:
1.309)
Chains used in RMSD evaluation for alignment 1:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
7pvd_matriglycan.pdb #3/A, 7pvd_matriglycan1.pdb #4/A
> hide #!4 models
> show #!4 models
> hide #!3 models
> hide #!1 models
> show #!3 models
> show #!1 models
> hide #!4 models
> hide #!1 models
> show #!4 models
> select #4
8902 atoms, 9139 bonds, 12 pseudobonds, 1078 residues, 2 models selected
> hide #!3 models
> interfaces sel & ~solvent
15 buried areas: C c 2495, B b 2457, A a 2421, B C 1133, A B 1112, A C 1105, a
b 670, c a 659, c b 650, C a 515, B c 499, A b 468, B M 373, A M 369, C M 361
> hide sel atoms
> show sel cartoons
> select ::name="NAG"
2674 atoms, 2757 bonds, 191 residues, 4 models selected
> show sel & #!4 atoms
> hide sel & #!4 atoms
> undo
> show #!1 models
> hide #!4 models
> select clear
> show #!2 models
> hide #!2 models
> hide #!1 models
> show #!3 models
> show #!4 models
Drag select of 272 atoms, 148 bonds
> style sel stick
Changed 272 atom styles
> color sel yellow
> select clear
> hide #!3 models
> hide #!4 models
> show #!4 models
> show #!3 models
> hide #!4 models
> show #!4 models
> select #4
8902 atoms, 9139 bonds, 12 pseudobonds, 1078 residues, 2 models selected
> show sel cartoons
> color sel red
> color sel yellow
> select #4
8902 atoms, 9139 bonds, 12 pseudobonds, 1078 residues, 2 models selected
> show sel cartoons
> select #4/A:119
8 atoms, 7 bonds, 1 residue, 1 model selected
> show sel atoms
> select #4/B:119
8 atoms, 7 bonds, 1 residue, 1 model selected
> show sel atoms
> select #4/C:119
8 atoms, 7 bonds, 1 residue, 1 model selected
> show sel atoms
Drag select of 287 atoms, 296 bonds, 1035 residues, 12 pseudobonds
> style sel stick
Changed 8618 atom styles
> select clear
> select #3/a#3/b#3/c#4/a#4/b#4/c
7956 atoms, 8148 bonds, 972 residues, 2 models selected
> hide sel cartoons
> select #4/C:150
12 atoms, 12 bonds, 1 residue, 1 model selected
> show sel atoms
> select #4/C:117
11 atoms, 11 bonds, 1 residue, 1 model selected
> show sel atoms
> select #4/B:117
11 atoms, 11 bonds, 1 residue, 1 model selected
> show sel atoms
> select #4/B:150
12 atoms, 12 bonds, 1 residue, 1 model selected
> show sel atoms
> select #4/A:150
12 atoms, 12 bonds, 1 residue, 1 model selected
> show sel atoms
> select #4/A:117
11 atoms, 11 bonds, 1 residue, 1 model selected
> show sel atoms
> select #4/A:121
6 atoms, 5 bonds, 1 residue, 1 model selected
> show sel atoms
> select #4/B:121
6 atoms, 5 bonds, 1 residue, 1 model selected
> show sel atoms
> select #4/C:121
6 atoms, 5 bonds, 1 residue, 1 model selected
> show sel atoms
> select #4/B:258
8 atoms, 7 bonds, 1 residue, 1 model selected
> show sel atoms
> show sel atoms
> show sel atoms
> select clear
> style sel sphere
Changed 136 atom styles
> style sel ball
Changed 136 atom styles
> color sel byhetero
> show #!1 models
> hide #!3 models
> hide #!4 models
> show #!4 models
> hide #!4 models
> show #!3 models
> select #4
8902 atoms, 9139 bonds, 12 pseudobonds, 1078 residues, 2 models selected
> hide #!3 models
> select #1
16834 atoms, 17320 bonds, 12 pseudobonds, 2072 residues, 2 models selected
> interfaces sel & ~solvent
22 buried areas: B b 2729, A a 2689, C c 2678, A B 1223, C A 1187, C B 1171, c
S 929, b Q 917, a O 900, H L 822, Q R 799, O P 794, S T 793, b c 704, a c 687,
a b 687, A b 615, B c 615, C a 580, C L 558, A H 549, C H 394
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022.cxs"
> select clear
> show #!3 models
> select clear
> mmaker #3/c to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain A (#1) with 7pvd_matriglycan.pdb, chain c (#3), sequence alignment score
= 32.8
Alignment identifier is 1
Showing conservation header ("seq_conservation" residue attribute) for
alignment 1
Hiding conservation header for alignment 1
Chains used in RMSD evaluation for alignment 1:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
7pvd_matriglycan.pdb #3/c
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 1
RMSD between 5 pruned atom pairs is 1.243 angstroms; (across all 129 pairs:
20.414)
> undo
> select clear
> mmaker #3/C to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain A (#1) with 7pvd_matriglycan.pdb, chain C (#3), sequence alignment score
= 938.5
Alignment identifier is 2
Showing conservation header ("seq_conservation" residue attribute) for
alignment 2
Hiding conservation header for alignment 2
Chains used in RMSD evaluation for alignment 2:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
7pvd_matriglycan.pdb #3/C
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 2
RMSD between 164 pruned atom pairs is 0.684 angstroms; (across all 183 pairs:
1.309)
> mmaker #3/B to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain A (#1) with 7pvd_matriglycan.pdb, chain B (#3), sequence alignment score
= 938.5
Alignment identifier is 1
Showing conservation header ("seq_conservation" residue attribute) for
alignment 1
Hiding conservation header for alignment 1
Chains used in RMSD evaluation for alignment 1:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
7pvd_matriglycan.pdb #3/B
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 1
RMSD between 164 pruned atom pairs is 0.684 angstroms; (across all 183 pairs:
1.309)
> mmaker #3/A to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain A (#1) with 7pvd_matriglycan.pdb, chain A (#3), sequence alignment score
= 938.5
Alignment identifier is 2
Showing conservation header ("seq_conservation" residue attribute) for
alignment 2
Hiding conservation header for alignment 2
Chains used in RMSD evaluation for alignment 2:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
7pvd_matriglycan.pdb #3/A
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 2
RMSD between 164 pruned atom pairs is 0.684 angstroms; (across all 183 pairs:
1.309)
> mmaker #3/C to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain A (#1) with 7pvd_matriglycan.pdb, chain C (#3), sequence alignment score
= 938.5
Alignment identifier is 1
Showing conservation header ("seq_conservation" residue attribute) for
alignment 1
Hiding conservation header for alignment 1
Chains used in RMSD evaluation for alignment 1:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
7pvd_matriglycan.pdb #3/C
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 1
RMSD between 164 pruned atom pairs is 0.684 angstroms; (across all 183 pairs:
1.309)
> mmaker #4/C to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain A (#1) with 7pvd_matriglycan1.pdb, chain C (#4), sequence alignment
score = 938.5
Alignment identifier is 2
Showing conservation header ("seq_conservation" residue attribute) for
alignment 2
Hiding conservation header for alignment 2
Chains used in RMSD evaluation for alignment 2:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
7pvd_matriglycan1.pdb #4/C
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 2
RMSD between 164 pruned atom pairs is 0.684 angstroms; (across all 183 pairs:
1.309)
> select #3
8902 atoms, 9139 bonds, 12 pseudobonds, 1078 residues, 2 models selected
> style sel ball
Changed 8902 atom styles
> select clear
> show #!4 models
> hide #!3 models
> hide #!1 models
> select #4/A
1512 atoms, 1549 bonds, 4 pseudobonds, 187 residues, 2 models selected
> color (#!4 & sel) #ffff0aff
> color (#!4 & sel) #cfe7ffff
> select #4/B
1512 atoms, 1549 bonds, 4 pseudobonds, 187 residues, 2 models selected
> color (#!4 & sel) #d2d6e1ff
> select #4/C
1512 atoms, 1549 bonds, 4 pseudobonds, 187 residues, 2 models selected
> lighting soft
> color (#!4 & sel) #9bb9ffff
> select clear
Drag select of 282 atoms, 455 residues, 6 pseudobonds, 277 bonds
> style sel sphere
Changed 3795 atom styles
> select clear
> style sel ball
Changed 136 atom styles
> color sel yellow
> select clear
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022.cxs"
opened ChimeraX session
> show #!1 models
> hide #!4 models
> show #!2 models
> hide #!2 models
> hide #!1 models
> show #!2 models
> show #!1 models
> hide #!2 models
> hide #!1 models
> open "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/CysRRLL_INOG_NSmaps/2510C-LIV-LASV-12bGP.pdb"
Summary of feedback from opening /Users/haoyangli/Google
Drive/LASVGP_Arevirumab/EMmaps/CysRRLL_INOG_NSmaps/2510C-LIV-LASV-12bGP.pdb
---
warnings | Start residue of secondary structure not found: HELIX 46 46 ASN 1
162 GLY 1 164 5 3
Start residue of secondary structure not found: HELIX 47 47 SER 1 193 GLY 1
197 5 5
Start residue of secondary structure not found: HELIX 48 48 ASN 2 162 GLY 2
164 5 3
Start residue of secondary structure not found: HELIX 49 49 SER 2 193 GLY 2
197 5 5
Start residue of secondary structure not found: HELIX 50 50 ASN 3 162 GLY 3
164 5 3
22 messages similar to the above omitted
Cannot find LINK/SSBOND residue CYS (147 )
Cannot find LINK/SSBOND residue CYS (147 )
Cannot find LINK/SSBOND residue CYS (147 )
Chain information for 2510C-LIV-LASV-12bGP.pdb #5
---
Chain | Description
A B C | No description available
D G J | No description available
E H K | No description available
> preset cartoons/nucleotides licorice/ovals
Changed 20321 atom styles
Preset expands to these ChimeraX commands:
show nucleic
hide protein|solvent|H
surf hide
style (protein|nucleic|solvent) & @@draw_mode=0 stick
cartoon
cartoon style modeh def arrows t arrowshelix f arrowscale 2 wid 2 thick 0.4 sides 12 div 20
cartoon style ~(nucleic|strand) x round
cartoon style (nucleic|strand) x rect
cartoon style protein modeh default arrows f x round width 1 thick 1
cartoon style nucleic x round width 1.6 thick 1.6
nucleotides tube/slab shape ellipsoid
Drag select of 198 residues, 2 pseudobonds
> delete atoms (#!5 & sel)
> delete bonds (#!5 & sel)
Drag select of 204 residues, 2 pseudobonds
Drag select of 197 residues, 2 pseudobonds
> delete atoms (#!5 & sel)
> delete bonds (#!5 & sel)
Drag select of 198 residues, 2 pseudobonds
> delete atoms (#!5 & sel)
> delete bonds (#!5 & sel)
> select clear
> show #!1 models
> show #!2 models
> hide #!2 models
> hide #!1 models
> hide #!5 models
> show #!1 models
> show #!2 models
> mmaker #2/A to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain A (#1) with
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb, chain
A (#2), sequence alignment score = 951.2
Alignment identifier is 1
Showing conservation header ("seq_conservation" residue attribute) for
alignment 1
Hiding conservation header for alignment 1
Chains used in RMSD evaluation for alignment 1:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb #2/A
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 1
RMSD between 184 pruned atom pairs is 0.396 angstroms; (across all 185 pairs:
0.431)
> mmaker #5/A to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain A (#1) with 2510C-LIV-LASV-12bGP.pdb, chain A (#5), sequence alignment
score = 712
Alignment identifier is 1
Showing conservation header ("seq_conservation" residue attribute) for
alignment 1
Hiding conservation header for alignment 1
Chains used in RMSD evaluation for alignment 1:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
2510C-LIV-LASV-12bGP.pdb #5/A
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 1
RMSD between 143 pruned atom pairs is 0.779 angstroms; (across all 162 pairs:
11.121)
> show #!5 models
> hide #!2 models
> show #!2 models
> hide #!1 models
> hide #!2 models
> show #!2 models
> mmaker #5 to #1 showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain C (#1) with 2510C-LIV-LASV-12bGP.pdb, chain A (#5), sequence alignment
score = 713.8
Alignment identifier is 2
Showing conservation header ("seq_conservation" residue attribute) for
alignment 2
Hiding conservation header for alignment 2
Chains used in RMSD evaluation for alignment 2:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/C,
2510C-LIV-LASV-12bGP.pdb #5/A
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 2
RMSD between 142 pruned atom pairs is 0.722 angstroms; (across all 162 pairs:
11.225)
> show #!1 models
> hide #!2 models
> hide #!1 models
> show #!1 models
> ui mousemode right "rotate selected models"
> select #5
12664 atoms, 12961 bonds, 36 pseudobonds, 1573 residues, 2 models selected
> mmaker #5/A to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain A (#1) with 2510C-LIV-LASV-12bGP.pdb, chain A (#5), sequence alignment
score = 712
Alignment identifier is 1
Showing conservation header ("seq_conservation" residue attribute) for
alignment 1
Hiding conservation header for alignment 1
Chains used in RMSD evaluation for alignment 1:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/A,
2510C-LIV-LASV-12bGP.pdb #5/A
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 1
RMSD between 143 pruned atom pairs is 0.779 angstroms; (across all 162 pairs:
11.121)
> select clear
> show #!2 models
> hide #!1 models
Drag select of 2066 atoms, 3841 residues, 54 pseudobonds, 2175 bonds
> show #!1 models
> select clear
Drag select of 3528 atoms, 5797 residues, 66 pseudobonds, 3720 bonds
> show sel surfaces
> select clear
> hide #!2 models
> hide #!1 models
> select #5
12664 atoms, 12961 bonds, 36 pseudobonds, 1573 residues, 2 models selected
> hide sel cartoons
> hide sel cartoons
> show sel cartoons
> hide sel surfaces
Drag select of 324 atoms, 1055 residues, 26 pseudobonds, 334 bonds
Drag select of 118 atoms, 251 residues, 123 bonds
Drag select of 324 atoms, 1087 residues, 26 pseudobonds, 334 bonds
> hide sel cartoons
> hide sel atoms
> select #5/A
2527 atoms, 2590 bonds, 12 pseudobonds, 305 residues, 2 models selected
> hide sel cartoons
> hide sel atoms
> select clear
Drag select of 220 residues
> select clear
> show #!1 models
> show #!2 models
> hide #!2 models
> hide #!1 models
Drag select of 220 residues
Alignment identifier is 5/D
Alignment identifier is 5/E
> show #!1 models
> hide #!1 models
> color (#!5 & sel) dim gray
> show sel surfaces
> color (#!5 & sel) #808003ff
> color (#!5 & sel) #996633ff
> color (#!5 & sel) #808003ff
> color (#!5 & sel) #808003ff
> color (#!5 & sel) #838003ff
> color (#!5 & sel) #8d8004ff
> color (#!5 & sel) #928004ff
> color (#!5 & sel) #977f04ff
> color (#!5 & sel) #9a7f04ff
> color (#!5 & sel) #9b7f04ff
> color (#!5 & sel) #9d7f04ff
> color (#!5 & sel) #a27f04ff
> color (#!5 & sel) #a27f04ff
> color (#!5 & sel) #a47f04ff
> color (#!5 & sel) #a47f05ff
> color (#!5 & sel) #a47f08ff
> color (#!5 & sel) #a47f0dff
> color (#!5 & sel) #a47f15ff
> color (#!5 & sel) #a47f19ff
> color (#!5 & sel) #a47f1cff
> color (#!5 & sel) #a47f24ff
> color (#!5 & sel) #a47f25ff
> color (#!5 & sel) #a47f2cff
> color (#!5 & sel) #a47f2fff
> color (#!5 & sel) #a47f30ff
> color (#!5 & sel) #a47f31ff
> color (#!5 & sel) #a47f35ff
> color (#!5 & sel) #a47f35ff
> color (#!5 & sel) #a47f35ff
> color (#!5 & sel) #a48635ff
> color (#!5 & sel) #a48e35ff
> color (#!5 & sel) #a59b35ff
> color (#!5 & sel) #a5ad36ff
> color (#!5 & sel) #a6ba36ff
> color (#!5 & sel) #a6b936ff
> color (#!5 & sel) #a5b636ff
> color (#!5 & sel) #a59b35ff
> color (#!5 & sel) #a48835ff
> color (#!5 & sel) #a48635ff
> color (#!5 & sel) #a48535ff
> color (#!5 & sel) #a48435ff
> color (#!5 & sel) #a48435ff
> color (#!5 & sel) #a18435ff
> color (#!5 & sel) #9a8435ff
> color (#!5 & sel) #928435ff
> color (#!5 & sel) #8e8435ff
> color (#!5 & sel) #8c8435ff
> show sel surfaces
> color (#!5 & sel) dim gray
> select clear
> show #!2 models
> show #!1 models
> ui tool show "Show Sequence Viewer"
> sequence chain #5/D #5/G #5/J
Alignment identifier is 1
> sequence chain #5/E #5/H #5/K
Alignment identifier is 2
> hide #!1 models
> hide #!2 models
> show sel cartoons
> show sel surfaces
> color (#!5 & sel) dim gray
> show sel cartoons
> show sel surfaces
> color (#!5 & sel) light gray
> select clear
> show #!1 models
> show #!2 models
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022_4NAbgroups.cxs"
> hide #!2 models
> mmaker #5/B to #1/B showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb,
chain B (#1) with 2510C-LIV-LASV-12bGP.pdb, chain B (#5), sequence alignment
score = 710.2
Alignment identifier is 3
Showing conservation header ("seq_conservation" residue attribute) for
alignment 3
Hiding conservation header for alignment 3
Chains used in RMSD evaluation for alignment 3:
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb #1/B,
2510C-LIV-LASV-12bGP.pdb #5/B
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 3
RMSD between 141 pruned atom pairs is 0.727 angstroms; (across all 162 pairs:
11.175)
> show #!2 models
> hide #!5 models
> hide #!1 models
> show #!5 models
> hide #!2 models
Drag select of 2510C-LIV-LASV-12bGP.pdb_D SES surface, 2510C-LIV-
LASV-12bGP.pdb_E SES surface, 2510C-LIV-LASV-12bGP.pdb_G SES surface,
2510C-LIV-LASV-12bGP.pdb_H SES surface, 2510C-LIV-LASV-12bGP.pdb_J SES
surface, 2510C-LIV-LASV-12bGP.pdb_K SES surface, 658 residues
> hide sel surfaces
> select clear
> show #!2 models
> hide #!2 models
> hide #!5 models
> show #!2 models
> ui tool show "Show Sequence Viewer"
> sequence chain #2/D #2/F #2/H
Alignment identifier is 3
> sequence chain #2/E #2/G #2/L
Alignment identifier is 4
> hide sel surfaces
> hide sel cartoons
> show sel cartoons
> hide sel surfaces
> ui tool show "Show Sequence Viewer"
> sequence chain #1/H
Alignment identifier is 1/H
> sequence chain #1/L
Alignment identifier is 1/L
> sequence chain #1/O #1/Q #1/S #2/O #2/Q #2/S
Alignment identifier is 5
> sequence chain #1/P #1/R #1/T #2/P #2/R #2/T
Alignment identifier is 6
> show #!1 models
> hide sel surfaces
> hide sel surfaces
> hide sel surfaces
> hide sel surfaces
> select clear
> show #!5 models
> lighting flat
> lighting full
> lighting shadows false
> lighting soft
> graphics silhouettes false
> select
> ::name="BDP"::name="BMA"::name="FUC"::name="MAN"::name="NAG"::name="XYS"
4640 atoms, 4874 bonds, 365 residues, 5 models selected
> style sel & #!1-2,5 ball
Changed 3528 atom styles
> style sel & #!1-2,5 sphere
Changed 3528 atom styles
> style sel & #!1-2,5 ball
Changed 3528 atom styles
> select clear
> hide #!1 models
> hide #!2 models
> hide #!5 models
> show #!1 models
> graphics silhouettes true
> lighting simple
> graphics silhouettes false
> lighting soft
> lighting simple
> graphics silhouettes true
> show #!2 models
> show #!5 models
> hide #!5 models
> hide #!2 models
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022_4NAbgroups.cxs"
Drag select of
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_A SES surface,
185899 of 206614 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_a SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_B SES surface,
186612 of 207034 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_b SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_C SES surface,
179441 of 201420 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_c SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_A SES surface,
39602 of 60532 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_a SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_B SES surface,
41468 of 55838 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_b SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_C SES surface,
40934 of 63382 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_c SES surface,
1181 atoms, 1698 residues, 12 pseudobonds, 1248 bonds
Drag select of
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_A SES surface,
173862 of 206614 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_a SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_B SES surface,
178085 of 207034 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_b SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_C SES surface,
162518 of 201420 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_c SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_A SES surface,
36550 of 60532 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_a SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_B SES surface,
40274 of 55838 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_b SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_C SES surface,
34334 of 63382 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_c SES surface,
1128 atoms, 1663 residues, 12 pseudobonds, 1190 bonds
Drag select of
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_A SES surface,
150102 of 206614 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_a SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_B SES surface,
154359 of 207034 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_b SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_C SES surface,
140016 of 201420 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_c SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_A SES surface,
30074 of 60532 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_a SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_B SES surface,
35404 of 55838 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_b SES surface,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_C SES surface,
23869 of 63382 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_c SES surface,
1029 atoms, 1592 residues, 10 pseudobonds, 1083 bonds
> hide sel atoms
> hide sel cartoons
> hide sel surfaces
Drag select of
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_A SES surface,
41668 of 206614 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_B SES surface,
5650 of 207034 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_C SES surface,
32362 of 201420 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_A SES surface,
30872 of 60532 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_C SES surface,
17329 of 63382 triangles, 229 atoms, 181 residues, 239 bonds
> hide sel atoms
> hide sel cartoons
> hide sel surfaces
> select #1/C
1814 atoms, 1872 bonds, 2 pseudobonds, 214 residues, 2 models selected
> hide sel surfaces
> hide sel cartoons
> select clear
Drag select of
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_A SES surface,
6570 of 206614 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_B SES surface,
37147 of 207034 triangles,
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_B SES surface,
17497 of 55838 triangles, 82 atoms, 41 residues, 84 bonds
> hide sel cartoons
> hide sel surfaces
> hide sel atoms
Drag select of
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_B SES surface,
2541 of 55838 triangles, 12 atoms, 12 bonds
> hide sel cartoons
> hide sel atoms
> hide sel surfaces
Drag select of 39 atoms, 41 bonds
> hide sel atoms
> show sel cartoons
> show sel cartoons
> hide sel cartoons
Drag select of 71 atoms, 76 bonds
> show sel surfaces
> show sel cartoons
> select clear
> show #!2 models
> hide #!1 models
> show #!1 models
> hide #!2 models
> hide #!1 models
> show #!2 models
Drag select of
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_C SES
surface, 337 of 206924 triangles,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_B SES
surface, 730 of 64992 triangles,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_C SES
surface, 6913 of 67888 triangles, 37 atoms, 37 bonds
Drag select of
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_C SES
surface, 10045 of 206924 triangles,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_C SES
surface, 10974 of 67888 triangles, 50 atoms, 8 residues, 52 bonds
> hide sel surfaces
> hide sel atoms
Drag select of
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_A SES
surface, 488 of 204572 triangles,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_B SES
surface, 8383 of 205288 triangles,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_C SES
surface, 61096 of 206924 triangles,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_c SES
surface, 66235 of 178986 triangles,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_C SES
surface, 4827 of 67888 triangles,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_c SES
surface, 6891 of 46184 triangles, 47 atoms, 176 residues, 2 pseudobonds, 52
bonds
> show sel surfaces
> select clear
> show #!1 models
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022_4NAbgroups.cxs"
> show #!5 models
> hide #!5 models
> select #2/F:22
6 atoms, 5 bonds, 1 residue, 1 model selected
> select clear
> lighting soft
> graphics silhouettes false
> show #!5 models
> hide #!5 models
> graphics silhouettes true
> graphics silhouettes false
> graphics silhouettes true
> lighting full
> lighting flat
> lighting full
> lighting flat
> lighting flat
> lighting shadows true intensity 0.5
> lighting shadows false
> lighting full
> lighting soft
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022_4NAbgroups.cxs"
opened ChimeraX session
> show sel cartoons
> show sel cartoons
> show sel cartoons
> select clear
> hide #!1 models
> show #!1 models
> graphics silhouettes false
> graphics silhouettes true
> lighting flat
> graphics silhouettes false
> lighting flat
> lighting full
> lighting shadows false
> graphics silhouettes false
> graphics silhouettes true
> lighting simple
> graphics silhouettes false
> graphics silhouettes true
> lighting soft
> graphics silhouettes false
> graphics silhouettes true
> save /Users/haoyangli/Desktop/image1.png supersample 3
> lighting simple
> lighting shadows true
> lighting shadows false
> save /Users/haoyangli/Desktop/image2.png supersample 3
> hide sel cartoons
> hide sel cartoons
> lighting soft
> lighting simple
> lighting full
> lighting shadows false
> graphics silhouettes false
> graphics silhouettes true
> lighting soft
> lighting simple
> lighting soft
> hide #!1 models
> show #!1 models
> lighting simple
> save /Users/haoyangli/Desktop/image1.png supersample 3
> lighting soft
> save /Users/haoyangli/Desktop/image2.png supersample 3
> hide #!1 models
> show #!1 models
> save /Users/haoyangli/Desktop/image3.png supersample 3
> hide #!1 models
> select #2/F
777 atoms, 805 bonds, 97 residues, 1 model selected
> hide sel cartoons
> select #2/G
813 atoms, 834 bonds, 106 residues, 1 model selected
> hide sel cartoons
> show sel & #!2 cartoons
> show sel & #!2 cartoons
> select clear
> show #!1 models
> hide #!1 models
> show #!1 models
> hide #!1 models
> show #!1 models
> save /Users/haoyangli/Desktop/image4.png supersample 3
Drag select of
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_C SES surface,
14490 of 63382 triangles,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_A SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_a SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_B SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_b SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_C SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_c SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_A SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_a SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_B SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_b SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_C SES
surface, 57596 of 67888 triangles,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_c SES
surface, 1602 atoms, 2344 residues, 1698 bonds, 18 pseudobonds
> select clear
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022_4NAbgroups.cxs"
Drag select of
GP_89F_372D_04282022_067_coot_real_space_refined_069(final).pdb_C SES surface,
14490 of 63382 triangles,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_A SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_a SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_B SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_b SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_C SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_c SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_A SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_a SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_B SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_b SES
surface,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_C SES
surface, 57596 of 67888 triangles,
GPFL_121F_372D_04132022_057_coot_new2_real_space_refined_070(final).pdb_c SES
surface, 1602 atoms, 2344 residues, 1698 bonds, 18 pseudobonds
> show sel surfaces
> select clear
> graphics silhouettes false
> graphics silhouettes true
> save /Users/haoyangli/Desktop/image5.png supersample 3
> save /Users/haoyangli/Desktop/image6.png supersample 3
> show #!4 models
> hide #!4 models
> show #!5 models
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022_4NAbgroups.cxs"
> hide #!1 models
> hide #!5 models
> hide sel & #!2 cartoons
> hide sel & #!2 surfaces
> hide sel & #!2 cartoons
> hide sel & #!2 surfaces
> hide sel surfaces
> hide sel cartoons
> hide sel cartoons
> hide sel surfaces
> show #!1 models
> hide sel cartoons
> hide sel surfaces
> hide sel surfaces
> hide sel cartoons
> show #!5 models
> hide #!5 models
> show #!5 models
> hide #!5 models
> show sel cartoons
> show sel cartoons
> select clear
> select #5/D
916 atoms, 936 bonds, 117 residues, 1 model selected
> show #!1-2 cartoons
> undo
> select clear
> show #!5 models
> hide #!2 models
> show #!2 models
> hide #!2 models
> hide #!1 models
Drag select of 219 residues
> hide sel cartoons
Drag select of 220 residues
> hide sel cartoons
> show #!1 models
> show #!2 models
> color (#!5 & sel) #8b8435ff
> color (#!5 & sel) #808003ff
> select clear
> select #2/D
777 atoms, 805 bonds, 97 residues, 1 model selected
> show sel cartoons
> select #2/E
813 atoms, 834 bonds, 106 residues, 1 model selected
> show sel cartoons
> select #2/R
793 atoms, 812 bonds, 104 residues, 1 model selected
> show sel cartoons
> hide sel cartoons
> select #2/Q
972 atoms, 998 bonds, 125 residues, 1 model selected
> show sel cartoons
> hide sel cartoons
> select #2/O
972 atoms, 998 bonds, 125 residues, 1 model selected
> show sel cartoons
> select #2/P
793 atoms, 812 bonds, 104 residues, 1 model selected
> show sel cartoons
> select clear
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022_4NAbgroups.cxs"
> graphics silhouettes false
> lighting soft
> lighting full
> lighting shadows false
> lighting flat
> lighting soft
> lighting simple
> lighting shadows true
> lighting shadows false
> lighting soft
> graphics silhouettes false
> save /Users/haoyangli/Desktop/image7.png supersample 3
> save /Users/haoyangli/Desktop/image1.png supersample 3
> graphics silhouettes true
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/NativeGP_May29_2022_4NAbgroups.cxs"
opened ChimeraX session
> hide sel cartoons
> hide sel cartoons
> show sel cartoons
> show sel cartoons
> show sel cartoons
> show sel cartoons
> select #2/F
777 atoms, 805 bonds, 97 residues, 1 model selected
> hide sel cartoons
> select #2/G
813 atoms, 834 bonds, 106 residues, 1 model selected
> hide sel cartoons
> graphics silhouettes false
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/Arenavirumab_3.cxs"
opened ChimeraX session
> hide #!1 models
> hide #!5 models
> preset cartoons/nucleotides ribbons/slabs
Changed 0 atom styles
Preset expands to these ChimeraX commands:
show nucleic
hide protein|solvent|H
surf hide
style (protein|nucleic|solvent) & @@draw_mode=0 stick
cartoon
cartoon style modeh def arrows t arrowshelix f arrowscale 2 wid 2 thick 0.4 sides 12 div 20
cartoon style ~(nucleic|strand) x round
cartoon style (nucleic|strand) x rect
nucleotides tube/slab shape box
> hide sel cartoons
> hide sel cartoons
> hide sel & #!2 cartoons
> hide sel & #!2 cartoons
> select clear
> graphics silhouettes true
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/CysRRLL_INOG_NSmaps/Cavity_filling.cxs"
> show #!1 models
> hide #!2 models
Drag select of 220 residues
> hide sel cartoons
Drag select of 220 residues
> hide sel cartoons
Drag select of 62 atoms, 233 residues, 68 bonds
> hide sel cartoons
> hide sel atoms
Drag select of 9 atoms, 1214 residues, 12 pseudobonds, 6 bonds
> hide sel atoms
Drag select of 220 residues
> hide sel cartoons
> select #2/H
777 atoms, 805 bonds, 97 residues, 1 model selected
> select #1/H
1048 atoms, 1077 bonds, 135 residues, 1 model selected
> hide sel cartoons
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/CysRRLL_INOG_NSmaps/Cavity_filling.cxs"
> ui tool show "Show Sequence Viewer"
> sequence chain #1/O #1/Q #1/S #2/O #2/Q #2/S
Alignment identifier is 1
> hide sel & #!1 cartoons
> select clear
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/CysRRLL_INOG_NSmaps/Cavity_filling.cxs"
> ui tool show "Show Sequence Viewer"
> sequence chain #1/A #1/B #1/C
Alignment identifier is 1
> ui tool show "Show Sequence Viewer"
> sequence chain #1/a #1/b #1/c #2/a #2/b #2/c
Alignment identifier is 2
> show sel atoms
> select clear
> style sel ball
Changed 24 atom styles
> show sel atoms
> style sel ball
Changed 33 atom styles
> color sel byhetero
> style sel sphere
Changed 33 atom styles
> style sel sphere
Changed 24 atom styles
> color sel byhetero
> select clear
> show sel atoms
> style sel sphere
Changed 24 atom styles
> color sel byhetero
> show sel & #!1 atoms
> style sel & #!1 sphere
Changed 27 atom styles
> color sel & #!1 byhetero
> show sel & #!1 atoms
> color sel & #!1 byhetero
> style sel & #!1 sphere
Changed 30 atom styles
> show sel & #!1 atoms
> color sel & #!1 byhetero
> style sel & #!1 sphere
Changed 27 atom styles
> select #1/a:340
5 atoms, 4 bonds, 1 residue, 1 model selected
> select clear
> graphics silhouettes false
> ui tool show "Side View"
Drag select of 44 atoms, 190 residues
> style sel ball
Changed 1514 atom styles
> select clear
> save "/Users/haoyangli/Google
> Drive/LASVGP_Arevirumab/EMmaps/CysRRLL_INOG_NSmaps/Cavity_filling.cxs"
——— End of log from Mon Apr 10 10:20:23 2023 ———
opened ChimeraX session
> view
> select #1/C:129
12 atoms, 12 bonds, 1 residue, 1 model selected
> show sel atoms
> select clear
> interfaces select #1/C & ::polymer_type>0 contacting #1/A#1/B &
> ::polymer_type>0 areaCutoff 0
42 contacting residues
> select #1/B:148
8 atoms, 7 bonds, 1 residue, 1 model selected
> show sel atoms
> select #1/C:124
10 atoms, 10 bonds, 1 residue, 1 model selected
> show sel atoms
> select clear
> interfaces select #1/C & ::polymer_type>0 contacting #1/A#1/B &
> ::polymer_type>0 areaCutoff 0
42 contacting residues
> interfaces select #1/C & ::polymer_type>0 contacting #1/A#1/B &
> ::polymer_type>0 areaCutoff 0
42 contacting residues
> select #1/C:159
4 atoms, 3 bonds, 1 residue, 1 model selected
> select #1/C:160
4 atoms, 3 bonds, 1 residue, 1 model selected
> select #1/C:159
4 atoms, 3 bonds, 1 residue, 1 model selected
> show #!2 models
> hide #!1 models
> show #!1 models
> hide #!2 models
QPainter::begin: Paint device returned engine == 0, type: 3
===== Log before crash end =====
Log:
UCSF ChimeraX version: 1.6.1 (2023-05-09)
© 2016-2023 Regents of the University of California. All rights reserved.
> open /Users/haoyangli/Desktop/123.cxs
Log from Mon May 1 17:48:59 2023UCSF ChimeraX version: 1.5 (2022-11-24)
© 2016-2022 Regents of the University of California. All rights reserved.
How to cite UCSF ChimeraX
> open /Users/haoyangli/Downloads/7puy.cif format mmcif
7puy.cif title:
Structure of the membrane soluble spike complex from the Lassa virus in a
C3-symmetric map [more info...]
Chain information for 7puy.cif #1
---
Chain | Description | UniProt
A B C | Pre-glycoprotein polyprotein GP complex | GLYC_LASSJ
a b c | Glycoprotein G2 | GLYC_LASSJ
Non-standard residues in 7puy.cif #1
---
BDP — beta-D-glucopyranuronic acid (beta-D-glucuronic acid; D-glucuronic acid;
glucuronic acid)
NAG — 2-acetamido-2-deoxy-beta-D-glucopyranose (N-acetyl-beta-D-glucosamine;
2-acetamido-2-deoxy-beta-D-glucose; 2-acetamido-2-deoxy-D-glucose;
2-acetamido-2-deoxy-glucose; N-ACETYL-D-GLUCOSAMINE)
XYS — alpha-D-xylopyranose (alpha-D-xylose; D-xylose; xylose; XYLOPYRANOSE)
> hide atoms
> show cartoons
> lighting soft
> set bgColor white
> graphics silhouettes true
> sequence chain #1/a#1/b#1/c
Alignment identifier is 1
> atggagagacagggaaagacaccattgggtctagttgac
Unknown command: atggagagacagggaaagacaccattgggtctagttgac
> hide atoms
> show cartoons
> select /a-c:384
27 atoms, 24 bonds, 3 residues, 1 model selected
> select /a-c:384
27 atoms, 24 bonds, 3 residues, 1 model selected
> select /a-c:425
27 atoms, 24 bonds, 3 residues, 1 model selected
> select /a-c:425-426
48 atoms, 45 bonds, 6 residues, 1 model selected
> select /a-c:431
21 atoms, 18 bonds, 3 residues, 1 model selected
> select /a-c:431-433
69 atoms, 66 bonds, 9 residues, 1 model selected
> select /a-c:433
24 atoms, 21 bonds, 3 residues, 1 model selected
> select /a-c:433
24 atoms, 21 bonds, 3 residues, 1 model selected
> show sel atoms
> select /a-c:448
30 atoms, 30 bonds, 3 residues, 1 model selected
> select /a-c:447-448
54 atoms, 54 bonds, 6 residues, 1 model selected
> open /Users/haoyangli/Downloads/7sgd.pdb
7sgd.pdb title:
Lassa virus glycoprotein construct(josiah GPCYSR4) recovered from GPC- I53-50
nanoparticle by localized reconstruction [more info...]
Chain information for 7sgd.pdb #2
---
Chain | Description | UniProt
A B C a b c | josiah GPCYSR4 I53-50A | Q6GWS0_9VIRU
Non-standard residues in 7sgd.pdb #2
---
BMA — β-D-mannopyranose (β-D-mannose; D-mannose; mannose)
FUC — α-L-fucopyranose (α-L-fucose; 6-deoxy-α-L-galactopyranose; L-fucose;
fucose)
MAN — α-D-mannopyranose (α-D-mannose; D-mannose; mannose)
NAG — 2-acetamido-2-deoxy-β-D-glucopyranose (N-acetyl-β-D-glucosamine;
2-acetamido-2-deoxy-β-D-glucose; 2-acetamido-2-deoxy-D-glucose;
2-acetamido-2-deoxy-glucose; N-acetyl-D-glucosamine)
> hide sel atoms
> show sel cartoons
> select add #2
9174 atoms, 9444 bonds, 9 pseudobonds, 1095 residues, 3 models selected
> show sel atoms
> hide sel atoms
> show sel cartoons
> sequence chain #2/A#2/B#2/C#2/a#2/b#2/c
Alignment identifier is 2
> mmaker #2/A to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker 7puy.cif, chain A (#1) with 7sgd.pdb, chain A (#2), sequence
alignment score = 1149.4
Alignment identifier is 3
Showing conservation header ("seq_conservation" residue attribute) for
alignment 3
Hiding conservation header for alignment 3
Chains used in RMSD evaluation for alignment 3: 7puy.cif #1/A, 7sgd.pdb #2/A
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 3
RMSD between 133 pruned atom pairs is 1.045 angstroms; (across all 169 pairs:
2.141)
> open "/Users/haoyangli/Downloads/7uot (1).pdb"
7uot (1).pdb title:
Native lassa glycoprotein In complex with neutralizing antibodies 8.9F and
37.2D [more info...]
Chain information for 7uot (1).pdb #3
---
Chain | Description | UniProt
A B C | glycoprotein G1 | GLYC_LASSJ
H | 8.9F heavy chain (variable domain) |
L | 8.9F light chain (variable domain) |
O Q S | 37.2D heavy chain (variable domain) |
P R T | 37.2D light chain (variable domain) |
a b c | GP2 | GLYC_LASSJ
Non-standard residues in 7uot (1).pdb #3
---
BMA — β-D-mannopyranose (β-D-mannose; D-mannose; mannose)
FUC — α-L-fucopyranose (α-L-fucose; 6-deoxy-α-L-galactopyranose; L-fucose;
fucose)
MAN — α-D-mannopyranose (α-D-mannose; D-mannose; mannose)
NAG — 2-acetamido-2-deoxy-β-D-glucopyranose (N-acetyl-β-D-glucosamine;
2-acetamido-2-deoxy-β-D-glucose; 2-acetamido-2-deoxy-D-glucose;
2-acetamido-2-deoxy-glucose; N-acetyl-D-glucosamine)
> select add #3
26008 atoms, 26764 bonds, 15 pseudobonds, 3167 residues, 5 models selected
> select subtract #2
16888 atoms, 17374 bonds, 6 pseudobonds, 2078 residues, 3 models selected
> select add #1
27229 atoms, 27979 bonds, 15 pseudobonds, 3338 residues, 4 models selected
> hide sel atoms
> show sel cartoons
> mmaker #3/A to #1/A showAlignment true
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker 7puy.cif, chain A (#1) with 7uot (1).pdb, chain A (#3), sequence
alignment score = 1198.8
Alignment identifier is 3
Showing conservation header ("seq_conservation" residue attribute) for
alignment 3
Hiding conservation header for alignment 3
Chains used in RMSD evaluation for alignment 3: 7puy.cif #1/A, 7uot (1).pdb
#3/A
Showing rmsd header ("seq_rmsd" residue attribute) for alignment 3
RMSD between 160 pruned atom pairs is 0.747 angstroms; (across all 183 pairs:
1.431)
> hide #!2 models
> color #3 #9437ffff
> show #!2 models
> hide #!3 models
> hide #!1 models
> select #2/b:423
9 atoms, 8 bonds, 1 residue, 1 model selected
> open /Users/haoyangli/Downloads/7sge.pdb
7sge.pdb title:
I53-50 nanoparticle core reconstructed from GPC-I53-50NP by focused refinement
[more info...]
Chain information for 7sge.pdb #4
---
Chain | Description
A | josiah GPCYSR4-I53-50A - nanoparticle component
B | I53-50B component
> hide #!2 models
> select add #2
9120 atoms, 9390 bonds, 9 pseudobonds, 1089 residues, 2 models selected
> select subtract #2
Nothing selected
> sequence chain #4/A
Alignment identifier is 4/A
> select #4/A:1
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #4/A:1-53
407 atoms, 412 bonds, 53 residues, 1 model selected
> select clear
> select #4/A:1
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #4/A:1
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #4/A:1
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #4/A:1-4
30 atoms, 29 bonds, 4 residues, 1 model selected
> select clear
> color #4 bychain
> show #!1 models
> hide #!1 models
> show #!2 models
> hide #4 models
> select #2/a-c:423
27 atoms, 24 bonds, 3 residues, 1 model selected
> select #2/a-c:423
27 atoms, 24 bonds, 3 residues, 1 model selected
> open /Users/haoyangli/Downloads/6p6f.cif
6p6f.cif title:
BG505 sosip-I53-50NP [more info...]
Chain information for 6p6f.cif #5
---
Chain | Description
A | I53-50A.1NT1
B | I53-50B.4PT1
6p6f.cif mmCIF Assemblies
---
1| complete icosahedral assembly
2| icosahedral asymmetric unit
3| icosahedral pentamer
4| icosahedral 23 hexamer
5| icosahedral asymmetric unit, std point frame
> close #5
> select #4/A:6
8 atoms, 7 bonds, 1 residue, 1 model selected
> select #4/A:6-206
1520 atoms, 1549 bonds, 201 residues, 1 model selected
> show #!1 models
> hide #!2 models
> select #1/a-c:432
24 atoms, 21 bonds, 3 residues, 1 model selected
> select #1/a-c:432
24 atoms, 21 bonds, 3 residues, 1 model selected
> show sel atoms
> select #1/a-c:427
21 atoms, 21 bonds, 3 residues, 1 model selected
> select #1/a-c:427
21 atoms, 21 bonds, 3 residues, 1 model selected
> show sel atoms
> select #1/a-c:428-429
36 atoms, 33 bonds, 6 residues, 1 model selected
> select #1/a-c:428-431
81 atoms, 78 bonds, 12 residues, 1 model selected
> select #1/a-c:423-424
39 atoms, 36 bonds, 6 residues, 1 model selected
> select #1/a-c:417-424
213 atoms, 213 bonds, 24 residues, 1 model selected
> select #1/a-c:424
12 atoms, 9 bonds, 3 residues, 1 model selected
> select #1/a-c:422-424
72 atoms, 69 bonds, 9 residues, 1 model selected
> show #!3 models
> hide #!1 models
> show #!2 models
> show #!1 models
> hide #!3 models
> hide #!1 models
> select #2/c:422
11 atoms, 10 bonds, 1 residue, 1 model selected
> select #2/a-c:423
27 atoms, 24 bonds, 3 residues, 1 model selected
> select #2/a-c:423
27 atoms, 24 bonds, 3 residues, 1 model selected
> show #4 models
> hide #4 models
> show #!3 models
> hide #!2 models
> show #!2 models
> hide #!3 models
> hide #!2 models
> show #!3 models
> color #!3 bychain
> interfaces #!3 & ~solvent
24 buried areas: B b 2272, A a 2260, C c 2224, A B 1223, A C 1187, B C 1171, H
L 822, Q R 799, O P 794, S T 793, c S 766, b Q 763, a O 745, b c 704, a c 687,
a b 687, A b 615, B c 615, C a 580, L q 368, C H 326, B g 321, A M 310, C r
302
> hbonds #!3 reveal true
3334 hydrogen bonds found
> hide #!3 atoms
> show #!3 atoms
> hide #!3 atoms
> interfaces #!3 & ~solvent
24 buried areas: B b 2272, A a 2260, C c 2224, A B 1223, A C 1187, B C 1171, H
L 822, Q R 799, O P 794, S T 793, c S 766, b Q 763, a O 745, b c 704, a c 687,
a b 687, A b 615, B c 615, C a 580, L q 368, C H 326, B g 321, A M 310, C r
302
> select add #3
16861 atoms, 17344 bonds, 1539 pseudobonds, 2075 residues, 4 models selected
> select add #2
25954 atoms, 26710 bonds, 1548 pseudobonds, 3161 residues, 5 models selected
> interfaces select & #!3 & ~solvent
Missing or invalid "atoms" argument: invalid atoms specifier
> select subtract #2
16834 atoms, 17320 bonds, 1539 pseudobonds, 2072 residues, 3 models selected
> interfaces select & ~solvent
Missing or invalid "atoms" argument: invalid atoms specifier
> select subtract #3
Nothing selected
> interfaces #!3 & ~solvent
24 buried areas: B b 2272, A a 2260, C c 2224, A B 1223, A C 1187, B C 1171, H
L 822, Q R 799, O P 794, S T 793, c S 766, b Q 763, a O 745, b c 704, a c 687,
a b 687, A b 615, B c 615, C a 580, L q 368, C H 326, B g 321, A M 310, C r
302
> select clear
> select #3/C:257
11 atoms, 10 bonds, 1 residue, 1 model selected
> show sel atoms
> select clear
> style #!3 stick
Changed 16834 atom styles
> select #3/C:258
8 atoms, 7 bonds, 1 residue, 1 model selected
> select add #3/C:259
16 atoms, 14 bonds, 2 residues, 1 model selected
> show sel atoms
> select #3/A:150
12 atoms, 12 bonds, 1 residue, 1 model selected
Drag select of 4 atoms, 111 residues, 3 bonds, 40 pseudobonds
> show sel atoms
> select clear
> hide #!3 atoms
> select #3/B:125
9 atoms, 8 bonds, 1 residue, 1 model selected
> show sel atoms
> select clear
> color #!3 byhetero
> select #3/A:151
9 atoms, 8 bonds, 1 residue, 1 model selected
> show sel atoms
> hide #5 models
> close #5
> hide #!3 models
> show #!1 models
> save /Users/haoyangli/Desktop/123.cxs
——— End of log from Mon May 1 17:48:59 2023 ———
opened ChimeraX session
OpenGL version: 4.1 ATI-4.10.12
OpenGL renderer: AMD Radeon Pro 5300M OpenGL Engine
OpenGL vendor: ATI Technologies Inc.
Python: 3.9.11
Locale: UTF-8
Qt version: PyQt6 6.4.2, Qt 6.4.2
Qt runtime version: 6.4.3
Qt platform: cocoa
Hardware:
Hardware Overview:
Model Name: MacBook Pro
Model Identifier: MacBookPro16,1
Processor Name: 6-Core Intel Core i7
Processor Speed: 2.6 GHz
Number of Processors: 1
Total Number of Cores: 6
L2 Cache (per Core): 256 KB
L3 Cache: 12 MB
Hyper-Threading Technology: Enabled
Memory: 16 GB
System Firmware Version: 1968.100.17.0.0 (iBridge: 20.16.4252.0.0,0)
OS Loader Version: 577~129
Software:
System Software Overview:
System Version: macOS 13.3.1 (a) (22E772610a)
Kernel Version: Darwin 22.4.0
Time since boot: 13 days, 23 hours, 17 minutes
Graphics/Displays:
Intel UHD Graphics 630:
Chipset Model: Intel UHD Graphics 630
Type: GPU
Bus: Built-In
VRAM (Dynamic, Max): 1536 MB
Vendor: Intel
Device ID: 0x3e9b
Revision ID: 0x0000
Automatic Graphics Switching: Supported
gMux Version: 5.0.0
Metal Support: Metal 3
AMD Radeon Pro 5300M:
Chipset Model: AMD Radeon Pro 5300M
Type: GPU
Bus: PCIe
PCIe Lane Width: x16
VRAM (Total): 4 GB
Vendor: AMD (0x1002)
Device ID: 0x7340
Revision ID: 0x0043
ROM Revision: 113-D3220E-190
VBIOS Version: 113-D32207P1-020
Option ROM Version: 113-D32207P1-020
EFI Driver Version: 01.A1.190
Automatic Graphics Switching: Supported
gMux Version: 5.0.0
Metal Support: Metal 3
Displays:
ASUS VE278:
Resolution: 1920 x 1080 (1080p FHD - Full High Definition)
UI Looks like: 1920 x 1080 @ 60.00Hz
Framebuffer Depth: 30-Bit Color (ARGB2101010)
Display Serial Number: E4LMTF043857
Main Display: Yes
Mirror: Off
Online: Yes
Rotation: Supported
Connection Type: DVI or HDMI
Adapter Firmware Version: 7.55
Installed Packages:
alabaster: 0.7.13
appdirs: 1.4.4
appnope: 0.1.3
asttokens: 2.2.1
Babel: 2.12.1
backcall: 0.2.0
beautifulsoup4: 4.11.2
blockdiag: 3.0.0
build: 0.10.0
certifi: 2021.10.8
cftime: 1.6.2
charset-normalizer: 3.1.0
ChimeraX-AddCharge: 1.5.9.1
ChimeraX-AddH: 2.2.5
ChimeraX-AlignmentAlgorithms: 2.0.1
ChimeraX-AlignmentHdrs: 3.3.1
ChimeraX-AlignmentMatrices: 2.1
ChimeraX-Alignments: 2.9.3
ChimeraX-AlphaFold: 1.0
ChimeraX-AltlocExplorer: 1.0.3
ChimeraX-AmberInfo: 1.0
ChimeraX-Arrays: 1.1
ChimeraX-Atomic: 1.43.10
ChimeraX-AtomicLibrary: 10.0.6
ChimeraX-AtomSearch: 2.0.1
ChimeraX-AxesPlanes: 2.3.2
ChimeraX-BasicActions: 1.1.2
ChimeraX-BILD: 1.0
ChimeraX-BlastProtein: 2.1.2
ChimeraX-BondRot: 2.0.1
ChimeraX-BugReporter: 1.0.1
ChimeraX-BuildStructure: 2.8
ChimeraX-Bumps: 1.0
ChimeraX-BundleBuilder: 1.2.2
ChimeraX-ButtonPanel: 1.0.1
ChimeraX-CageBuilder: 1.0.1
ChimeraX-CellPack: 1.0
ChimeraX-Centroids: 1.3.2
ChimeraX-ChangeChains: 1.0.2
ChimeraX-CheckWaters: 1.3.1
ChimeraX-ChemGroup: 2.0.1
ChimeraX-Clashes: 2.2.4
ChimeraX-ColorActions: 1.0.3
ChimeraX-ColorGlobe: 1.0
ChimeraX-ColorKey: 1.5.3
ChimeraX-CommandLine: 1.2.5
ChimeraX-ConnectStructure: 2.0.1
ChimeraX-Contacts: 1.0.1
ChimeraX-Core: 1.6.1
ChimeraX-CoreFormats: 1.1
ChimeraX-coulombic: 1.4.2
ChimeraX-Crosslinks: 1.0
ChimeraX-Crystal: 1.0
ChimeraX-CrystalContacts: 1.0.1
ChimeraX-DataFormats: 1.2.3
ChimeraX-Dicom: 1.2
ChimeraX-DistMonitor: 1.4
ChimeraX-DockPrep: 1.1.1
ChimeraX-Dssp: 2.0
ChimeraX-EMDB-SFF: 1.0
ChimeraX-ESMFold: 1.0
ChimeraX-FileHistory: 1.0.1
ChimeraX-FunctionKey: 1.0.1
ChimeraX-Geometry: 1.3
ChimeraX-gltf: 1.0
ChimeraX-Graphics: 1.1.1
ChimeraX-Hbonds: 2.4
ChimeraX-Help: 1.2.1
ChimeraX-HKCage: 1.3
ChimeraX-IHM: 1.1
ChimeraX-ImageFormats: 1.2
ChimeraX-IMOD: 1.0
ChimeraX-IO: 1.0.1
ChimeraX-ItemsInspection: 1.0.1
ChimeraX-Label: 1.1.7
ChimeraX-ListInfo: 1.1.1
ChimeraX-Log: 1.1.5
ChimeraX-LookingGlass: 1.1
ChimeraX-Maestro: 1.8.2
ChimeraX-Map: 1.1.4
ChimeraX-MapData: 2.0
ChimeraX-MapEraser: 1.0.1
ChimeraX-MapFilter: 2.0.1
ChimeraX-MapFit: 2.0
ChimeraX-MapSeries: 2.1.1
ChimeraX-Markers: 1.0.1
ChimeraX-Mask: 1.0.2
ChimeraX-MatchMaker: 2.0.12
ChimeraX-MDcrds: 2.6
ChimeraX-MedicalToolbar: 1.0.2
ChimeraX-Meeting: 1.0.1
ChimeraX-MLP: 1.1.1
ChimeraX-mmCIF: 2.12
ChimeraX-MMTF: 2.2
ChimeraX-Modeller: 1.5.9
ChimeraX-ModelPanel: 1.3.7
ChimeraX-ModelSeries: 1.0.1
ChimeraX-Mol2: 2.0
ChimeraX-Mole: 1.0
ChimeraX-Morph: 1.0.2
ChimeraX-MouseModes: 1.2
ChimeraX-Movie: 1.0
ChimeraX-Neuron: 1.0
ChimeraX-Nifti: 1.0
ChimeraX-NRRD: 1.0
ChimeraX-Nucleotides: 2.0.3
ChimeraX-OpenCommand: 1.10.1
ChimeraX-PDB: 2.7.2
ChimeraX-PDBBio: 1.0
ChimeraX-PDBLibrary: 1.0.2
ChimeraX-PDBMatrices: 1.0
ChimeraX-PickBlobs: 1.0.1
ChimeraX-Positions: 1.0
ChimeraX-PresetMgr: 1.1
ChimeraX-PubChem: 2.1
ChimeraX-ReadPbonds: 1.0.1
ChimeraX-Registration: 1.1.1
ChimeraX-RemoteControl: 1.0
ChimeraX-RenderByAttr: 1.1
ChimeraX-RenumberResidues: 1.1
ChimeraX-ResidueFit: 1.0.1
ChimeraX-RestServer: 1.1
ChimeraX-RNALayout: 1.0
ChimeraX-RotamerLibMgr: 3.0
ChimeraX-RotamerLibsDunbrack: 2.0
ChimeraX-RotamerLibsDynameomics: 2.0
ChimeraX-RotamerLibsRichardson: 2.0
ChimeraX-SaveCommand: 1.5.1
ChimeraX-SchemeMgr: 1.0
ChimeraX-SDF: 2.0.1
ChimeraX-Segger: 1.0
ChimeraX-Segment: 1.0.1
ChimeraX-SelInspector: 1.0
ChimeraX-SeqView: 2.8.3
ChimeraX-Shape: 1.0.1
ChimeraX-Shell: 1.0.1
ChimeraX-Shortcuts: 1.1.1
ChimeraX-ShowSequences: 1.0.1
ChimeraX-SideView: 1.0.1
ChimeraX-Smiles: 2.1
ChimeraX-SmoothLines: 1.0
ChimeraX-SpaceNavigator: 1.0
ChimeraX-StdCommands: 1.10.3
ChimeraX-STL: 1.0.1
ChimeraX-Storm: 1.0
ChimeraX-StructMeasure: 1.1.2
ChimeraX-Struts: 1.0.1
ChimeraX-Surface: 1.0.1
ChimeraX-SwapAA: 2.0.1
ChimeraX-SwapRes: 2.2.1
ChimeraX-TapeMeasure: 1.0
ChimeraX-Test: 1.0
ChimeraX-Toolbar: 1.1.2
ChimeraX-ToolshedUtils: 1.2.1
ChimeraX-Topography: 1.0
ChimeraX-Tug: 1.0.1
ChimeraX-UI: 1.28.4
ChimeraX-uniprot: 2.2.2
ChimeraX-UnitCell: 1.0.1
ChimeraX-ViewDockX: 1.2
ChimeraX-VIPERdb: 1.0
ChimeraX-Vive: 1.1
ChimeraX-VolumeMenu: 1.0.1
ChimeraX-VTK: 1.0
ChimeraX-WavefrontOBJ: 1.0
ChimeraX-WebCam: 1.0.2
ChimeraX-WebServices: 1.1.1
ChimeraX-Zone: 1.0.1
colorama: 0.4.6
comm: 0.1.3
contourpy: 1.0.7
cxservices: 1.2.2
cycler: 0.11.0
Cython: 0.29.33
debugpy: 1.6.7
decorator: 5.1.1
docutils: 0.19
executing: 1.2.0
filelock: 3.9.0
fonttools: 4.39.3
funcparserlib: 1.0.1
grako: 3.16.5
h5py: 3.8.0
html2text: 2020.1.16
idna: 3.4
ihm: 0.35
imagecodecs: 2022.9.26
imagesize: 1.4.1
importlib-metadata: 6.6.0
ipykernel: 6.21.1
ipython: 8.10.0
ipython-genutils: 0.2.0
ipywidgets: 8.0.6
jedi: 0.18.2
Jinja2: 3.1.2
jupyter-client: 8.0.2
jupyter-core: 5.3.0
jupyterlab-widgets: 3.0.7
kiwisolver: 1.4.4
line-profiler: 4.0.2
lxml: 4.9.2
lz4: 4.3.2
MarkupSafe: 2.1.2
matplotlib: 3.6.3
matplotlib-inline: 0.1.6
msgpack: 1.0.4
nest-asyncio: 1.5.6
netCDF4: 1.6.2
networkx: 2.8.8
nibabel: 5.0.1
nptyping: 2.5.0
numexpr: 2.8.4
numpy: 1.23.5
openvr: 1.23.701
packaging: 21.3
ParmEd: 3.4.3
parso: 0.8.3
pep517: 0.13.0
pexpect: 4.8.0
pickleshare: 0.7.5
Pillow: 9.3.0
pip: 23.0
pkginfo: 1.9.6
platformdirs: 3.5.0
prompt-toolkit: 3.0.38
psutil: 5.9.4
ptyprocess: 0.7.0
pure-eval: 0.2.2
pycollada: 0.7.2
pydicom: 2.3.0
Pygments: 2.14.0
pynrrd: 1.0.0
PyOpenGL: 3.1.5
PyOpenGL-accelerate: 3.1.5
pyparsing: 3.0.9
pyproject-hooks: 1.0.0
PyQt6-commercial: 6.4.2
PyQt6-Qt6: 6.4.3
PyQt6-sip: 13.4.1
PyQt6-WebEngine-commercial: 6.4.0
PyQt6-WebEngine-Qt6: 6.4.3
python-dateutil: 2.8.2
pytz: 2023.3
pyzmq: 25.0.2
qtconsole: 5.4.0
QtPy: 2.3.1
RandomWords: 0.4.0
requests: 2.28.2
scipy: 1.9.3
setuptools: 67.4.0
setuptools-scm: 7.0.5
sfftk-rw: 0.7.3
six: 1.16.0
snowballstemmer: 2.2.0
sortedcontainers: 2.4.0
soupsieve: 2.4.1
sphinx: 6.1.3
sphinx-autodoc-typehints: 1.22
sphinxcontrib-applehelp: 1.0.4
sphinxcontrib-blockdiag: 3.0.0
sphinxcontrib-devhelp: 1.0.2
sphinxcontrib-htmlhelp: 2.0.1
sphinxcontrib-jsmath: 1.0.1
sphinxcontrib-qthelp: 1.0.3
sphinxcontrib-serializinghtml: 1.1.5
stack-data: 0.6.2
tables: 3.7.0
tcia-utils: 1.2.0
tifffile: 2022.10.10
tinyarray: 1.2.4
tomli: 2.0.1
tornado: 6.3.1
traitlets: 5.9.0
typing-extensions: 4.5.0
tzdata: 2023.3
urllib3: 1.26.15
wcwidth: 0.2.6
webcolors: 1.12
wheel: 0.38.4
wheel-filename: 1.4.1
widgetsnbextension: 4.0.7
zipp: 3.15.0
Change History (2)
comment:1 by , 2 years ago
| Cc: | added |
|---|---|
| Component: | Unassigned → Window Toolkit |
| Owner: | set to |
| Platform: | → all |
| Project: | → ChimeraX |
| Status: | new → accepted |
| Summary: | ChimeraX bug report submission → Crashed in QTabBar::paintEvent(), QPainter::begin: Paint device returned engine == 0 |
comment:2 by , 2 years ago
| Resolution: | → can't reproduce |
|---|---|
| Status: | accepted → closed |
Note:
See TracTickets
for help on using tickets.
