Opened 3 years ago

Last modified 3 years ago

#9177 closed defect

ChimeraX bug report submission — at Initial Version

Reported by: chimerax-bug-report@… Owned by:
Priority: normal Milestone:
Component: Window Toolkit Version:
Keywords: Cc: Tom Goddard
Blocked By: Blocking:
Notify when closed: Platform: all
Project: ChimeraX

Description

The following bug report has been submitted:
Platform:        macOS-10.16-x86_64-i386-64bit
ChimeraX Version: 1.6.1 (2023-05-09 17:57:07 UTC)
Description
Last time you used ChimeraX it crashed.
Please describe steps that led to the crash here.
Fatal Python error: Segmentation fault

Current thread 0x00007ff85a19d340 (most recent call first):
  File "/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-packages/chimerax/ui/gui.py", line 275 in event_loop
  File "/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-packages/chimerax/core/__main__.py", line 892 in init
  File "/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-packages/chimerax/core/__main__.py", line 1043 in 
  File "/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/runpy.py", line 87 in _run_code
  File "/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/runpy.py", line 197 in _run_module_as_main


{"app_name":"ChimeraX","timestamp":"2023-06-12 11:46:26.00 -0400","app_version":"1.6.1","slice_uuid":"5df621ee-554e-36a8-b448-93b2334e5480","build_version":"1.6.1.0","platform":1,"bundleID":"edu.ucsf.cgl.ChimeraX","share_with_app_devs":0,"is_first_party":0,"bug_type":"309","os_version":"macOS 13.3.1 (22E772610a)","roots_installed":0,"name":"ChimeraX","incident_id":"AA6625D7-E4A8-42C1-BA33-6E1C390DA4BC"}
{
  "uptime" : 250000,
  "procRole" : "Background",
  "version" : 2,
  "userID" : 501,
  "deployVersion" : 210,
  "modelCode" : "MacBookPro15,2",
  "coalitionID" : 53470,
  "osVersion" : {
    "train" : "macOS 13.3.1",
    "build" : "22E772610a",
    "releaseType" : "User"
  },
  "captureTime" : "2023-06-12 11:46:08.6262 -0400",
  "incident" : "AA6625D7-E4A8-42C1-BA33-6E1C390DA4BC",
  "pid" : 56548,
  "cpuType" : "X86-64",
  "roots_installed" : 0,
  "bug_type" : "309",
  "procLaunch" : "2023-06-08 16:56:00.2203 -0400",
  "procStartAbsTime" : 220016427807714,
  "procExitAbsTime" : 259285065740758,
  "procName" : "ChimeraX",
  "procPath" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/MacOS\/ChimeraX",
  "bundleInfo" : {"CFBundleShortVersionString":"1.6.1","CFBundleVersion":"1.6.1.0","CFBundleIdentifier":"edu.ucsf.cgl.ChimeraX"},
  "storeInfo" : {"deviceIdentifierForVendor":"AA534D71-249F-5C83-BDF8-8597525678D1","thirdParty":true},
  "parentProc" : "launchd",
  "parentPid" : 1,
  "coalitionName" : "edu.ucsf.cgl.ChimeraX",
  "crashReporterKey" : "1E84C152-81FD-95B6-1AA7-65E94D64DF08",
  "throttleTimeout" : 2147483647,
  "codeSigningID" : "edu.ucsf.cgl.ChimeraX",
  "codeSigningTeamID" : "LWV8X224YF",
  "codeSigningFlags" : 570491649,
  "codeSigningValidationCategory" : 6,
  "codeSigningTrustLevel" : 0,
  "wakeTime" : 9152,
  "bridgeVersion" : {"build":"20P4252","train":"7.4"},
  "sleepWakeUUID" : "E7DC04E2-54C4-46CA-AF59-0BE3F6C1F93B",
  "sip" : "enabled",
  "vmRegionInfo" : "0x18 is not in any region.  Bytes before following region: 140737487937512\n      REGION TYPE                    START - END         [ VSIZE] PRT\/MAX SHRMOD  REGION DETAIL\n      UNUSED SPACE AT START\n--->  \n      shared memory            7ffffff9a000-7ffffff9b000 [    4K] r-x\/r-x SM=SHM  ",
  "exception" : {"codes":"0x0000000000000001, 0x0000000000000018","rawCodes":[1,24],"type":"EXC_BAD_ACCESS","signal":"SIGSEGV","subtype":"KERN_INVALID_ADDRESS at 0x0000000000000018"},
  "vmregioninfo" : "0x18 is not in any region.  Bytes before following region: 140737487937512\n      REGION TYPE                    START - END         [ VSIZE] PRT\/MAX SHRMOD  REGION DETAIL\n      UNUSED SPACE AT START\n--->  \n      shared memory            7ffffff9a000-7ffffff9b000 [    4K] r-x\/r-x SM=SHM  ",
  "extMods" : {"caller":{"thread_create":0,"thread_set_state":0,"task_for_pid":0},"system":{"thread_create":0,"thread_set_state":0,"task_for_pid":0},"targeted":{"thread_create":0,"thread_set_state":0,"task_for_pid":0},"warnings":0},
  "faultingThread" : 0,
  "threads" : [{"queue":"com.apple.main-thread","instructionState":{"instructionStream":{"bytes":[102,231,255,235,7,235,2,235,0,72,137,195,72,131,125,192,0,116,9,72,139,125,192,232,199,36,41,0,72,137,223,232,249,38,41,0,102,15,31,132,0,0,0,0,0,85,72,137,229,65,87,65,86,65,84,83,72,131,236,64,73,137,247,73,137,254,72,199,7,0,0,0,0,72,137,247,232,172,255,223,255,102,46,15,31,132,0,0,0,0,0,102,144,72,137,195,72,139,120,24,72,139,7,255,80,24,72,133,192,117,238,72,137,223,232,6,124,221,255,72,139,123,24,72,139,7,255,80,32,72,133,192,116,32,73,139,62,73,137,6,72,133,255,15,132,204,1,0,0,72,131,196,64,91,65,92,65,94,65,95,93,233,61,36,41,0,72,139,3,72,137,223,255,144,168,0,0,0,131,248,9,117,61,76,137,255,232,254,254,223,255,72],"offset":96}},"frames":[{"imageOffset":33266,"symbol":"__pthread_kill","symbolLocation":10,"imageIndex":151},{"imageOffset":24294,"symbol":"pthread_kill","symbolLocation":263,"imageIndex":152},{"imageOffset":271873,"symbol":"raise","symbolLocation":26,"imageIndex":153},{"imageOffset":13805,"symbol":"_sigtramp","symbolLocation":29,"imageIndex":154},{"imageOffset":0,"imageIndex":155},{"imageOffset":48058,"imageIndex":69},{"imageOffset":87816,"imageIndex":69},{"imageOffset":504101,"symbol":"QCommonStyle::drawControl(QStyle::ControlElement, QStyleOption const*, QPainter*, QWidget const*) const","symbolLocation":1845,"imageIndex":48},{"imageOffset":74236,"imageIndex":69},{"imageOffset":787163,"imageIndex":48},{"imageOffset":2137620,"symbol":"QTabBar::paintEvent(QPaintEvent*)","symbolLocation":1700,"imageIndex":48},{"imageOffset":372014,"symbol":"QWidget::event(QEvent*)","symbolLocation":1262,"imageIndex":48},{"imageOffset":2135124,"symbol":"QTabBar::event(QEvent*)","symbolLocation":980,"imageIndex":48},{"imageOffset":43463,"symbol":"QApplicationPrivate::notify_helper(QObject*, QEvent*)","symbolLocation":247,"imageIndex":48},{"imageOffset":47372,"symbol":"QApplication::notify(QObject*, QEvent*)","symbolLocation":508,"imageIndex":48},{"imageOffset":1282438,"symbol":"sipQApplication::notify(QObject*, QEvent*)","symbolLocation":230,"imageIndex":47},{"imageOffset":450858,"symbol":"QCoreApplication::notifyInternal2(QObject*, QEvent*)","symbolLocation":170,"imageIndex":45},{"imageOffset":315357,"symbol":"QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":3981,"imageIndex":48},{"imageOffset":347167,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":1007,"imageIndex":48},{"imageOffset":315672,"symbol":"QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":4296,"imageIndex":48},{"imageOffset":347167,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":1007,"imageIndex":48},{"imageOffset":315672,"symbol":"QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":4296,"imageIndex":48},{"imageOffset":347167,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":1007,"imageIndex":48},{"imageOffset":315672,"symbol":"QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":4296,"imageIndex":48},{"imageOffset":347167,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":1007,"imageIndex":48},{"imageOffset":315672,"symbol":"QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":4296,"imageIndex":48},{"imageOffset":347167,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":1007,"imageIndex":48},{"imageOffset":346842,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":682,"imageIndex":48},{"imageOffset":346842,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":682,"imageIndex":48},{"imageOffset":346842,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":682,"imageIndex":48},{"imageOffset":346842,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":682,"imageIndex":48},{"imageOffset":346842,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":682,"imageIndex":48},{"imageOffset":346842,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":682,"imageIndex":48},{"imageOffset":346842,"symbol":"QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":682,"imageIndex":48},{"imageOffset":315672,"symbol":"QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)","symbolLocation":4296,"imageIndex":48},{"imageOffset":446749,"symbol":"QWidgetRepaintManager::paintAndFlush()","symbolLocation":5085,"imageIndex":48},{"imageOffset":447487,"symbol":"QWidgetRepaintManager::sync()","symbolLocation":255,"imageIndex":48},{"imageOffset":372565,"symbol":"QWidget::event(QEvent*)","symbolLocation":1813,"imageIndex":48},{"imageOffset":1679844,"symbol":"QMainWindow::event(QEvent*)","symbolLocation":276,"imageIndex":48},{"imageOffset":612367,"symbol":"sipQMainWindow::event(QEvent*)","symbolLocation":191,"imageIndex":47},{"imageOffset":43463,"symbol":"QApplicationPrivate::notify_helper(QObject*, QEvent*)","symbolLocation":247,"imageIndex":48},{"imageOffset":47372,"symbol":"QApplication::notify(QObject*, QEvent*)","symbolLocation":508,"imageIndex":48},{"imageOffset":1282438,"symbol":"sipQApplication::notify(QObject*, QEvent*)","symbolLocation":230,"imageIndex":47},{"imageOffset":450858,"symbol":"QCoreApplication::notifyInternal2(QObject*, QEvent*)","symbolLocation":170,"imageIndex":45},{"imageOffset":431989,"symbol":"QWidgetRepaintManager::sendUpdateRequest(QWidget*, QWidgetRepaintManager::UpdateTime)","symbolLocation":629,"imageIndex":48},{"imageOffset":431267,"symbol":"void QWidgetRepaintManager::markDirty(QRect const&, QWidget*, QWidgetRepaintManager::UpdateTime, QWidgetRepaintManager::BufferState)","symbolLocation":2163,"imageIndex":48},{"imageOffset":475377,"imageIndex":48},{"imageOffset":775594,"imageIndex":45},{"imageOffset":855085,"symbol":"QWindowPrivate::emitScreenChangedRecursion(QScreen*)","symbolLocation":77,"imageIndex":49},{"imageOffset":813514,"symbol":"QScreen::~QScreen()","symbolLocation":682,"imageIndex":49},{"imageOffset":813630,"symbol":"QScreen::~QScreen()","symbolLocation":14,"imageIndex":49},{"imageOffset":895932,"symbol":"QWindowSystemInterface::handleScreenRemoved(QPlatformScreen*)","symbolLocation":28,"imageIndex":49},{"imageOffset":211027,"imageIndex":68},{"imageOffset":203752,"imageIndex":68},{"imageOffset":227502,"imageIndex":68},{"imageOffset":86925,"symbol":"displayConfigFinalizedProc","symbolLocation":259,"imageIndex":156},{"imageOffset":46273,"symbol":"CGSPostLocalNotification","symbolLocation":220,"imageIndex":156},{"imageOffset":45012,"symbol":"(anonymous namespace)::notify_datagram_handler(unsigned int, CGSDatagramType, void*, unsigned long, void*)","symbolLocation":98,"imageIndex":156},{"imageOffset":3312444,"symbol":"CGSDatagramReadStream::dispatchMainQueueDatagrams()","symbolLocation":202,"imageIndex":156},{"imageOffset":3312227,"symbol":"invocation function for block in CGSDatagramReadStream::mainQueueWakeup()","symbolLocation":18,"imageIndex":156},{"imageOffset":7569,"symbol":"_dispatch_call_block_and_release","symbolLocation":12,"imageIndex":157},{"imageOffset":12339,"symbol":"_dispatch_client_callout","symbolLocation":8,"imageIndex":157},{"imageOffset":65487,"symbol":"_dispatch_main_queue_drain","symbolLocation":954,"imageIndex":157},{"imageOffset":64519,"symbol":"_dispatch_main_queue_callback_4CF","symbolLocation":31,"imageIndex":157},{"imageOffset":770613,"symbol":"__CFRUNLOOP_IS_SERVICING_THE_MAIN_DISPATCH_QUEUE__","symbolLocation":9,"imageIndex":158},{"imageOffset":508015,"symbol":"__CFRunLoopRun","symbolLocation":2452,"imageIndex":158},{"imageOffset":503921,"symbol":"CFRunLoopRunSpecific","symbolLocation":560,"imageIndex":158},{"imageOffset":192461,"symbol":"RunCurrentEventLoopInMode","symbolLocation":292,"imageIndex":159},{"imageOffset":191966,"symbol":"ReceiveNextEventCommon","symbolLocation":657,"imageIndex":159},{"imageOffset":191288,"symbol":"_BlockUntilNextEventMatchingListInModeWithFilter","symbolLocation":64,"imageIndex":159},{"imageOffset":255904,"symbol":"_DPSNextEvent","symbolLocation":858,"imageIndex":160},{"imageOffset":251466,"symbol":"-[NSApplication(NSEvent) _nextEventMatchingEventMask:untilDate:inMode:dequeue:]","symbolLocation":1214,"imageIndex":160},{"imageOffset":195768,"symbol":"-[NSApplication run]","symbolLocation":586,"imageIndex":160},{"imageOffset":91987,"imageIndex":68},{"imageOffset":488630,"symbol":"QEventLoop::exec(QFlags)","symbolLocation":486,"imageIndex":45},{"imageOffset":452389,"symbol":"QCoreApplication::exec()","symbolLocation":133,"imageIndex":45},{"imageOffset":2250058,"symbol":"meth_QApplication_exec(_object*, _object*)","symbolLocation":90,"imageIndex":47},{"imageOffset":517917,"symbol":"cfunction_call","symbolLocation":125,"imageIndex":1},{"imageOffset":259511,"symbol":"_PyObject_MakeTpCall","symbolLocation":359,"imageIndex":1},{"imageOffset":1146524,"symbol":"call_function","symbolLocation":876,"imageIndex":1},{"imageOffset":1135266,"symbol":"_PyEval_EvalFrameDefault","symbolLocation":25554,"imageIndex":1},{"imageOffset":261416,"symbol":"function_code_fastcall","symbolLocation":104,"imageIndex":1},{"imageOffset":269674,"symbol":"method_vectorcall","symbolLocation":202,"imageIndex":1},{"imageOffset":1146380,"symbol":"call_function","symbolLocation":732,"imageIndex":1},{"imageOffset":1135266,"symbol":"_PyEval_EvalFrameDefault","symbolLocation":25554,"imageIndex":1},{"imageOffset":1149699,"symbol":"_PyEval_EvalCode","symbolLocation":2611,"imageIndex":1},{"imageOffset":261297,"symbol":"_PyFunction_Vectorcall","symbolLocation":289,"imageIndex":1},{"imageOffset":1146380,"symbol":"call_function","symbolLocation":732,"imageIndex":1},{"imageOffset":1135435,"symbol":"_PyEval_EvalFrameDefault","symbolLocation":25723,"imageIndex":1},{"imageOffset":1149699,"symbol":"_PyEval_EvalCode","symbolLocation":2611,"imageIndex":1},{"imageOffset":1109419,"symbol":"PyEval_EvalCode","symbolLocation":139,"imageIndex":1},{"imageOffset":1096722,"symbol":"builtin_exec","symbolLocation":626,"imageIndex":1},{"imageOffset":516131,"symbol":"cfunction_vectorcall_FASTCALL","symbolLocation":195,"imageIndex":1},{"imageOffset":1146380,"symbol":"call_function","symbolLocation":732,"imageIndex":1},{"imageOffset":1135435,"symbol":"_PyEval_EvalFrameDefault","symbolLocation":25723,"imageIndex":1},{"imageOffset":1149699,"symbol":"_PyEval_EvalCode","symbolLocation":2611,"imageIndex":1},{"imageOffset":261297,"symbol":"_PyFunction_Vectorcall","symbolLocation":289,"imageIndex":1},{"imageOffset":1146380,"symbol":"call_function","symbolLocation":732,"imageIndex":1},{"imageOffset":1135435,"symbol":"_PyEval_EvalFrameDefault","symbolLocation":25723,"imageIndex":1},{"imageOffset":1149699,"symbol":"_PyEval_EvalCode","symbolLocation":2611,"imageIndex":1},{"imageOffset":261297,"symbol":"_PyFunction_Vectorcall","symbolLocation":289,"imageIndex":1},{"imageOffset":1566832,"symbol":"pymain_run_module","symbolLocation":208,"imageIndex":1},{"imageOffset":1564551,"symbol":"Py_RunMain","symbolLocation":1431,"imageIndex":1},{"imageOffset":1566095,"symbol":"pymain_main","symbolLocation":223,"imageIndex":1},{"imageOffset":1565851,"symbol":"Py_Main","symbolLocation":43,"imageIndex":1},{"imageOffset":3528,"symbol":"main","symbolLocation":120,"imageIndex":0},{"imageOffset":25631,"symbol":"start","symbolLocation":1903,"imageIndex":161}],"id":2685069,"triggered":true,"threadState":{"r13":{"value":140378515198288},"rax":{"value":0},"rflags":{"value":582},"cpu":{"value":0},"r14":{"value":11},"rsi":{"value":11},"r8":{"value":140378371350344},"cr2":{"value":140378364817272},"rdx":{"value":0},"r10":{"value":140704640258880,"symbolLocation":0,"symbol":"_main_thread"},"r9":{"value":13566497374258238407},"r15":{"value":22},"rbx":{"value":140704640258880,"symbolLocation":0,"symbol":"_main_thread"},"trap":{"value":133},"err":{"value":33554760},"r11":{"value":582},"rip":{"value":140703508799986,"matchesCrashFrame":1},"rbp":{"value":140378371349120},"rsp":{"value":140378371349080},"r12":{"value":259},"rcx":{"value":140378371349080},"flavor":"x86_THREAD_STATE","rdi":{"value":259}},"name":"CrBrowserMain"},{"id":2685150,"name":"ThreadPoolServiceThread","frames":[{"imageOffset":44566,"symbol":"kevent64","symbolLocation":10,"imageIndex":151},{"imageOffset":72176586,"imageIndex":55},{"imageOffset":72176239,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71838381,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685153,"name":"Chrome_IOThread","frames":[{"imageOffset":44566,"symbol":"kevent64","symbolLocation":10,"imageIndex":151},{"imageOffset":72176586,"imageIndex":55},{"imageOffset":72176239,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":30119282,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685154,"name":"NetworkConfigWatcher","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":72148767,"imageIndex":55},{"imageOffset":71278185,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685158,"name":"Chrome_InProcGpuThread","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":72148767,"imageIndex":55},{"imageOffset":71278185,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685159,"name":"Chrome_ChildIOThread","frames":[{"imageOffset":44566,"symbol":"kevent64","symbolLocation":10,"imageIndex":151},{"imageOffset":72176586,"imageIndex":55},{"imageOffset":72176239,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":118470786,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685160,"name":"CompositorTileWorker1","frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":151},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":152},{"imageOffset":72117794,"imageIndex":55},{"imageOffset":108041477,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685161,"name":"ThreadPoolSingleThreadSharedForeground0","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71890095,"imageIndex":55},{"imageOffset":71893079,"imageIndex":55},{"imageOffset":71891901,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685162,"name":"NetworkConfigWatcher","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":72148767,"imageIndex":55},{"imageOffset":71278185,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685163,"name":"VizCompositorThread","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71278088,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685165,"name":"NetworkService","frames":[{"imageOffset":44566,"symbol":"kevent64","symbolLocation":10,"imageIndex":151},{"imageOffset":72176586,"imageIndex":55},{"imageOffset":72176239,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685166,"name":"NetworkConfigWatcher","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":72148767,"imageIndex":55},{"imageOffset":71278185,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685167,"name":"ThreadPoolSingleThreadForegroundBlocking1","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71890095,"imageIndex":55},{"imageOffset":71893079,"imageIndex":55},{"imageOffset":71891949,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685195,"name":"NetworkConfigWatcher","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":72148767,"imageIndex":55},{"imageOffset":71278185,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685220,"frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":151},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":152},{"imageOffset":3445311,"symbol":"blas_thread_server","symbolLocation":207,"imageIndex":17},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685221,"frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":151},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":152},{"imageOffset":3445311,"symbol":"blas_thread_server","symbolLocation":207,"imageIndex":17},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685222,"frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":151},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":152},{"imageOffset":3445311,"symbol":"blas_thread_server","symbolLocation":207,"imageIndex":17},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685249,"name":"com.apple.NSEventThread","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":38828,"symbol":"CGSSnarfAndDispatchDatagrams","symbolLocation":160,"imageIndex":156},{"imageOffset":3288317,"symbol":"SLSGetNextEventRecordInternal","symbolLocation":284,"imageIndex":156},{"imageOffset":1319776,"symbol":"SLEventCreateNextEvent","symbolLocation":9,"imageIndex":156},{"imageOffset":237769,"symbol":"PullEventsFromWindowServerOnConnection(unsigned int, unsigned char, __CFMachPortBoost*)","symbolLocation":268,"imageIndex":159},{"imageOffset":237451,"symbol":"MessageHandler(__CFMachPort*, void*, long, void*)","symbolLocation":48,"imageIndex":159},{"imageOffset":700006,"symbol":"__CFMachPortPerform","symbolLocation":244,"imageIndex":158},{"imageOffset":513443,"symbol":"__CFRUNLOOP_IS_CALLING_OUT_TO_A_SOURCE1_PERFORM_FUNCTION__","symbolLocation":41,"imageIndex":158},{"imageOffset":513251,"symbol":"__CFRunLoopDoSource1","symbolLocation":540,"imageIndex":158},{"imageOffset":508257,"symbol":"__CFRunLoopRun","symbolLocation":2694,"imageIndex":158},{"imageOffset":503921,"symbol":"CFRunLoopRunSpecific","symbolLocation":560,"imageIndex":158},{"imageOffset":1698057,"symbol":"_NSEventThread","symbolLocation":132,"imageIndex":160},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685293,"name":"MemoryInfra","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":72148767,"imageIndex":55},{"imageOffset":71278185,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2685294,"name":"ThreadPoolSingleThreadSharedBackgroundBlocking2","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71890095,"imageIndex":55},{"imageOffset":71892236,"imageIndex":55},{"imageOffset":71891757,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":2696004,"name":"NetworkConfigWatcher","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":72148767,"imageIndex":55},{"imageOffset":71278185,"imageIndex":55},{"imageOffset":71786483,"imageIndex":55},{"imageOffset":71490098,"imageIndex":55},{"imageOffset":71944792,"imageIndex":55},{"imageOffset":71945194,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":3082467,"name":"ThreadPoolForegroundWorker","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71890095,"imageIndex":55},{"imageOffset":71893079,"imageIndex":55},{"imageOffset":71891853,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":3084913,"name":"ThreadPoolBackgroundWorker","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71890095,"imageIndex":55},{"imageOffset":71893079,"imageIndex":55},{"imageOffset":71891709,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":3129579,"name":"QFileInfoGatherer","frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":151},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":152},{"imageOffset":2108299,"imageIndex":45},{"imageOffset":2108158,"symbol":"QWaitCondition::wait(QMutex*, QDeadlineTimer)","symbolLocation":94,"imageIndex":45},{"imageOffset":4640285,"symbol":"QFileInfoGatherer::run()","symbolLocation":125,"imageIndex":49},{"imageOffset":2067843,"imageIndex":45},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":3222111,"frames":[{"imageOffset":7088,"symbol":"start_wqthread","symbolLocation":0,"imageIndex":152}]},{"id":3226254,"queue":"com.apple.CFMachPort","frames":[{"imageOffset":281652,"symbol":"CFSetGetValue","symbolLocation":33,"imageIndex":158},{"imageOffset":650875,"symbol":"_cfmp_source_invalidated","symbolLocation":89,"imageIndex":158},{"imageOffset":650771,"symbol":"___CFMachPortCreateWithPort2_block_invoke","symbolLocation":19,"imageIndex":158},{"imageOffset":7569,"symbol":"_dispatch_call_block_and_release","symbolLocation":12,"imageIndex":157},{"imageOffset":12339,"symbol":"_dispatch_client_callout","symbolLocation":8,"imageIndex":157},{"imageOffset":23397,"symbol":"_dispatch_continuation_pop","symbolLocation":463,"imageIndex":157},{"imageOffset":98497,"symbol":"_dispatch_source_cancel_callout","symbolLocation":153,"imageIndex":157},{"imageOffset":95270,"symbol":"_dispatch_source_invoke","symbolLocation":1279,"imageIndex":157},{"imageOffset":37000,"symbol":"_dispatch_lane_serial_drain","symbolLocation":393,"imageIndex":157},{"imageOffset":40249,"symbol":"_dispatch_lane_invoke","symbolLocation":366,"imageIndex":157},{"imageOffset":82940,"symbol":"_dispatch_workloop_worker_thread","symbolLocation":765,"imageIndex":157},{"imageOffset":11349,"symbol":"_pthread_wqthread","symbolLocation":327,"imageIndex":152},{"imageOffset":7103,"symbol":"start_wqthread","symbolLocation":15,"imageIndex":152}]},{"id":3226478,"name":"ThreadPoolForegroundWorker","frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":34276,"symbol":"mach_msg_overwrite","symbolLocation":692,"imageIndex":151},{"imageOffset":6298,"symbol":"mach_msg","symbolLocation":19,"imageIndex":151},{"imageOffset":72149299,"imageIndex":55},{"imageOffset":71890095,"imageIndex":55},{"imageOffset":71893079,"imageIndex":55},{"imageOffset":71891853,"imageIndex":55},{"imageOffset":72123480,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":3226915,"frames":[{"imageOffset":7088,"symbol":"start_wqthread","symbolLocation":0,"imageIndex":152}]},{"id":3226917,"frames":[{"imageOffset":5554,"symbol":"mach_msg2_trap","symbolLocation":10,"imageIndex":151},{"imageOffset":63277,"symbol":"mach_msg2_internal","symbolLocation":78,"imageIndex":151},{"imageOffset":25694,"symbol":"_kernelrpc_thread_policy_set","symbolLocation":172,"imageIndex":151},{"imageOffset":25472,"symbol":"thread_policy_set","symbolLocation":15,"imageIndex":151},{"imageOffset":6136548,"symbol":"-[NSThread _setThreadPriority:]","symbolLocation":299,"imageIndex":162},{"imageOffset":72387245,"imageIndex":55},{"imageOffset":72123416,"imageIndex":55},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":3226957,"name":"Thread (pooled)","frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":151},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":152},{"imageOffset":2109100,"imageIndex":45},{"imageOffset":2108334,"imageIndex":45},{"imageOffset":2108158,"symbol":"QWaitCondition::wait(QMutex*, QDeadlineTimer)","symbolLocation":94,"imageIndex":45},{"imageOffset":2085349,"imageIndex":45},{"imageOffset":2067843,"imageIndex":45},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":3226958,"name":"Thread (pooled)","frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":151},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":152},{"imageOffset":2109100,"imageIndex":45},{"imageOffset":2108334,"imageIndex":45},{"imageOffset":2108158,"symbol":"QWaitCondition::wait(QMutex*, QDeadlineTimer)","symbolLocation":94,"imageIndex":45},{"imageOffset":2085349,"imageIndex":45},{"imageOffset":2067843,"imageIndex":45},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":3226959,"name":"Thread (pooled)","frames":[{"imageOffset":16622,"symbol":"__psynch_cvwait","symbolLocation":10,"imageIndex":151},{"imageOffset":26456,"symbol":"_pthread_cond_wait","symbolLocation":1242,"imageIndex":152},{"imageOffset":2109100,"imageIndex":45},{"imageOffset":2108334,"imageIndex":45},{"imageOffset":2108158,"symbol":"QWaitCondition::wait(QMutex*, QDeadlineTimer)","symbolLocation":94,"imageIndex":45},{"imageOffset":2085349,"imageIndex":45},{"imageOffset":2067843,"imageIndex":45},{"imageOffset":25043,"symbol":"_pthread_start","symbolLocation":125,"imageIndex":152},{"imageOffset":7123,"symbol":"thread_start","symbolLocation":15,"imageIndex":152}]},{"id":3226989,"frames":[{"imageOffset":7088,"symbol":"start_wqthread","symbolLocation":0,"imageIndex":152}]}],
  "usedImages" : [
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4412698624,
    "CFBundleShortVersionString" : "1.6.1",
    "CFBundleIdentifier" : "edu.ucsf.cgl.ChimeraX",
    "size" : 4096,
    "uuid" : "5df621ee-554e-36a8-b448-93b2334e5480",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/MacOS\/ChimeraX",
    "name" : "ChimeraX",
    "CFBundleVersion" : "1.6.1.0"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4420542464,
    "CFBundleShortVersionString" : "3.9.11, (c) 2001-2021 Python Software Foundation.",
    "CFBundleIdentifier" : "org.python.python",
    "size" : 2527232,
    "uuid" : "ef9cc1f4-5991-3213-9a9e-e68c578b6c1b",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/Python",
    "name" : "Python",
    "CFBundleVersion" : "3.9.11"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4413292544,
    "size" : 12288,
    "uuid" : "26e2211d-6e3c-34a0-9ef2-e395ec9e55ec",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_heapq.cpython-39-darwin.so",
    "name" : "_heapq.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4413153280,
    "size" : 20480,
    "uuid" : "0d397cb0-ba52-314e-bd56-863340384c78",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/binascii.cpython-39-darwin.so",
    "name" : "binascii.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4413210624,
    "size" : 24576,
    "uuid" : "b9299f10-06ed-376d-94f7-5f40a9a019ce",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/zlib.cpython-39-darwin.so",
    "name" : "zlib.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4413485056,
    "size" : 12288,
    "uuid" : "acea136f-27d9-3006-b785-f415ed7c491c",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_bz2.cpython-39-darwin.so",
    "name" : "_bz2.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4414091264,
    "size" : 204800,
    "uuid" : "d7e1b7aa-2530-3908-b749-1ddf8aad37bb",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_lzma.cpython-39-darwin.so",
    "name" : "_lzma.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4413534208,
    "size" : 8192,
    "uuid" : "eba0bbb2-1ee4-33c8-b2c3-e0ca34b5efb2",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/grp.cpython-39-darwin.so",
    "name" : "grp.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4413341696,
    "size" : 24576,
    "uuid" : "5f0c5830-adfd-3807-a69b-3ac334660886",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_struct.cpython-39-darwin.so",
    "name" : "_struct.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4413800448,
    "size" : 36864,
    "uuid" : "87ed7f18-fdc5-3cc8-97f0-ee393ee6ab9f",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/math.cpython-39-darwin.so",
    "name" : "math.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4413423616,
    "size" : 8192,
    "uuid" : "9e551319-6228-323e-961d-0102241059ad",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_bisect.cpython-39-darwin.so",
    "name" : "_bisect.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4413722624,
    "size" : 8192,
    "uuid" : "d7ea60e7-dc7b-30c1-968b-07c80dec058e",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_random.cpython-39-darwin.so",
    "name" : "_random.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4413579264,
    "size" : 20480,
    "uuid" : "dcac7b53-ad00-326b-86a5-ab8ee3c866b3",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_sha512.cpython-39-darwin.so",
    "name" : "_sha512.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4413636608,
    "size" : 4096,
    "uuid" : "260d58a8-ac64-3d93-ad4e-8e24c7ed2c7a",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/arrays\/_arrays.cpython-39-darwin.so",
    "name" : "_arrays.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4415827968,
    "size" : 663552,
    "uuid" : "7e891c56-f468-3ac7-926a-b3efe3e69557",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/arrays\/lib\/libarrays.dylib",
    "name" : "libarrays.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4414365696,
    "size" : 24576,
    "uuid" : "548d7da5-6a01-3908-b0e7-cf52811a65eb",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_json.cpython-39-darwin.so",
    "name" : "_json.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4434018304,
    "size" : 4489216,
    "uuid" : "3c57f0c7-97af-382e-bdaf-5b192a395a0c",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/core\/_multiarray_umath.cpython-39-darwin.so",
    "name" : "_multiarray_umath.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4529451008,
    "size" : 64028672,
    "uuid" : "24c9d5c5-4854-3af4-9550-cb0204044dfa",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/.dylibs\/libopenblas64_.0.dylib",
    "name" : "libopenblas64_.0.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4418236416,
    "size" : 1146880,
    "uuid" : "9abe5ede-ad43-391a-9e54-866711fac32a",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/.dylibs\/libgfortran.3.dylib",
    "name" : "libgfortran.3.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4414730240,
    "size" : 225280,
    "uuid" : "7ffa409f-fb04-3b64-be9a-3e3a494c975e",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/.dylibs\/libquadmath.0.dylib",
    "name" : "libquadmath.0.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4413890560,
    "size" : 90112,
    "uuid" : "7c6d7cb7-82db-3290-8181-07646fea1f80",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/.dylibs\/libgcc_s.1.dylib",
    "name" : "libgcc_s.1.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4414427136,
    "size" : 65536,
    "uuid" : "b167e339-2809-37ba-8e75-5887037a5a03",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_datetime.cpython-39-darwin.so",
    "name" : "_datetime.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4415401984,
    "size" : 98304,
    "uuid" : "a0f1736c-019e-304a-831b-33c61292773f",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_pickle.cpython-39-darwin.so",
    "name" : "_pickle.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4415041536,
    "size" : 81920,
    "uuid" : "19fff319-9db7-3f06-86fd-431cf039cbdd",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/core\/_multiarray_tests.cpython-39-darwin.so",
    "name" : "_multiarray_tests.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4415238144,
    "size" : 12288,
    "uuid" : "14c199de-bb55-3957-b5e3-5186e436f6f7",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_posixsubprocess.cpython-39-darwin.so",
    "name" : "_posixsubprocess.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4414570496,
    "size" : 20480,
    "uuid" : "2f042ce6-bef0-3ad9-97f5-2da7655122a4",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/select.cpython-39-darwin.so",
    "name" : "select.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4415574016,
    "size" : 73728,
    "uuid" : "865f1d2b-bb7c-3188-a588-737beec80b87",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_ctypes.cpython-39-darwin.so",
    "name" : "_ctypes.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4417101824,
    "size" : 114688,
    "uuid" : "e0295914-340c-31b8-90e3-ab43913e9c42",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/linalg\/_umath_linalg.cpython-39-darwin.so",
    "name" : "_umath_linalg.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4416917504,
    "size" : 81920,
    "uuid" : "8f950734-eaf8-30d8-90fa-19315f9e3cb1",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/fft\/_pocketfft_internal.cpython-39-darwin.so",
    "name" : "_pocketfft_internal.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4417331200,
    "size" : 475136,
    "uuid" : "78637382-a5da-3b41-80af-140e50bd93f3",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/mtrand.cpython-39-darwin.so",
    "name" : "mtrand.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4424429568,
    "size" : 131072,
    "uuid" : "2bbe12ec-f3f9-3d48-8d9d-5d78fe52a418",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/bit_generator.cpython-39-darwin.so",
    "name" : "bit_generator.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4424708096,
    "size" : 229376,
    "uuid" : "f8b8d031-7753-33cd-93f8-b9ee523054ab",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_common.cpython-39-darwin.so",
    "name" : "_common.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4414627840,
    "size" : 28672,
    "uuid" : "388ef3f8-6fc4-3be1-8cec-68f80b144aa3",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_hashlib.cpython-39-darwin.so",
    "name" : "_hashlib.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4419833856,
    "size" : 368640,
    "uuid" : "9b470578-8ffb-3e67-9fe0-7446a9ba507b",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/libssl.1.1.dylib",
    "name" : "libssl.1.1.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4430221312,
    "size" : 2195456,
    "uuid" : "73600d5b-8efd-3996-af09-e02c28d67dcb",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/libcrypto.1.1.dylib",
    "name" : "libcrypto.1.1.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4415287296,
    "size" : 28672,
    "uuid" : "673b41f3-28be-3326-bbd9-f33c09b2c664",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_blake2.cpython-39-darwin.so",
    "name" : "_blake2.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4426051584,
    "size" : 344064,
    "uuid" : "c031b4b0-9fe6-3f12-b72d-61b1b63fa4f2",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_bounded_integers.cpython-39-darwin.so",
    "name" : "_bounded_integers.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4416643072,
    "size" : 65536,
    "uuid" : "28eb0207-3278-3299-a6e1-af6198c95536",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_mt19937.cpython-39-darwin.so",
    "name" : "_mt19937.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4425355264,
    "size" : 65536,
    "uuid" : "dbeca4b1-3fb3-3a81-a2fe-4ff45340f900",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_philox.cpython-39-darwin.so",
    "name" : "_philox.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4425068544,
    "size" : 65536,
    "uuid" : "d29931bb-5833-38e0-b60c-ec87f9495fa4",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_pcg64.cpython-39-darwin.so",
    "name" : "_pcg64.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4416790528,
    "size" : 32768,
    "uuid" : "e84a3da1-4290-32da-98dc-8d8e708fca1a",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_sfc64.cpython-39-darwin.so",
    "name" : "_sfc64.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4428537856,
    "size" : 589824,
    "uuid" : "793608fd-338f-3f47-abff-e2dc17331adb",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_generator.cpython-39-darwin.so",
    "name" : "_generator.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4413677568,
    "size" : 4096,
    "uuid" : "d0f47093-7e88-3d31-9906-b6b48a0ff811",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_opcode.cpython-39-darwin.so",
    "name" : "_opcode.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4426592256,
    "size" : 126976,
    "uuid" : "75eff895-415d-3be0-9017-952a6d6c54c5",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/geometry\/_geometry.cpython-39-darwin.so",
    "name" : "_geometry.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4514193408,
    "size" : 1605632,
    "uuid" : "5590e5eb-1a53-3bf0-9ffc-71d23992c730",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtCore.abi3.so",
    "name" : "QtCore.abi3.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4507025408,
    "size" : 5210112,
    "uuid" : "6238782e-d1aa-3245-81ef-2925bf1a4c96",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtCore.framework\/Versions\/A\/QtCore",
    "name" : "QtCore"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4425764864,
    "size" : 98304,
    "uuid" : "f511de72-2757-3ff5-8524-716ba83b7953",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/sip.cpython-39-darwin.so",
    "name" : "sip.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4517732352,
    "size" : 2834432,
    "uuid" : "951581e2-ae51-392a-82d9-fdf83e162d11",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtWidgets.abi3.so",
    "name" : "QtWidgets.abi3.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4706263040,
    "size" : 4931584,
    "uuid" : "5bfaef33-ce47-32bf-acb3-03cbe9e68a6f",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtWidgets.framework\/Versions\/A\/QtWidgets",
    "name" : "QtWidgets"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4693905408,
    "size" : 7094272,
    "uuid" : "cf0b9ade-9377-380e-9a84-904983d7bb60",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtGui.framework\/Versions\/A\/QtGui",
    "name" : "QtGui"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4433068032,
    "size" : 540672,
    "uuid" : "d75bc176-b599-346d-9c20-e26d546cecdf",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtDBus.framework\/Versions\/A\/QtDBus",
    "name" : "QtDBus"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4523892736,
    "size" : 1490944,
    "uuid" : "9c3eb0df-69a3-3b03-ab77-80606e4891d2",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtGui.abi3.so",
    "name" : "QtGui.abi3.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4427132928,
    "size" : 65536,
    "uuid" : "8d885ad7-b0a5-3652-95d8-53791eacb3ca",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtWebEngineWidgets.abi3.so",
    "name" : "QtWebEngineWidgets.abi3.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4426809344,
    "size" : 81920,
    "uuid" : "1e9cc466-23ad-39e2-80a4-31ff007d87d5",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtWebEngineWidgets.framework\/Versions\/A\/QtWebEngineWidgets",
    "name" : "QtWebEngineWidgets"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4429586432,
    "size" : 294912,
    "uuid" : "7178d391-3db2-3825-b031-83a02c9069fa",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtPrintSupport.framework\/Versions\/A\/QtPrintSupport",
    "name" : "QtPrintSupport"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 5062676480,
    "size" : 174571520,
    "uuid" : "473ca65c-6149-3bfa-a88b-95ac735bcd3b",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtWebEngineCore.framework\/Versions\/A\/QtWebEngineCore",
    "name" : "QtWebEngineCore"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4723576832,
    "size" : 4194304,
    "uuid" : "2320a4ff-4480-3fab-b65e-d0bfa30e7175",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtQuick.framework\/Versions\/A\/QtQuick",
    "name" : "QtQuick"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4513038336,
    "size" : 425984,
    "uuid" : "801f31da-cbeb-31ff-b9cf-f6db264a808b",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtOpenGL.framework\/Versions\/A\/QtOpenGL",
    "name" : "QtOpenGL"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4427280384,
    "size" : 540672,
    "uuid" : "9b2c88ec-5704-30b2-ad3d-1029261e37b3",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtQmlModels.framework\/Versions\/A\/QtQmlModels",
    "name" : "QtQmlModels"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4428001280,
    "size" : 196608,
    "uuid" : "7680348f-ddbb-3d03-b57e-51a794fc69aa",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtWebChannel.framework\/Versions\/A\/QtWebChannel",
    "name" : "QtWebChannel"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4729262080,
    "size" : 4112384,
    "uuid" : "b142d2df-822a-3c32-93f9-9c3a3c116594",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtQml.framework\/Versions\/A\/QtQml",
    "name" : "QtQml"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4527169536,
    "size" : 1163264,
    "uuid" : "4e8fb178-39bd-37fc-92f2-6fbc9d82af88",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtNetwork.framework\/Versions\/A\/QtNetwork",
    "name" : "QtNetwork"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4528676864,
    "size" : 491520,
    "uuid" : "bc6797b4-2790-31eb-91cb-ec099d47f563",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtPositioning.framework\/Versions\/A\/QtPositioning",
    "name" : "QtPositioning"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4428296192,
    "size" : 81920,
    "uuid" : "e7d49a3d-a512-3f57-8fe3-a90e0c97f2c2",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtQuickWidgets.framework\/Versions\/A\/QtQuickWidgets",
    "name" : "QtQuickWidgets"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4420403200,
    "size" : 32768,
    "uuid" : "da4429b4-302e-3d2b-9b06-391152bff6fa",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtWebChannel.abi3.so",
    "name" : "QtWebChannel.abi3.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4704497664,
    "size" : 458752,
    "uuid" : "7dd9c25c-c2a0-3248-8f79-da774e47248d",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtNetwork.abi3.so",
    "name" : "QtNetwork.abi3.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4703473664,
    "size" : 212992,
    "uuid" : "bbba7cd3-3207-3cce-b34b-1c5d98ea53eb",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtWebEngineCore.abi3.so",
    "name" : "QtWebEngineCore.abi3.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4513660928,
    "size" : 147456,
    "uuid" : "8dd82bcd-6f94-324d-b419-e93c71b99376",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtPrintSupport.abi3.so",
    "name" : "QtPrintSupport.abi3.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4714430464,
    "size" : 638976,
    "uuid" : "7175bc4c-ca2f-30b6-9734-062b84bd0ae2",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/platforms\/libqcocoa.dylib",
    "name" : "libqcocoa.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4703010816,
    "size" : 163840,
    "uuid" : "60501060-de6d-35b6-8325-74cf1323cca0",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/styles\/libqmacstyle.dylib",
    "name" : "libqmacstyle.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4529315840,
    "size" : 12288,
    "uuid" : "887805e6-e59a-3c6e-b025-b018d0d5e48b",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/fcntl.cpython-39-darwin.so",
    "name" : "fcntl.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4704063488,
    "size" : 180224,
    "uuid" : "620756c7-4f13-3305-b7e6-2653d410e4a6",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/pyexpat.cpython-39-darwin.so",
    "name" : "pyexpat.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4703272960,
    "size" : 57344,
    "uuid" : "4be1a98e-c179-38fa-854c-0dc2cc23696d",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_socket.cpython-39-darwin.so",
    "name" : "_socket.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4529364992,
    "size" : 32768,
    "uuid" : "7d6b64db-191d-3216-97d9-ac978b08929e",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/array.cpython-39-darwin.so",
    "name" : "array.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4703383552,
    "size" : 8192,
    "uuid" : "1eae6074-8612-3bc6-b16b-c173a995e90c",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_queue.cpython-39-darwin.so",
    "name" : "_queue.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4704342016,
    "size" : 20480,
    "uuid" : "73712781-c20d-3f97-9760-5c95eb030227",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_csv.cpython-39-darwin.so",
    "name" : "_csv.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4514152448,
    "size" : 4096,
    "uuid" : "bf662773-0d04-3254-b643-bbe11593cfbd",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic_lib\/_load_libs.cpython-39-darwin.so",
    "name" : "_load_libs.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4773732352,
    "size" : 1253376,
    "uuid" : "5192d8ff-91ee-3ba1-acbe-0cc0875d9dd3",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic_lib\/lib\/libatomstruct.dylib",
    "name" : "libatomstruct.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4704399360,
    "size" : 24576,
    "uuid" : "40ef14e9-a17d-39b6-be0c-127555677085",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic_lib\/lib\/libelement.dylib",
    "name" : "libelement.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4703428608,
    "size" : 4096,
    "uuid" : "6f0774d3-c270-3d3b-a12f-e63ec563d40d",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic_lib\/lib\/libpyinstance.dylib",
    "name" : "libpyinstance.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4705619968,
    "size" : 217088,
    "uuid" : "7e9191e6-b126-301c-9f6a-d5b23f0013b8",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic\/libmolc.dylib",
    "name" : "libmolc.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4754276352,
    "size" : 372736,
    "uuid" : "95fc95cc-2a76-36f6-b171-503f2c5e75cb",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic\/cymol.cpython-39-darwin.so",
    "name" : "cymol.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4770529280,
    "size" : 110592,
    "uuid" : "3b4799e1-0245-3f6e-9109-a9ac8206aefd",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/tinyarray.cpython-39-darwin.so",
    "name" : "tinyarray.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4706107392,
    "size" : 36864,
    "uuid" : "6ea8e4d1-a62b-3827-9897-2823a0b67614",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic\/cytmpl.cpython-39-darwin.so",
    "name" : "cytmpl.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4772114432,
    "size" : 548864,
    "uuid" : "9dcd38a4-f108-3a57-9c0e-954d70f6b885",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/map\/_map.cpython-39-darwin.so",
    "name" : "_map.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4770766848,
    "size" : 86016,
    "uuid" : "b9c1eb65-29b3-3cc9-87cb-63be7734a3c7",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_ssl.cpython-39-darwin.so",
    "name" : "_ssl.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4706217984,
    "size" : 4096,
    "uuid" : "f905c35e-44ce-3ab4-b790-b5efa6fa95e8",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_scproxy.cpython-39-darwin.so",
    "name" : "_scproxy.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4723445760,
    "size" : 16384,
    "uuid" : "e41a65c4-df75-3d5a-890b-9a8577668c95",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/charset_normalizer\/md.cpython-39-darwin.so",
    "name" : "md.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4770050048,
    "size" : 131072,
    "uuid" : "3fdee7fa-47ca-3a24-bdf1-a967c1e82890",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/charset_normalizer\/md__mypyc.cpython-39-darwin.so",
    "name" : "md__mypyc.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4777984000,
    "size" : 1093632,
    "uuid" : "d95f3165-cb18-3268-914d-e0787602c93f",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/unicodedata.cpython-39-darwin.so",
    "name" : "unicodedata.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4754915328,
    "size" : 20480,
    "uuid" : "b6eb0e34-67c7-373c-8f57-ea91e98a9b10",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_multibytecodec.cpython-39-darwin.so",
    "name" : "_multibytecodec.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4723511296,
    "size" : 4096,
    "uuid" : "f5a33081-e839-36e3-aac1-06c51c431620",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_uuid.cpython-39-darwin.so",
    "name" : "_uuid.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4772859904,
    "size" : 307200,
    "uuid" : "859b4edd-8da4-3f22-86e0-07538c7b5aa5",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_decimal.cpython-39-darwin.so",
    "name" : "_decimal.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4770967552,
    "size" : 819200,
    "uuid" : "ec819ef5-b16f-3f6b-b23d-03751398c0a3",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/_imaging.cpython-39-darwin.so",
    "name" : "_imaging.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4776923136,
    "size" : 557056,
    "uuid" : "91766682-e5af-36de-8e46-40aae99e8ebc",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libopenjp2.2.5.0.dylib",
    "name" : "libopenjp2.2.5.0.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4770344960,
    "size" : 131072,
    "uuid" : "b683b844-94c8-3f8a-beb5-91a6d8400c27",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libz.1.2.13.dylib",
    "name" : "libz.1.2.13.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4775645184,
    "size" : 1081344,
    "uuid" : "89eeb1e7-5ff6-38db-8cb6-e21e09420bfe",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libtiff.5.dylib",
    "name" : "libtiff.5.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4773294080,
    "size" : 163840,
    "uuid" : "15c6e7fa-c3e7-3ee3-ae79-9a665bbdde8d",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libxcb.1.1.0.dylib",
    "name" : "libxcb.1.1.0.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4777562112,
    "size" : 196608,
    "uuid" : "b0d3eea1-3ea6-3ee2-bf57-abab390b6e3c",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/liblzma.5.dylib",
    "name" : "liblzma.5.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4772016128,
    "size" : 16384,
    "uuid" : "568add8e-f7cf-38b0-9331-09a426332386",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libXau.6.dylib",
    "name" : "libXau.6.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4773646336,
    "size" : 16384,
    "uuid" : "c019ad02-bd14-398d-a4fd-e9e4afb4b6e0",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libXdmcp.6.dylib",
    "name" : "libXdmcp.6.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4773572608,
    "size" : 12288,
    "uuid" : "16da837b-0859-30b7-ba52-b0f481c0e785",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/termios.cpython-39-darwin.so",
    "name" : "termios.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4779134976,
    "size" : 16384,
    "uuid" : "ade40abc-2f4a-329a-85cd-79f89e46722e",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/matplotlib\/_c_internal_utils.cpython-39-darwin.so",
    "name" : "_c_internal_utils.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4779610112,
    "size" : 131072,
    "uuid" : "15c5112f-e802-397a-ab70-78b767c00ddf",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/matplotlib\/_path.cpython-39-darwin.so",
    "name" : "_path.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4781518848,
    "size" : 671744,
    "uuid" : "e6de4cc7-aef8-3516-9028-7d24011f9a4a",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/matplotlib\/ft2font.cpython-39-darwin.so",
    "name" : "ft2font.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4779200512,
    "size" : 98304,
    "uuid" : "8a1f8383-59fa-3629-9c87-465192203088",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/kiwisolver\/_cext.cpython-39-darwin.so",
    "name" : "_cext.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4780236800,
    "size" : 163840,
    "uuid" : "95976df9-a305-3674-b12c-d53106a0a7fb",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/matplotlib\/_image.cpython-39-darwin.so",
    "name" : "_image.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4779806720,
    "size" : 151552,
    "uuid" : "9a40449f-d479-3ae9-a9d8-3f7a8d89b1ba",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/surface\/_surface.cpython-39-darwin.so",
    "name" : "_surface.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4776873984,
    "size" : 4096,
    "uuid" : "eb6596f0-6c8e-33b8-a8e2-f6609e0a6d86",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/pdb_lib\/_load_libs.cpython-39-darwin.so",
    "name" : "_load_libs.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4777824256,
    "size" : 24576,
    "uuid" : "f9157b35-e0ad-39d9-a2be-d1613dfc0ba2",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/pdb_lib\/lib\/libpdbconnect.dylib",
    "name" : "libpdbconnect.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4779446272,
    "size" : 36864,
    "uuid" : "4d4d6c45-fa58-3cee-b1fd-935c81b3d0b4",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/errorchecker.cpython-39-darwin.so",
    "name" : "errorchecker.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4781109248,
    "size" : 176128,
    "uuid" : "92179bb5-b1e9-3d74-ab97-1ebb7d7ae1e3",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/arraydatatype.cpython-39-darwin.so",
    "name" : "arraydatatype.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4780466176,
    "size" : 208896,
    "uuid" : "02a51b14-39d5-30d0-a9e7-4a9188d5084b",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/wrapper.cpython-39-darwin.so",
    "name" : "wrapper.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4780044288,
    "size" : 40960,
    "uuid" : "fb5796bc-2097-34fd-aa9e-ac5ec077ef6f",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/formathandler.cpython-39-darwin.so",
    "name" : "formathandler.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4782403584,
    "size" : 32768,
    "uuid" : "1da0fbf1-6658-3ab0-bfaf-3ecde710627d",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/latebind.cpython-39-darwin.so",
    "name" : "latebind.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4780843008,
    "size" : 106496,
    "uuid" : "988c7ab9-57c2-3f1f-81f6-58afbd09155f",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/vbo.cpython-39-darwin.so",
    "name" : "vbo.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4777902080,
    "size" : 32768,
    "uuid" : "2260e39a-f951-3ccb-a3d0-b5a148b476ef",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqgif.dylib",
    "name" : "libqgif.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4781436928,
    "size" : 32768,
    "uuid" : "73d7bcd4-8546-396d-a967-2b785956402a",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqwbmp.dylib",
    "name" : "libqwbmp.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4839370752,
    "size" : 589824,
    "uuid" : "3b229f97-2736-3600-b112-046517b55a28",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqwebp.dylib",
    "name" : "libqwebp.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4838371328,
    "size" : 32768,
    "uuid" : "4d459091-8414-3dd9-a319-ee4211c41c4f",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqico.dylib",
    "name" : "libqico.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4838178816,
    "size" : 32768,
    "uuid" : "b29450f6-8c13-3f1e-9427-b5575bbd2213",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqmacheif.dylib",
    "name" : "libqmacheif.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4840026112,
    "size" : 458752,
    "uuid" : "151efa3b-6415-3f4d-a2cd-0dda27471d74",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqjpeg.dylib",
    "name" : "libqjpeg.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4838453248,
    "size" : 442368,
    "uuid" : "3d7ed307-a3b4-3412-85bb-f5632e4815f1",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqtiff.dylib",
    "name" : "libqtiff.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4838260736,
    "size" : 32768,
    "uuid" : "fd611473-3a96-3452-9f7f-3dda20d00245",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqsvg.dylib",
    "name" : "libqsvg.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4838977536,
    "size" : 245760,
    "uuid" : "0813164b-4492-302c-869b-1216dcde7f80",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtSvg.framework\/Versions\/A\/QtSvg",
    "name" : "QtSvg"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4840742912,
    "size" : 32768,
    "uuid" : "ce0d663c-e2e6-390b-9ac5-39b3a57677d4",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqpdf.dylib",
    "name" : "libqpdf.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4857364480,
    "size" : 8241152,
    "uuid" : "14700322-295c-3fb7-baf2-c550dfb64888",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtPdf.framework\/Versions\/A\/QtPdf",
    "name" : "QtPdf"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4840550400,
    "size" : 32768,
    "uuid" : "8015e3fa-97c4-3f06-b195-f49611fc1bb3",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqicns.dylib",
    "name" : "libqicns.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4840632320,
    "size" : 32768,
    "uuid" : "240d6086-fc62-33e6-ba7a-d165f711e209",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqtga.dylib",
    "name" : "libqtga.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4841021440,
    "size" : 32768,
    "uuid" : "37b5a2dc-1384-3311-8590-292529c94730",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqmacjp2.dylib",
    "name" : "libqmacjp2.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64h",
    "base" : 4840824832,
    "size" : 65536,
    "uuid" : "d2da3b5f-f5ba-3ef1-b99d-bc64a8487401",
    "path" : "\/usr\/lib\/libobjc-trampolines.dylib",
    "name" : "libobjc-trampolines.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4780158976,
    "size" : 4096,
    "uuid" : "176a598c-2a97-38a7-82a0-9cee2f55e0b3",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/core\/_mac_util.cpython-39-darwin.so",
    "name" : "_mac_util.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4855857152,
    "size" : 98304,
    "uuid" : "b103f1cd-dafd-3f25-a627-7b8fe067937c",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/lz4\/_version.cpython-39-darwin.so",
    "name" : "_version.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4855545856,
    "size" : 212992,
    "uuid" : "0a572b0f-7271-319c-9f17-7d1821eaccd7",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/lz4\/frame\/_frame.cpython-39-darwin.so",
    "name" : "_frame.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4856528896,
    "size" : 143360,
    "uuid" : "809e113e-a9e6-304f-8c5d-9c998d93032c",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/core\/_serialize.cpython-39-darwin.so",
    "name" : "_serialize.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4856819712,
    "size" : 98304,
    "uuid" : "da802e8c-8946-3174-a88d-c460d9f502f9",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/msgpack\/_cmsgpack.cpython-39-darwin.so",
    "name" : "_cmsgpack.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4856160256,
    "size" : 16384,
    "uuid" : "3b220334-2123-365c-babe-beb387dab5ca",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/linalg\/lapack_lite.cpython-39-darwin.so",
    "name" : "lapack_lite.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4856004608,
    "size" : 77824,
    "uuid" : "45e679b6-43af-3a5e-b39a-4521b5380f01",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic\/_ribbons.cpython-39-darwin.so",
    "name" : "_ribbons.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4856393728,
    "size" : 20480,
    "uuid" : "ba973aa3-7e75-3e17-ba66-60209a667b0d",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/graphics\/_graphics.cpython-39-darwin.so",
    "name" : "_graphics.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4867407872,
    "size" : 454656,
    "uuid" : "5a0f30d4-b4ba-316a-8278-78d0c72f5977",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/mmcif\/mmcif.cpython-39-darwin.so",
    "name" : "mmcif.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4866048000,
    "size" : 446464,
    "uuid" : "363f0a7f-8a13-3465-82ee-3a637fe01cc3",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/mmcif\/_mmcif.cpython-39-darwin.so",
    "name" : "_mmcif.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4857032704,
    "size" : 176128,
    "uuid" : "5e4388ca-929a-385d-8f7e-4a6c443b3eab",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/pdb\/_pdbio.cpython-39-darwin.so",
    "name" : "_pdbio.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4873232384,
    "size" : 1646592,
    "uuid" : "f6715553-8e55-3558-821f-aa3230c76581",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/lxml\/etree.cpython-39-darwin.so",
    "name" : "etree.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4868669440,
    "size" : 139264,
    "uuid" : "39a3906c-1e68-3b4d-b78b-0ba3a985c514",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/lxml\/_elementpath.cpython-39-darwin.so",
    "name" : "_elementpath.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4872634368,
    "CFBundleShortVersionString" : "3.0",
    "CFBundleIdentifier" : "com.apple.security.csparser",
    "size" : 98304,
    "uuid" : "26a4d257-e0f8-3d9b-be1c-3346667a17ba",
    "path" : "\/System\/Library\/Frameworks\/Security.framework\/Versions\/A\/PlugIns\/csparser.bundle\/Contents\/MacOS\/csparser",
    "name" : "csparser",
    "CFBundleVersion" : "60420.101.4"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4944519168,
    "size" : 69632,
    "uuid" : "945a985a-b909-351d-bdab-7b4cc3abe896",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/numpy_formathandler.cpython-39-darwin.so",
    "name" : "numpy_formathandler.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4952010752,
    "size" : 24576,
    "uuid" : "31758f9e-950f-3dd3-aabd-b4f95f7234e3",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/nones_formathandler.cpython-39-darwin.so",
    "name" : "nones_formathandler.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4958318592,
    "size" : 16384,
    "uuid" : "b3a28b9e-f2e7-30be-b15e-275f4f68c91b",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/alignment_algs\/_sw.cpython-39-darwin.so",
    "name" : "_sw.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4973678592,
    "size" : 4096,
    "uuid" : "e1f9fc84-3b63-3ab7-b6d9-8a3d7a31082f",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/alignment_algs\/libalign_algs.dylib",
    "name" : "libalign_algs.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4973522944,
    "size" : 28672,
    "uuid" : "b3fdf741-e64a-382d-829e-9788a9d976e1",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/alignment_algs\/_nw.cpython-39-darwin.so",
    "name" : "_nw.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 4702883840,
    "size" : 8192,
    "uuid" : "9e241d8d-ee83-3dfd-aa89-fd7a71a7d9de",
    "path" : "\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_multiprocessing.cpython-39-darwin.so",
    "name" : "_multiprocessing.cpython-39-darwin.so"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 140703508766720,
    "size" : 237560,
    "uuid" : "08606a44-7008-3658-9f00-6c250b80e9c3",
    "path" : "\/usr\/lib\/system\/libsystem_kernel.dylib",
    "name" : "libsystem_kernel.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 140703509004288,
    "size" : 49152,
    "uuid" : "86dfa543-95fa-36b4-83c6-bf03d01b2aad",
    "path" : "\/usr\/lib\/system\/libsystem_pthread.dylib",
    "name" : "libsystem_pthread.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 140703507615744,
    "size" : 557048,
    "uuid" : "0773ddbc-707e-3b56-ad3e-97aaa9b2c3ed",
    "path" : "\/usr\/lib\/system\/libsystem_c.dylib",
    "name" : "libsystem_c.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 140703509200896,
    "size" : 40944,
    "uuid" : "c99e2bcf-5fa3-3690-9f4b-5e9a08b57343",
    "path" : "\/usr\/lib\/system\/libsystem_platform.dylib",
    "name" : "libsystem_platform.dylib"
  },
  {
    "size" : 0,
    "source" : "A",
    "base" : 0,
    "uuid" : "00000000-0000-0000-0000-000000000000"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 140703589146624,
    "CFBundleShortVersionString" : "1.600.0",
    "CFBundleIdentifier" : "com.apple.SkyLight",
    "size" : 4132859,
    "uuid" : "d13830de-e60f-353f-948c-8d4adfdbc698",
    "path" : "\/System\/Library\/PrivateFrameworks\/SkyLight.framework\/Versions\/A\/SkyLight",
    "name" : "SkyLight"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 140703507308544,
    "size" : 294900,
    "uuid" : "c03e068c-2b62-3aed-9358-e0aa79ff7851",
    "path" : "\/usr\/lib\/system\/libdispatch.dylib",
    "name" : "libdispatch.dylib"
  },
  {
    "source" : "P",
    "arch" : "x86_64h",
    "base" : 140703509417984,
    "CFBundleShortVersionString" : "6.9",
    "CFBundleIdentifier" : "com.apple.CoreFoundation",
    "size" : 4837360,
    "uuid" : "315a3f65-0954-3635-96dc-2f65c691d074",
    "path" : "\/System\/Library\/Frameworks\/CoreFoundation.framework\/Versions\/A\/CoreFoundation",
    "name" : "CoreFoundation",
    "CFBundleVersion" : "1971"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 140703671640064,
    "CFBundleShortVersionString" : "2.1.1",
    "CFBundleIdentifier" : "com.apple.HIToolbox",
    "size" : 3112958,
    "uuid" : "a6003e8b-72cc-3d98-b569-26102836c61f",
    "path" : "\/System\/Library\/Frameworks\/Carbon.framework\/Versions\/A\/Frameworks\/HIToolbox.framework\/Versions\/A\/HIToolbox",
    "name" : "HIToolbox"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 140703560597504,
    "CFBundleShortVersionString" : "6.9",
    "CFBundleIdentifier" : "com.apple.AppKit",
    "size" : 16809969,
    "uuid" : "af96f40f-d333-3647-9da4-eddc52df4753",
    "path" : "\/System\/Library\/Frameworks\/AppKit.framework\/Versions\/C\/AppKit",
    "name" : "AppKit",
    "CFBundleVersion" : "2299.50.120"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 140703505489920,
    "size" : 624040,
    "uuid" : "f22a1143-9732-3e23-a8b7-cbade6bb8301",
    "path" : "\/usr\/lib\/dyld",
    "name" : "dyld"
  },
  {
    "source" : "P",
    "arch" : "x86_64",
    "base" : 140703524782080,
    "CFBundleShortVersionString" : "6.9",
    "CFBundleIdentifier" : "com.apple.Foundation",
    "size" : 9998329,
    "uuid" : "b2777f39-79a2-3f29-849d-99acb74e4a12",
    "path" : "\/System\/Library\/Frameworks\/Foundation.framework\/Versions\/C\/Foundation",
    "name" : "Foundation",
    "CFBundleVersion" : "1971"
  }
],
  "sharedCache" : {
  "base" : 140703504867328,
  "size" : 21474836480,
  "uuid" : "5dd9a20c-1502-31aa-84b0-1cda4c95765b"
},
  "vmSummary" : "ReadOnly portion of Libraries: Total=1.1G resident=0K(0%) swapped_out_or_unallocated=1.1G(100%)\nWritable regions: Total=13.7G written=0K(0%) resident=0K(0%) swapped_out=0K(0%) unallocated=13.7G(100%)\n\n                                VIRTUAL   REGION \nREGION TYPE                        SIZE    COUNT (non-coalesced) \n===========                     =======  ======= \nAccelerate framework               256K        2 \nActivity Tracing                   256K        1 \nCG backing stores                 7476K       13 \nCG image                           256K       39 \nColorSync                          264K       29 \nCoreAnimation                      200K       35 \nCoreGraphics                        16K        3 \nCoreServices                       624K        2 \nCoreUI image data                 3532K       42 \nFoundation                          32K        2 \nIOKit                             15.5M        2 \nKernel Alloc Once                    8K        1 \nMALLOC                            13.1G     1122 \nMALLOC guard page                   32K        8 \nMALLOC_LARGE (reserved)           2580K        2         reserved VM address space (unallocated)\nMALLOC_NANO (reserved)           128.0M        1         reserved VM address space (unallocated)\nMach message                        24K        5 \nOpenGL GLSL                        384K        4 \nSTACK GUARD                        128K       32 \nStack                            174.2M       33 \nStack Guard                       56.0M        1 \nVM_ALLOCATE                      246.2M      161 \n__CTF                               824        1 \n__DATA                            47.5M      778 \n__DATA_CONST                      41.2M      399 \n__DATA_DIRTY                      1812K      231 \n__FONT_DATA                        2352        1 \n__GLSLBUILTINS                    5174K        1 \n__INFO_FILTER                         8        1 \n__LINKEDIT                       202.6M      153 \n__OBJC_RO                         66.2M        1 \n__OBJC_RW                         2012K        2 \n__TEXT                           947.4M      781 \ndyld private memory                292K        4 \nmapped file                      541.3M       94 \nshared memory                     3004K       31 \n===========                     =======  ======= \nTOTAL                             15.5G     4018 \nTOTAL, minus reserved VM space    15.4G     4018 \n",
  "legacyInfo" : {
  "threadTriggered" : {
    "name" : "CrBrowserMain",
    "queue" : "com.apple.main-thread"
  }
},
  "logWritingSignature" : "4f43ce7d9ca3536aa3f1071a80e255b73fd7adf9",
  "trialInfo" : {
  "rollouts" : [
    {
      "rolloutId" : "5f72dc58705eff005a46b3a9",
      "factorPackIds" : {

      },
      "deploymentId" : 240000015
    },
    {
      "rolloutId" : "60186475825c62000ccf5450",
      "factorPackIds" : {

      },
      "deploymentId" : 240000055
    }
  ],
  "experiments" : [
    {
      "treatmentId" : "c28e4ee6-1b08-4f90-8e05-2809e78310a3",
      "experimentId" : "6317d2003d24842ff850182a",
      "deploymentId" : 400000013
    },
    {
      "treatmentId" : "6dd670af-0633-45e4-ae5f-122ae4df02be",
      "experimentId" : "64406ba83deb637ac8a04419",
      "deploymentId" : 900000005
    }
  ]
}
}
===== Log before crash start =====
UCSF ChimeraX version: 1.6.1 (2023-05-09)  
© 2016-2023 Regents of the University of California. All rights reserved.  

> open "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures/7v99 chimera work.cxs"

Log from Thu Jun 8 16:55:49 2023UCSF ChimeraX version: 1.6.1 (2023-05-09)  
© 2016-2023 Regents of the University of California. All rights reserved.  

> open "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures/7v99 chimera work.cxs"

Log from Tue Jun 6 16:44:25 2023UCSF ChimeraX version: 1.6.1 (2023-05-09)  
© 2016-2023 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  

> help help:quickstart

> open 2bbv

2bbv title:  
The refined three-dimensional structure of an insect virus At 2.8 angstroms
resolution [more info...]  
  
Chain information for 2bbv #1  
---  
Chain | Description | UniProt  
A B C | PROTEIN (BLACK BEETLE VIRUS CAPSID PROTEIN) | COAT_BBV 1-363  
D E F | PROTEIN (BLACK BEETLE VIRUS CAPSID PROTEIN) | COAT_BBV 364-407  
N | RNA (5'-R(*UP*CP*UP*UP*AP*UP*AP*UP*CP*U)-3') |  
  
Non-standard residues in 2bbv #1  
---  
CA — calcium ion  
  
2bbv mmCIF Assemblies  
---  
1| complete icosahedral assembly  
2| icosahedral asymmetric unit  
3| icosahedral pentamer  
4| icosahedral 23 hexamer  
5| icosahedral asymmetric unit, std point frame  
6| crystal asymmetric unit, crystal frame  
  

> color bychain

> style /b stick

Changed 2382 atom styles  

> color /n teal

[Repeated 1 time(s)]

> hide /c

> show /c

> hide /n

> shown /n

Unknown command: shown /n  

> show /n

[Repeated 1 time(s)]

> ribbon /c

[Repeated 1 time(s)]

> ribbon /n

> style /n ribbon

Expected a keyword  

> select /N:4@C5'

1 atom, 1 residue, 1 model selected  

> select up

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select up

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select down

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select down

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select up

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select up

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select down

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select down

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select up

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select up

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select down

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select down

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select up

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select up

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select down

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select down

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select up

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select up

201 atoms, 222 bonds, 10 residues, 1 model selected  

> color sel gold

> select clear

> color sel gold

> select clear

> color sel gold

> select clear

> color sel gold

> select clear

> color sel red

> surface #1

> color /n fromatoms

> surface #1

> surface #2

No atoms specified by #2  

> surface

> surface #1 hide

Expected a keyword  

> hide surfaces #1

Expected ',' or a keyword  

> hide surfaces

> show surfaces

> hide surfaces

> style solvent sphere

Changed 208 atom styles  

> color solvent red

> sym #1

2bbv mmCIF Assemblies  
---  
1| complete icosahedral assembly| 60 copies of chains A-F,N  
2| icosahedral asymmetric unit| 1 copy of chains A-F,N  
3| icosahedral pentamer| 5 copies of chains A-F,N  
4| icosahedral 23 hexamer| 6 copies of chains A-F,N  
5| icosahedral asymmetric unit, std point frame| 1 copy of chains A-F,N  
6| crystal asymmetric unit, crystal frame| 5 copies of chains A-F,N  
  

> hide #1 models

> show #1

> show #1 models

> sym #1 assembly 3 newModel false copies false

Made 5 graphical clones for 2bbv assembly 3  

> sym #1 assembly 1

Made 60 graphical clones for 2bbv assembly 1  

> show #!1 models

> hide #!1 models

> show #!1 models

> hide #!1 models

> hide #!2 models

> show #!2 models

> sym #1 assembly 1view

Assembly "1view" not found, have 1, 2, 3, 4, 5, 6  

> view

> set bgColor white

> set silhouettes true

> save /Users/matthewcomstock/Desktop/2bbv.png

> movie record

> turn y 2 180

> wait 180

> movie encode /Users/matthewcomstock/Desktop/movie1.mp4

Movie saved to /Users/matthewcomstock/Desktop/movie1.mp4  
  

> close #2

> sym #1 assembly 3 newModel false copies false

Made 5 graphical clones for 2bbv assembly 3  

> show #1 models

> view

> ui mousemode right zoom

> ui mousemode right translate

> ui mousemode right zoom

> surface #1

> color /n fromatoms

> style solvent sphere

Changed 208 atom styles  

> color solvent red

> view

> close

> set bgColor black

> set bgColor transparent

> set silhouettes false

> open 1080 fromDatabase emdb

Summary of feedback from opening 1080 fetched from emdb  
---  
note | Fetching compressed map 1080 from
ftp://ftp.ebi.ac.uk/pub/databases/emdb/structures/EMD-1080/map/emd_1080.map.gz  
  
Opened emdb 1080 as #1, grid size 100,100,100, pixel 2.7, shown at level 1.68,
step 1, values float32  

> lighting full

> volume #1 level 0.9

> volume #1 level .5

> volume #1 level .2

> volume #1 level .1

> volume #1 level 2

> volume #1 level .15

> volume #1 level 1.68

> ui mousemode right "contour level"

> volume #1 level 1.812

> volume #1 level 1.773

> volume #1 level 1.504

> volume #1 level 1.275

> volume #1 encloseVolume 1e6 step 1 color tan

> volume #1 1e5 step 1

Expected a keyword  

> volume #1 1e5 step 1 color tan

Expected a keyword  

> volume #1 encloseVolume 1e5 step 1

> volume #1 encloseVolume 1e4 step 1

> volume #1 encloseVolume 1e6 step 1 color tan

> set bgColor gray

> set bgColor #80808000

> set silhouettes true

> open 1grl

Summary of feedback from opening 1grl fetched from pdb  
---  
note | Fetching compressed mmCIF 1grl from
http://files.rcsb.org/download/1grl.cif  
  
1grl title:  
The crystal structure of the bacterial chaperonin groel At 2.8 angstroms [more
info...]  
  
Chain information for 1grl #2  
---  
Chain | Description | UniProt  
A B C D E F G | GROEL (HSP60 CLASS) | CH60_ECOLI 2-548  
  
1grl mmCIF Assemblies  
---  
1| author_and_software_defined_assembly  
2| software_defined_assembly  
  

> lighting default

> ui mousemode right zoom

> ui mousemode right "translate selected models"

> select /D:357@CG2

1 atom, 1 residue, 1 model selected  

> view matrix models #2,1,0,0,44.01,0,1,0,-1.4223,0,0,1,-0.37848

> ui mousemode right "rotate selected models"

> view matrix models
> #2,0.99999,-0.0041909,0.002923,44.116,0.0043018,0.99923,-0.039047,-2.5771,-0.0027571,0.039059,0.99923,-0.57913

> view matrix models
> #2,0.99572,-0.092469,0.00020636,43.966,0.092405,0.99494,-0.039468,1.1951,0.0034442,0.039318,0.99922,-0.31382

> fitmap #2 inMap #1

Fit molecule 1grl (#2) to map emdb 1080 (#1) using 29274 atoms  
average map value = 1.33, steps = 104  
shifted from previous position = 0.914  
rotated from previous position = 20.7 degrees  
atoms outside contour = 3707, contour level = 0.82501  
  
Position of 1grl (#2) relative to emdb 1080 (#1) coordinates:  
Matrix rotation and translation  
0.90168809 -0.43225449 -0.01070721 39.38415285  
0.43238288 0.90129381 0.02673023 18.93264110  
-0.00190392 -0.02873195 0.99958534 -0.07033036  
Axis -0.06401015 -0.01016007 0.99789753  
Axis point -21.87968789 95.67746379 0.00000000  
Rotation angle (degrees) 25.67269007  
Shift along axis -2.78352503  
  

> volume #1 transparency 0.5

> view matrix models
> #2,0.92048,-0.39074,-0.0062701,40.283,0.39076,0.92009,0.027407,17.143,-0.0049401,-0.027678,0.9996,-0.20146

> fitmap #2 inMap #1

Fit molecule 1grl (#2) to map emdb 1080 (#1) using 29274 atoms  
average map value = 1.33, steps = 60  
shifted from previous position = 0.0354  
rotated from previous position = 2.63 degrees  
atoms outside contour = 3704, contour level = 0.82501  
  
Position of 1grl (#2) relative to emdb 1080 (#1) coordinates:  
Matrix rotation and translation  
0.90160406 -0.43242969 -0.01070914 39.38027615  
0.43255808 0.90120994 0.02672371 18.93993563  
-0.00190494 -0.02872653 0.99958549 -0.07718132  
Axis -0.06397061 -0.01015704 0.99790009  
Axis point -21.87911091 95.63336281 0.00000000  
Rotation angle (degrees) 25.68378070  
Shift along axis -2.78857344  
  

> volume #1 transparency 0.5

> molmap #2 10

Opened 1grl map 10 as #3, grid size 63,63,41, pixel 3.33, shown at level
0.0611, step 1, values float32  

> volume #3 style mesh

> volume subtract #1 #3 minRms true

Opened volume difference as #4, grid size 100,100,100, pixel 2.7, shown at
step 1, values float32  
Minimum RMS scale factor for "1grl map 10 #3" above level 0.061077 is 4.5565  
  

> volume #4 color pink transparency 0

> hide atoms

> show ribbons

> close

> set bgColor black

> set bgColor transparent

> set silhouettes false

> open 1a0m fromDatabase eds

Summary of feedback from opening 1a0m fetched from eds  
---  
note | Fetching map 1a0m from
http://www.ebi.ac.uk/pdbe/coordinates/files/1a0m.ccp4  
  
Opened eds 1a0m as #1, grid size 97,101,88, pixel 0.37,0.37,0.367, shown at
level 2.28, step 1, values float32  

> open 1a0m

Summary of feedback from opening 1a0m fetched from pdb  
---  
note | Fetching compressed mmCIF 1a0m from
http://files.rcsb.org/download/1a0m.cif  
  
1a0m title:  
1.1 angstrom crystal structure of A-conotoxin [TYR15]-epi [more info...]  
  
Chain information for 1a0m #2  
---  
Chain | Description | UniProt  
A B | ALPHA-CONOTOXIN [TYR15]-EPI | CXA1_CONEP 1-16  
  
Non-standard residues in 1a0m #2  
---  
NH2 — amino group  
  

> hide ribbons

> show

> volume #1 level 1.0 style mesh

> ui mousemode right zoom

> volume zone #1 nearAtoms #2 range 2

> volume #1 level 0.5 transparency 0.6

> close

> open 1273 fromDatabase emdb

Summary of feedback from opening 1273 fetched from emdb  
---  
note | Fetching compressed map 1273 from
ftp://ftp.ebi.ac.uk/pub/databases/emdb/structures/EMD-1273/map/emd_1273.map.gz  
  
Opened emdb 1273 as #1, grid size 2048,2048,76, pixel 22.5, shown at step 1,
values int8  

> volume #1 region all showOutlineBox true

> close

> open 7v99

Summary of feedback from opening 7v99 fetched from pdb  
---  
note | Fetching compressed mmCIF 7v99 from
http://files.rcsb.org/download/7v99.cif  
  
7v99 title:  
catalytic core of human telomerase holoenzyme [more info...]  
  
Chain information for 7v99 #1  
---  
Chain | Description | UniProt  
A | Telomerase reverse transcriptase | TERT_HUMAN 1-1132  
K | Histone H2A type 1-B/E | H2A1B_HUMAN 1-129  
L | Histone H2B type 1-K | H2B1K_HUMAN 1-125  
R | Telomerase RNA component |  
S | Primer DNA |  
  

> color bychain

> set bgColor white

> set bgColor #ffffff00

> lighting simple

> lighting full

> hide atoms

> show cartoons

> show atoms

> show surfaces

> nucleotides ladder

> graphics silhouettes true

> volume hide

No volumes specified  

> select /R:33-334

5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected  

> hide surfaces sel

Expected ',' or a keyword  

> hide sel surfaces

> color sel orange

> hide /a

> hide /a atoms

> hide /a surfaces

> hide /a ribbons

> hide /s

> hide /s all

Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword  

> hide /s models

[Repeated 1 time(s)]

> show /s models

> show /s atoms

> hide /s atoms

> hide /s surfaces

> hide /s ribbons

> sym #1

7v99 mmCIF Assemblies  
---  
1| author_defined_assembly| 1 copy of chains A,K,L,R,S  
  

> show /a surfaces

> color /r teal

> color /r orange

> color /k green

> color /l green

> color /k red

> hide sel atoms

> show sel atoms

> color sel bynucleotide

> nucleotides sel stubs

> nucleotides sel ladder

> nucleotides sel stubs

> nucleotides sel tube/slab shape muffler

> nucleotides sel tube/slab shape ellipsoid

> nucleotides sel tube/slab shape box

> nucleotides sel slab

> style nucleic & sel stick

Changed 5156 atom styles  

> nucleotides sel fill

> style nucleic & sel stick

Changed 5156 atom styles  

> nucleotides sel stubs

> nucleotides sel ladder

> color #1.4 #ff59f5ff

> hide /k atoms

> hide /l atoms

> color #1.5 #00d301ff

> color #1.5 #00da01ff

> save "/Users/matthewcomstock/OneDrive - Michigan State University/project
> analysis/230308 telomerase RNA structure/telomerase structures/7v99 chimera
> work.cxs"

> open https://www.rbvi.ucsf.edu/chimerax/tutorials.html

Opened https://www.rbvi.ucsf.edu/chimerax/tutorials.html  

> ui tool show "Show Sequence Viewer"

> sequence chain /R

Alignment identifier is 1/R  

> select sequence
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> color sel red

> color sel orange

> save "/Users/matthewcomstock/OneDrive - Michigan State University/project
> analysis/230308 telomerase RNA structure/telomerase structures/7v99 chimera
> work.cxs"

> ui tool show "Show Sequence Viewer"

> sequence chain /R

Destroying pre-existing alignment with identifier 1/R  
Alignment identifier is 1/R  

> select /a

7898 atoms, 8092 bonds, 1 pseudobond, 991 residues, 2 models selected  

> select /r

5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected  

> select /r sequence
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> select sequence
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> select /r

5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected  

> select /r :1:10

Nothing selected  

> select /r:1:10

Nothing selected  

> select /r:10

Nothing selected  

> select /r:100

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select /r:101

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select /r:237

20 atoms, 21 bonds, 1 residue, 1 model selected  

> color sel red

> color sel green

> color /r:334 red

> save /Users/matthewcomstock/Desktop/image1.png supersample 3

> hide /r:start-236

> hide ribbons /r:start-236

Expected ',' or a keyword  

> hide /r:start-236 ribbons

> hide /r:335-end atoms, ribbons

> show /r:335-end atoms, ribbons

> show /r:335-end atoms

> show /r:335-end

> hide /r:335-end

> show /r atoms, ribbons

> hide /r atoms, ribbons

> show /r atoms, ribbons

> hide sequence ggguug atoms, ribbon

Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword  

> select /r sequence
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> name trapping_TR sel

> name traptr sel

> color traptr red

> color traptr orange

> select /R:33-192

3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected  

> name before_traptr sel

> hide before_traptr atoms, ribbons

> save /Users/matthewcomstock/Desktop/image1.png supersample 3

> movie record

> turn y 2 180

> wait 180

> movie encode /Users/matthewcomstock/Desktop/movie1.mp4

Movie saved to /Users/matthewcomstock/Desktop/movie1.mp4  
  

> save "/Users/matthewcomstock/OneDrive - Michigan State University/project
> analysis/230308 telomerase RNA structure/telomerase structures/7v99 chimera
> work.cxs"

> cd "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures"

Current working directory is:
/Users/matthewcomstock/Library/CloudStorage/OneDrive-
MichiganStateUniversity/project analysis/230308 telomerase RNA
structure/telomerase structures  

> select /a

7898 atoms, 8092 bonds, 1 pseudobond, 991 residues, 2 models selected  

> transparency (#!1 & sel) 50

> show /s atoms, ribbons

> color /s red

> show before_traptr ribbons

> hide before_traptr ribbons

> ribbon before_traptr

> hide ribbons

> show ribbons

> hide /a ribbons

> hide before_traptr

> hide before_traptr ribbons

> before_traptr

Unknown command: before_traptr  

> select /R:33-192

3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected  

> hide sel

> hide sel ribbons

> hide sel ribbons, atoms

> show sel ribbons, atoms

> hide sel ribbons, atoms

> name before_traptr sel

> show before_traptr ribbons

> show before_traptr ribbons, atoms

> hide before_traptr ribbons, atoms

> show before_traptr ribbons

> show before_traptr ribbons transparency .5

Expected ',' or a keyword  

> show before_traptr ribbon, transparency .5

Missing or invalid "what" argument: Should be one of 'atoms', 'bonds',
'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces'  

> transparancy before_traptr 0.5

Unknown command: transparancy before_traptr 0.5  

> select before_traptr

5156 atoms, 3422 bonds, 104 pseudobonds, 243 residues, 3 models selected  

> transparancy 0.5

Unknown command: transparancy 0.5  

> transparency 0.5

> transparency 1

> transparency /a 50

> transparency /a 75

> transparency /a 25

> transparency /a 35

> transparency before_traptr 35

> surface before_traptr

> hide surfaces

> show /a surfaces

> show /k, /l surface

Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword  

> show /k or /l surface

Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword  

> show /k and /l surface

Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword  

> show /l surfaces

> show /k surfaces

> hide before_traptr

> hide traptr

> hide traptr ribbons

> hide traptr ribbons, atoms

> show traptr ribbons, atoms

> /r
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

Unknown command: sequence /r
ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg  

> select sequence /r
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

Expected a keyword  

> select /r sequence
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> name traptr /r sequence
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

"/r sequence
ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg":
contains extra trailing text  

> name traptr sel

> select /R:33-192

3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected  

> select /R:33-192

3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected  

> name before_traptr sel

> hide before_traptr

> hide before_traptr atoms, ribbons

> hide traptr atoms, ribbons

> lighting soft

> lighting simple

> lighting full

> lighting simple

> show /r:33:147

> show /r:33-147

> show /r:33-137

> show /r:33-147

> hide /r:33-147

> select /r:237-334

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> name traptr sel

> hide traptr

> hide traptr atoms, ribbons

> show traptr atoms, ribbons

> select /R:33-192

3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected  

> select /r:163-192

643 atoms, 720 bonds, 30 residues, 1 model selected  

> name beforetr1 sel

> show beforetr1 atoms, ribbons

> hide beforetr1 atoms, ribbons

> hide traptr atoms, ribbons

[Repeated 1 time(s)]

> hide traptr

> select /r:237-334

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> select /r:33-147

2426 atoms, 2702 bonds, 59 pseudobonds, 115 residues, 2 models selected  

> show /r:33-147

> hide /r:33-147

> select /r:33-147

2426 atoms, 2702 bonds, 59 pseudobonds, 115 residues, 2 models selected  

> name test1 sel

> show test1

> hide test1

> select test1

5156 atoms, 2702 bonds, 59 pseudobonds, 243 residues, 2 models selected  

> select /r:33-147

2426 atoms, 2702 bonds, 59 pseudobonds, 115 residues, 2 models selected  

> name beforetraptr1

"beforetraptr1" is not defined  

> name beforetraptr1 sel

> show beforetraptr1

> hide beforetraptr1

> show beforetraptr1 atoms, ribbons

> hide beforetraptr1 atoms, ribbons

> show beforetraptr1 atoms, ribbons

> show beforetraptr1 atoms, ribbons, surfaces

> hide beforetraptr1 atoms, ribbons

> color beforetraptr1 teal

> hide beforetraptr1 surfaces

> show beforetraptr1 atoms, ribbons

> transparency beforetraptr1 50 target all

> transparency beforetraptr1 50 target All

Invalid "target" argument: Character 'A' is not an allowed target, must be one
of acrsbmpfl  

> transparency beforetraptr1 50 target all

> transparency beforetraptr1 10 target all

> transparency beforetraptr1 100 target all

> color beforetraptr1 red

> color beforetraptr1 pink

> select /r:163-192

643 atoms, 720 bonds, 30 residues, 1 model selected  

> select /r:163-192

643 atoms, 720 bonds, 30 residues, 1 model selected  

> name beforetraptr2 sel

> show beforetraptr2 atoms, ribbons

> color beforetraptr2 pink

> save "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures/7v99 chimera work.cxs"

——— End of log from Tue Jun 6 16:44:25 2023 ———

opened ChimeraX session  
UCSF ChimeraX version: 1.6.1 (2023-05-09)  
© 2016-2023 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  

> show traptr ribbons, atoms

> hide traptr ribbons, atoms

> show traptr ribbons, atoms

> color traptr red

> info chains

chain id /A chain_id A  
chain id /K chain_id K  
chain id /L chain_id L  
chain id /R chain_id R  
chain id /S chain_id S  

> info models

model id #1 type AtomicStructure name 7v99  
model id #1.1 type PseudobondGroup name "hydrogen bonds"  
model id #1.2 type PseudobondGroup name "missing structure"  
model id #1.3 type MolecularSurface name "7v99_A SES surface"  
model id #1.4 type MolecularSurface name "7v99_K SES surface"  
model id #1.5 type MolecularSurface name "7v99_L SES surface"  
model id #1.6 type MolecularSurface name "7v99_R SES surface"  
model id #1.7 type MolecularSurface name "7v99_S SES surface"  

> info selection

atom id /R:163@P idatm_type Pac  
atom id /R:163@OP1 idatm_type O3-  
atom id /R:163@OP2 idatm_type O3-  
atom id /R:163@O5' idatm_type O3  
atom id /R:163@C5' idatm_type C3  
atom id /R:163@C4' idatm_type C3  
atom id /R:163@O4' idatm_type O3  
atom id /R:163@C3' idatm_type C3  
atom id /R:163@O3' idatm_type O3  
atom id /R:163@C2' idatm_type C3  
atom id /R:163@O2' idatm_type O3  
atom id /R:163@C1' idatm_type C3  
atom id /R:163@N9 idatm_type Npl  
atom id /R:163@C8 idatm_type Car  
atom id /R:163@N7 idatm_type N2  
atom id /R:163@C5 idatm_type Car  
atom id /R:163@C6 idatm_type C2  
atom id /R:163@O6 idatm_type O2  
atom id /R:163@N1 idatm_type Npl  
atom id /R:163@C2 idatm_type C2  
atom id /R:163@N2 idatm_type Npl  
atom id /R:163@N3 idatm_type N2  
atom id /R:163@C4 idatm_type Car  
atom id /R:164@P idatm_type Pac  
atom id /R:164@OP1 idatm_type O3-  
atom id /R:164@OP2 idatm_type O3-  
atom id /R:164@O5' idatm_type O3  
atom id /R:164@C5' idatm_type C3  
atom id /R:164@C4' idatm_type C3  
atom id /R:164@O4' idatm_type O3  
atom id /R:164@C3' idatm_type C3  
atom id /R:164@O3' idatm_type O3  
atom id /R:164@C2' idatm_type C3  
atom id /R:164@O2' idatm_type O3  
atom id /R:164@C1' idatm_type C3  
atom id /R:164@N9 idatm_type Npl  
atom id /R:164@C8 idatm_type Car  
atom id /R:164@N7 idatm_type N2  
atom id /R:164@C5 idatm_type Car  
atom id /R:164@C6 idatm_type Car  
atom id /R:164@N6 idatm_type Npl  
atom id /R:164@N1 idatm_type N2  
atom id /R:164@C2 idatm_type Car  
atom id /R:164@N3 idatm_type N2  
atom id /R:164@C4 idatm_type Car  
atom id /R:165@P idatm_type Pac  
atom id /R:165@OP1 idatm_type O3-  
atom id /R:165@OP2 idatm_type O3-  
atom id /R:165@O5' idatm_type O3  
atom id /R:165@C5' idatm_type C3  
atom id /R:165@C4' idatm_type C3  
atom id /R:165@O4' idatm_type O3  
atom id /R:165@C3' idatm_type C3  
atom id /R:165@O3' idatm_type O3  
atom id /R:165@C2' idatm_type C3  
atom id /R:165@O2' idatm_type O3  
atom id /R:165@C1' idatm_type C3  
atom id /R:165@N9 idatm_type Npl  
atom id /R:165@C8 idatm_type Car  
atom id /R:165@N7 idatm_type N2  
atom id /R:165@C5 idatm_type Car  
atom id /R:165@C6 idatm_type C2  
atom id /R:165@O6 idatm_type O2  
atom id /R:165@N1 idatm_type Npl  
atom id /R:165@C2 idatm_type C2  
atom id /R:165@N2 idatm_type Npl  
atom id /R:165@N3 idatm_type N2  
atom id /R:165@C4 idatm_type Car  
atom id /R:166@P idatm_type Pac  
atom id /R:166@OP1 idatm_type O3-  
atom id /R:166@OP2 idatm_type O3-  
atom id /R:166@O5' idatm_type O3  
atom id /R:166@C5' idatm_type C3  
atom id /R:166@C4' idatm_type C3  
atom id /R:166@O4' idatm_type O3  
atom id /R:166@C3' idatm_type C3  
atom id /R:166@O3' idatm_type O3  
atom id /R:166@C2' idatm_type C3  
atom id /R:166@O2' idatm_type O3  
atom id /R:166@C1' idatm_type C3  
atom id /R:166@N1 idatm_type Npl  
atom id /R:166@C2 idatm_type C2  
atom id /R:166@O2 idatm_type O2  
atom id /R:166@N3 idatm_type N2  
atom id /R:166@C4 idatm_type C2  
atom id /R:166@N4 idatm_type Npl  
atom id /R:166@C5 idatm_type C2  
atom id /R:166@C6 idatm_type C2  
atom id /R:167@P idatm_type Pac  
atom id /R:167@OP1 idatm_type O3-  
atom id /R:167@OP2 idatm_type O3-  
atom id /R:167@O5' idatm_type O3  
atom id /R:167@C5' idatm_type C3  
atom id /R:167@C4' idatm_type C3  
atom id /R:167@O4' idatm_type O3  
atom id /R:167@C3' idatm_type C3  
atom id /R:167@O3' idatm_type O3  
atom id /R:167@C2' idatm_type C3  
atom id /R:167@O2' idatm_type O3  
atom id /R:167@C1' idatm_type C3  
atom id /R:167@N9 idatm_type Npl  
atom id /R:167@C8 idatm_type Car  
atom id /R:167@N7 idatm_type N2  
atom id /R:167@C5 idatm_type Car  
atom id /R:167@C6 idatm_type Car  
atom id /R:167@N6 idatm_type Npl  
atom id /R:167@N1 idatm_type N2  
atom id /R:167@C2 idatm_type Car  
atom id /R:167@N3 idatm_type N2  
atom id /R:167@C4 idatm_type Car  
atom id /R:168@P idatm_type Pac  
atom id /R:168@OP1 idatm_type O3-  
atom id /R:168@OP2 idatm_type O3-  
atom id /R:168@O5' idatm_type O3  
atom id /R:168@C5' idatm_type C3  
atom id /R:168@C4' idatm_type C3  
atom id /R:168@O4' idatm_type O3  
atom id /R:168@C3' idatm_type C3  
atom id /R:168@O3' idatm_type O3  
atom id /R:168@C2' idatm_type C3  
atom id /R:168@O2' idatm_type O3  
atom id /R:168@C1' idatm_type C3  
atom id /R:168@N9 idatm_type Npl  
atom id /R:168@C8 idatm_type Car  
atom id /R:168@N7 idatm_type N2  
atom id /R:168@C5 idatm_type Car  
atom id /R:168@C6 idatm_type Car  
atom id /R:168@N6 idatm_type Npl  
atom id /R:168@N1 idatm_type N2  
atom id /R:168@C2 idatm_type Car  
atom id /R:168@N3 idatm_type N2  
atom id /R:168@C4 idatm_type Car  
atom id /R:169@P idatm_type Pac  
atom id /R:169@OP1 idatm_type O3-  
atom id /R:169@OP2 idatm_type O3-  
atom id /R:169@O5' idatm_type O3  
atom id /R:169@C5' idatm_type C3  
atom id /R:169@C4' idatm_type C3  
atom id /R:169@O4' idatm_type O3  
atom id /R:169@C3' idatm_type C3  
atom id /R:169@O3' idatm_type O3  
atom id /R:169@C2' idatm_type C3  
atom id /R:169@O2' idatm_type O3  
atom id /R:169@C1' idatm_type C3  
atom id /R:169@N9 idatm_type Npl  
atom id /R:169@C8 idatm_type Car  
atom id /R:169@N7 idatm_type N2  
atom id /R:169@C5 idatm_type Car  
atom id /R:169@C6 idatm_type Car  
atom id /R:169@N6 idatm_type Npl  
atom id /R:169@N1 idatm_type N2  
atom id /R:169@C2 idatm_type Car  
atom id /R:169@N3 idatm_type N2  
atom id /R:169@C4 idatm_type Car  
atom id /R:170@P idatm_type Pac  
atom id /R:170@OP1 idatm_type O3-  
atom id /R:170@OP2 idatm_type O3-  
atom id /R:170@O5' idatm_type O3  
atom id /R:170@C5' idatm_type C3  
atom id /R:170@C4' idatm_type C3  
atom id /R:170@O4' idatm_type O3  
atom id /R:170@C3' idatm_type C3  
atom id /R:170@O3' idatm_type O3  
atom id /R:170@C2' idatm_type C3  
atom id /R:170@O2' idatm_type O3  
atom id /R:170@C1' idatm_type C3  
atom id /R:170@N1 idatm_type Npl  
atom id /R:170@C2 idatm_type C2  
atom id /R:170@O2 idatm_type O2  
atom id /R:170@N3 idatm_type N2  
atom id /R:170@C4 idatm_type C2  
atom id /R:170@N4 idatm_type Npl  
atom id /R:170@C5 idatm_type C2  
atom id /R:170@C6 idatm_type C2  
atom id /R:171@P idatm_type Pac  
atom id /R:171@OP1 idatm_type O3-  
atom id /R:171@OP2 idatm_type O3-  
atom id /R:171@O5' idatm_type O3  
atom id /R:171@C5' idatm_type C3  
atom id /R:171@C4' idatm_type C3  
atom id /R:171@O4' idatm_type O3  
atom id /R:171@C3' idatm_type C3  
atom id /R:171@O3' idatm_type O3  
atom id /R:171@C2' idatm_type C3  
atom id /R:171@O2' idatm_type O3  
atom id /R:171@C1' idatm_type C3  
atom id /R:171@N9 idatm_type Npl  
atom id /R:171@C8 idatm_type Car  
atom id /R:171@N7 idatm_type N2  
atom id /R:171@C5 idatm_type Car  
atom id /R:171@C6 idatm_type Car  
atom id /R:171@N6 idatm_type Npl  
atom id /R:171@N1 idatm_type N2  
atom id /R:171@C2 idatm_type Car  
atom id /R:171@N3 idatm_type N2  
atom id /R:171@C4 idatm_type Car  
atom id /R:172@P idatm_type Pac  
atom id /R:172@OP1 idatm_type O3-  
atom id /R:172@OP2 idatm_type O3-  
atom id /R:172@O5' idatm_type O3  
atom id /R:172@C5' idatm_type C3  
atom id /R:172@C4' idatm_type C3  
atom id /R:172@O4' idatm_type O3  
atom id /R:172@C3' idatm_type C3  
atom id /R:172@O3' idatm_type O3  
atom id /R:172@C2' idatm_type C3  
atom id /R:172@O2' idatm_type O3  
atom id /R:172@C1' idatm_type C3  
atom id /R:172@N9 idatm_type Npl  
atom id /R:172@C8 idatm_type Car  
atom id /R:172@N7 idatm_type N2  
atom id /R:172@C5 idatm_type Car  
atom id /R:172@C6 idatm_type Car  
atom id /R:172@N6 idatm_type Npl  
atom id /R:172@N1 idatm_type N2  
atom id /R:172@C2 idatm_type Car  
atom id /R:172@N3 idatm_type N2  
atom id /R:172@C4 idatm_type Car  
atom id /R:173@P idatm_type Pac  
atom id /R:173@OP1 idatm_type O3-  
atom id /R:173@OP2 idatm_type O3-  
atom id /R:173@O5' idatm_type O3  
atom id /R:173@C5' idatm_type C3  
atom id /R:173@C4' idatm_type C3  
atom id /R:173@O4' idatm_type O3  
atom id /R:173@C3' idatm_type C3  
atom id /R:173@O3' idatm_type O3  
atom id /R:173@C2' idatm_type C3  
atom id /R:173@O2' idatm_type O3  
atom id /R:173@C1' idatm_type C3  
atom id /R:173@N9 idatm_type Npl  
atom id /R:173@C8 idatm_type Car  
atom id /R:173@N7 idatm_type N2  
atom id /R:173@C5 idatm_type Car  
atom id /R:173@C6 idatm_type Car  
atom id /R:173@N6 idatm_type Npl  
atom id /R:173@N1 idatm_type N2  
atom id /R:173@C2 idatm_type Car  
atom id /R:173@N3 idatm_type N2  
atom id /R:173@C4 idatm_type Car  
atom id /R:174@P idatm_type Pac  
atom id /R:174@OP1 idatm_type O3-  
atom id /R:174@OP2 idatm_type O3-  
atom id /R:174@O5' idatm_type O3  
atom id /R:174@C5' idatm_type C3  
atom id /R:174@C4' idatm_type C3  
atom id /R:174@O4' idatm_type O3  
atom id /R:174@C3' idatm_type C3  
atom id /R:174@O3' idatm_type O3  
atom id /R:174@C2' idatm_type C3  
atom id /R:174@O2' idatm_type O3  
atom id /R:174@C1' idatm_type C3  
atom id /R:174@N9 idatm_type Npl  
atom id /R:174@C8 idatm_type Car  
atom id /R:174@N7 idatm_type N2  
atom id /R:174@C5 idatm_type Car  
atom id /R:174@C6 idatm_type Car  
atom id /R:174@N6 idatm_type Npl  
atom id /R:174@N1 idatm_type N2  
atom id /R:174@C2 idatm_type Car  
atom id /R:174@N3 idatm_type N2  
atom id /R:174@C4 idatm_type Car  
atom id /R:175@P idatm_type Pac  
atom id /R:175@OP1 idatm_type O3-  
atom id /R:175@OP2 idatm_type O3-  
atom id /R:175@O5' idatm_type O3  
atom id /R:175@C5' idatm_type C3  
atom id /R:175@C4' idatm_type C3  
atom id /R:175@O4' idatm_type O3  
atom id /R:175@C3' idatm_type C3  
atom id /R:175@O3' idatm_type O3  
atom id /R:175@C2' idatm_type C3  
atom id /R:175@O2' idatm_type O3  
atom id /R:175@C1' idatm_type C3  
atom id /R:175@N9 idatm_type Npl  
atom id /R:175@C8 idatm_type Car  
atom id /R:175@N7 idatm_type N2  
atom id /R:175@C5 idatm_type Car  
atom id /R:175@C6 idatm_type Car  
atom id /R:175@N6 idatm_type Npl  
atom id /R:175@N1 idatm_type N2  
atom id /R:175@C2 idatm_type Car  
atom id /R:175@N3 idatm_type N2  
atom id /R:175@C4 idatm_type Car  
atom id /R:176@P idatm_type Pac  
atom id /R:176@OP1 idatm_type O3-  
atom id /R:176@OP2 idatm_type O3-  
atom id /R:176@O5' idatm_type O3  
atom id /R:176@C5' idatm_type C3  
atom id /R:176@C4' idatm_type C3  
atom id /R:176@O4' idatm_type O3  
atom id /R:176@C3' idatm_type C3  
atom id /R:176@O3' idatm_type O3  
atom id /R:176@C2' idatm_type C3  
atom id /R:176@O2' idatm_type O3  
atom id /R:176@C1' idatm_type C3  
atom id /R:176@N9 idatm_type Npl  
atom id /R:176@C8 idatm_type Car  
atom id /R:176@N7 idatm_type N2  
atom id /R:176@C5 idatm_type Car  
atom id /R:176@C6 idatm_type Car  
atom id /R:176@N6 idatm_type Npl  
atom id /R:176@N1 idatm_type N2  
atom id /R:176@C2 idatm_type Car  
atom id /R:176@N3 idatm_type N2  
atom id /R:176@C4 idatm_type Car  
atom id /R:177@P idatm_type Pac  
atom id /R:177@OP1 idatm_type O3-  
atom id /R:177@OP2 idatm_type O3-  
atom id /R:177@O5' idatm_type O3  
atom id /R:177@C5' idatm_type C3  
atom id /R:177@C4' idatm_type C3  
atom id /R:177@O4' idatm_type O3  
atom id /R:177@C3' idatm_type C3  
atom id /R:177@O3' idatm_type O3  
atom id /R:177@C2' idatm_type C3  
atom id /R:177@O2' idatm_type O3  
atom id /R:177@C1' idatm_type C3  
atom id /R:177@N1 idatm_type Npl  
atom id /R:177@C2 idatm_type C2  
atom id /R:177@O2 idatm_type O2  
atom id /R:177@N3 idatm_type Npl  
atom id /R:177@C4 idatm_type C2  
atom id /R:177@O4 idatm_type O2  
atom id /R:177@C5 idatm_type C2  
atom id /R:177@C6 idatm_type C2  
atom id /R:178@P idatm_type Pac  
atom id /R:178@OP1 idatm_type O3-  
atom id /R:178@OP2 idatm_type O3-  
atom id /R:178@O5' idatm_type O3  
atom id /R:178@C5' idatm_type C3  
atom id /R:178@C4' idatm_type C3  
atom id /R:178@O4' idatm_type O3  
atom id /R:178@C3' idatm_type C3  
atom id /R:178@O3' idatm_type O3  
atom id /R:178@C2' idatm_type C3  
atom id /R:178@O2' idatm_type O3  
atom id /R:178@C1' idatm_type C3  
atom id /R:178@N9 idatm_type Npl  
atom id /R:178@C8 idatm_type Car  
atom id /R:178@N7 idatm_type N2  
atom id /R:178@C5 idatm_type Car  
atom id /R:178@C6 idatm_type C2  
atom id /R:178@O6 idatm_type O2  
atom id /R:178@N1 idatm_type Npl  
atom id /R:178@C2 idatm_type C2  
atom id /R:178@N2 idatm_type Npl  
atom id /R:178@N3 idatm_type N2  
atom id /R:178@C4 idatm_type Car  
atom id /R:179@P idatm_type Pac  
atom id /R:179@OP1 idatm_type O3-  
atom id /R:179@OP2 idatm_type O3-  
atom id /R:179@O5' idatm_type O3  
atom id /R:179@C5' idatm_type C3  
atom id /R:179@C4' idatm_type C3  
atom id /R:179@O4' idatm_type O3  
atom id /R:179@C3' idatm_type C3  
atom id /R:179@O3' idatm_type O3  
atom id /R:179@C2' idatm_type C3  
atom id /R:179@O2' idatm_type O3  
atom id /R:179@C1' idatm_type C3  
atom id /R:179@N1 idatm_type Npl  
atom id /R:179@C2 idatm_type C2  
atom id /R:179@O2 idatm_type O2  
atom id /R:179@N3 idatm_type Npl  
atom id /R:179@C4 idatm_type C2  
atom id /R:179@O4 idatm_type O2  
atom id /R:179@C5 idatm_type C2  
atom id /R:179@C6 idatm_type C2  
atom id /R:180@P idatm_type Pac  
atom id /R:180@OP1 idatm_type O3-  
atom id /R:180@OP2 idatm_type O3-  
atom id /R:180@O5' idatm_type O3  
atom id /R:180@C5' idatm_type C3  
atom id /R:180@C4' idatm_type C3  
atom id /R:180@O4' idatm_type O3  
atom id /R:180@C3' idatm_type C3  
atom id /R:180@O3' idatm_type O3  
atom id /R:180@C2' idatm_type C3  
atom id /R:180@O2' idatm_type O3  
atom id /R:180@C1' idatm_type C3  
atom id /R:180@N1 idatm_type Npl  
atom id /R:180@C2 idatm_type C2  
atom id /R:180@O2 idatm_type O2  
atom id /R:180@N3 idatm_type N2  
atom id /R:180@C4 idatm_type C2  
atom id /R:180@N4 idatm_type Npl  
atom id /R:180@C5 idatm_type C2  
atom id /R:180@C6 idatm_type C2  
atom id /R:181@P idatm_type Pac  
atom id /R:181@OP1 idatm_type O3-  
atom id /R:181@OP2 idatm_type O3-  
atom id /R:181@O5' idatm_type O3  
atom id /R:181@C5' idatm_type C3  
atom id /R:181@C4' idatm_type C3  
atom id /R:181@O4' idatm_type O3  
atom id /R:181@C3' idatm_type C3  
atom id /R:181@O3' idatm_type O3  
atom id /R:181@C2' idatm_type C3  
atom id /R:181@O2' idatm_type O3  
atom id /R:181@C1' idatm_type C3  
atom id /R:181@N9 idatm_type Npl  
atom id /R:181@C8 idatm_type Car  
atom id /R:181@N7 idatm_type N2  
atom id /R:181@C5 idatm_type Car  
atom id /R:181@C6 idatm_type Car  
atom id /R:181@N6 idatm_type Npl  
atom id /R:181@N1 idatm_type N2  
atom id /R:181@C2 idatm_type Car  
atom id /R:181@N3 idatm_type N2  
atom id /R:181@C4 idatm_type Car  
atom id /R:182@P idatm_type Pac  
atom id /R:182@OP1 idatm_type O3-  
atom id /R:182@OP2 idatm_type O3-  
atom id /R:182@O5' idatm_type O3  
atom id /R:182@C5' idatm_type C3  
atom id /R:182@C4' idatm_type C3  
atom id /R:182@O4' idatm_type O3  
atom id /R:182@C3' idatm_type C3  
atom id /R:182@O3' idatm_type O3  
atom id /R:182@C2' idatm_type C3  
atom id /R:182@O2' idatm_type O3  
atom id /R:182@C1' idatm_type C3  
atom id /R:182@N9 idatm_type Npl  
atom id /R:182@C8 idatm_type Car  
atom id /R:182@N7 idatm_type N2  
atom id /R:182@C5 idatm_type Car  
atom id /R:182@C6 idatm_type C2  
atom id /R:182@O6 idatm_type O2  
atom id /R:182@N1 idatm_type Npl  
atom id /R:182@C2 idatm_type C2  
atom id /R:182@N2 idatm_type Npl  
atom id /R:182@N3 idatm_type N2  
atom id /R:182@C4 idatm_type Car  
atom id /R:183@P idatm_type Pac  
atom id /R:183@OP1 idatm_type O3-  
atom id /R:183@OP2 idatm_type O3-  
atom id /R:183@O5' idatm_type O3  
atom id /R:183@C5' idatm_type C3  
atom id /R:183@C4' idatm_type C3  
atom id /R:183@O4' idatm_type O3  
atom id /R:183@C3' idatm_type C3  
atom id /R:183@O3' idatm_type O3  
atom id /R:183@C2' idatm_type C3  
atom id /R:183@O2' idatm_type O3  
atom id /R:183@C1' idatm_type C3  
atom id /R:183@N1 idatm_type Npl  
atom id /R:183@C2 idatm_type C2  
atom id /R:183@O2 idatm_type O2  
atom id /R:183@N3 idatm_type N2  
atom id /R:183@C4 idatm_type C2  
atom id /R:183@N4 idatm_type Npl  
atom id /R:183@C5 idatm_type C2  
atom id /R:183@C6 idatm_type C2  
atom id /R:184@P idatm_type Pac  
atom id /R:184@OP1 idatm_type O3-  
atom id /R:184@OP2 idatm_type O3-  
atom id /R:184@O5' idatm_type O3  
atom id /R:184@C5' idatm_type C3  
atom id /R:184@C4' idatm_type C3  
atom id /R:184@O4' idatm_type O3  
atom id /R:184@C3' idatm_type C3  
atom id /R:184@O3' idatm_type O3  
atom id /R:184@C2' idatm_type C3  
atom id /R:184@O2' idatm_type O3  
atom id /R:184@C1' idatm_type C3  
atom id /R:184@N1 idatm_type Npl  
atom id /R:184@C2 idatm_type C2  
atom id /R:184@O2 idatm_type O2  
atom id /R:184@N3 idatm_type Npl  
atom id /R:184@C4 idatm_type C2  
atom id /R:184@O4 idatm_type O2  
atom id /R:184@C5 idatm_type C2  
atom id /R:184@C6 idatm_type C2  
atom id /R:185@P idatm_type Pac  
atom id /R:185@OP1 idatm_type O3-  
atom id /R:185@OP2 idatm_type O3-  
atom id /R:185@O5' idatm_type O3  
atom id /R:185@C5' idatm_type C3  
atom id /R:185@C4' idatm_type C3  
atom id /R:185@O4' idatm_type O3  
atom id /R:185@C3' idatm_type C3  
atom id /R:185@O3' idatm_type O3  
atom id /R:185@C2' idatm_type C3  
atom id /R:185@O2' idatm_type O3  
atom id /R:185@C1' idatm_type C3  
atom id /R:185@N9 idatm_type Npl  
atom id /R:185@C8 idatm_type Car  
atom id /R:185@N7 idatm_type N2  
atom id /R:185@C5 idatm_type Car  
atom id /R:185@C6 idatm_type C2  
atom id /R:185@O6 idatm_type O2  
atom id /R:185@N1 idatm_type Npl  
atom id /R:185@C2 idatm_type C2  
atom id /R:185@N2 idatm_type Npl  
atom id /R:185@N3 idatm_type N2  
atom id /R:185@C4 idatm_type Car  
atom id /R:186@P idatm_type Pac  
atom id /R:186@OP1 idatm_type O3-  
atom id /R:186@OP2 idatm_type O3-  
atom id /R:186@O5' idatm_type O3  
atom id /R:186@C5' idatm_type C3  
atom id /R:186@C4' idatm_type C3  
atom id /R:186@O4' idatm_type O3  
atom id /R:186@C3' idatm_type C3  
atom id /R:186@O3' idatm_type O3  
atom id /R:186@C2' idatm_type C3  
atom id /R:186@O2' idatm_type O3  
atom id /R:186@C1' idatm_type C3  
atom id /R:186@N1 idatm_type Npl  
atom id /R:186@C2 idatm_type C2  
atom id /R:186@O2 idatm_type O2  
atom id /R:186@N3 idatm_type N2  
atom id /R:186@C4 idatm_type C2  
atom id /R:186@N4 idatm_type Npl  
atom id /R:186@C5 idatm_type C2  
atom id /R:186@C6 idatm_type C2  
atom id /R:187@P idatm_type Pac  
atom id /R:187@OP1 idatm_type O3-  
atom id /R:187@OP2 idatm_type O3-  
atom id /R:187@O5' idatm_type O3  
atom id /R:187@C5' idatm_type C3  
atom id /R:187@C4' idatm_type C3  
atom id /R:187@O4' idatm_type O3  
atom id /R:187@C3' idatm_type C3  
atom id /R:187@O3' idatm_type O3  
atom id /R:187@C2' idatm_type C3  
atom id /R:187@O2' idatm_type O3  
atom id /R:187@C1' idatm_type C3  
atom id /R:187@N1 idatm_type Npl  
atom id /R:187@C2 idatm_type C2  
atom id /R:187@O2 idatm_type O2  
atom id /R:187@N3 idatm_type Npl  
atom id /R:187@C4 idatm_type C2  
atom id /R:187@O4 idatm_type O2  
atom id /R:187@C5 idatm_type C2  
atom id /R:187@C6 idatm_type C2  
atom id /R:188@P idatm_type Pac  
atom id /R:188@OP1 idatm_type O3-  
atom id /R:188@OP2 idatm_type O3-  
atom id /R:188@O5' idatm_type O3  
atom id /R:188@C5' idatm_type C3  
atom id /R:188@C4' idatm_type C3  
atom id /R:188@O4' idatm_type O3  
atom id /R:188@C3' idatm_type C3  
atom id /R:188@O3' idatm_type O3  
atom id /R:188@C2' idatm_type C3  
atom id /R:188@O2' idatm_type O3  
atom id /R:188@C1' idatm_type C3  
atom id /R:188@N9 idatm_type Npl  
atom id /R:188@C8 idatm_type Car  
atom id /R:188@N7 idatm_type N2  
atom id /R:188@C5 idatm_type Car  
atom id /R:188@C6 idatm_type C2  
atom id /R:188@O6 idatm_type O2  
atom id /R:188@N1 idatm_type Npl  
atom id /R:188@C2 idatm_type C2  
atom id /R:188@N2 idatm_type Npl  
atom id /R:188@N3 idatm_type N2  
atom id /R:188@C4 idatm_type Car  
atom id /R:189@P idatm_type Pac  
atom id /R:189@OP1 idatm_type O3-  
atom id /R:189@OP2 idatm_type O3-  
atom id /R:189@O5' idatm_type O3  
atom id /R:189@C5' idatm_type C3  
atom id /R:189@C4' idatm_type C3  
atom id /R:189@O4' idatm_type O3  
atom id /R:189@C3' idatm_type C3  
atom id /R:189@O3' idatm_type O3  
atom id /R:189@C2' idatm_type C3  
atom id /R:189@O2' idatm_type O3  
atom id /R:189@C1' idatm_type C3  
atom id /R:189@N9 idatm_type Npl  
atom id /R:189@C8 idatm_type Car  
atom id /R:189@N7 idatm_type N2  
atom id /R:189@C5 idatm_type Car  
atom id /R:189@C6 idatm_type C2  
atom id /R:189@O6 idatm_type O2  
atom id /R:189@N1 idatm_type Npl  
atom id /R:189@C2 idatm_type C2  
atom id /R:189@N2 idatm_type Npl  
atom id /R:189@N3 idatm_type N2  
atom id /R:189@C4 idatm_type Car  
atom id /R:190@P idatm_type Pac  
atom id /R:190@OP1 idatm_type O3-  
atom id /R:190@OP2 idatm_type O3-  
atom id /R:190@O5' idatm_type O3  
atom id /R:190@C5' idatm_type C3  
atom id /R:190@C4' idatm_type C3  
atom id /R:190@O4' idatm_type O3  
atom id /R:190@C3' idatm_type C3  
atom id /R:190@O3' idatm_type O3  
atom id /R:190@C2' idatm_type C3  
atom id /R:190@O2' idatm_type O3  
atom id /R:190@C1' idatm_type C3  
atom id /R:190@N1 idatm_type Npl  
atom id /R:190@C2 idatm_type C2  
atom id /R:190@O2 idatm_type O2  
atom id /R:190@N3 idatm_type N2  
atom id /R:190@C4 idatm_type C2  
atom id /R:190@N4 idatm_type Npl  
atom id /R:190@C5 idatm_type C2  
atom id /R:190@C6 idatm_type C2  
atom id /R:191@P idatm_type Pac  
atom id /R:191@OP1 idatm_type O3-  
atom id /R:191@OP2 idatm_type O3-  
atom id /R:191@O5' idatm_type O3  
atom id /R:191@C5' idatm_type C3  
atom id /R:191@C4' idatm_type C3  
atom id /R:191@O4' idatm_type O3  
atom id /R:191@C3' idatm_type C3  
atom id /R:191@O3' idatm_type O3  
atom id /R:191@C2' idatm_type C3  
atom id /R:191@O2' idatm_type O3  
atom id /R:191@C1' idatm_type C3  
atom id /R:191@N1 idatm_type Npl  
atom id /R:191@C2 idatm_type C2  
atom id /R:191@O2 idatm_type O2  
atom id /R:191@N3 idatm_type N2  
atom id /R:191@C4 idatm_type C2  
atom id /R:191@N4 idatm_type Npl  
atom id /R:191@C5 idatm_type C2  
atom id /R:191@C6 idatm_type C2  
atom id /R:192@P idatm_type Pac  
atom id /R:192@OP1 idatm_type O3-  
atom id /R:192@OP2 idatm_type O3-  
atom id /R:192@O5' idatm_type O3  
atom id /R:192@C5' idatm_type C3  
atom id /R:192@C4' idatm_type C3  
atom id /R:192@O4' idatm_type O3  
atom id /R:192@C3' idatm_type C3  
atom id /R:192@O3' idatm_type O3  
atom id /R:192@C2' idatm_type C3  
atom id /R:192@O2' idatm_type O3  
atom id /R:192@C1' idatm_type C3  
atom id /R:192@N1 idatm_type Npl  
atom id /R:192@C2 idatm_type C2  
atom id /R:192@O2 idatm_type O2  
atom id /R:192@N3 idatm_type N2  
atom id /R:192@C4 idatm_type C2  
atom id /R:192@N4 idatm_type Npl  
atom id /R:192@C5 idatm_type C2  
atom id /R:192@C6 idatm_type C2  

> info selection

atom id /R:163@P idatm_type Pac  
atom id /R:163@OP1 idatm_type O3-  
atom id /R:163@OP2 idatm_type O3-  
atom id /R:163@O5' idatm_type O3  
atom id /R:163@C5' idatm_type C3  
atom id /R:163@C4' idatm_type C3  
atom id /R:163@O4' idatm_type O3  
atom id /R:163@C3' idatm_type C3  
atom id /R:163@O3' idatm_type O3  
atom id /R:163@C2' idatm_type C3  
atom id /R:163@O2' idatm_type O3  
atom id /R:163@C1' idatm_type C3  
atom id /R:163@N9 idatm_type Npl  
atom id /R:163@C8 idatm_type Car  
atom id /R:163@N7 idatm_type N2  
atom id /R:163@C5 idatm_type Car  
atom id /R:163@C6 idatm_type C2  
atom id /R:163@O6 idatm_type O2  
atom id /R:163@N1 idatm_type Npl  
atom id /R:163@C2 idatm_type C2  
atom id /R:163@N2 idatm_type Npl  
atom id /R:163@N3 idatm_type N2  
atom id /R:163@C4 idatm_type Car  
atom id /R:164@P idatm_type Pac  
atom id /R:164@OP1 idatm_type O3-  
atom id /R:164@OP2 idatm_type O3-  
atom id /R:164@O5' idatm_type O3  
atom id /R:164@C5' idatm_type C3  
atom id /R:164@C4' idatm_type C3  
atom id /R:164@O4' idatm_type O3  
atom id /R:164@C3' idatm_type C3  
atom id /R:164@O3' idatm_type O3  
atom id /R:164@C2' idatm_type C3  
atom id /R:164@O2' idatm_type O3  
atom id /R:164@C1' idatm_type C3  
atom id /R:164@N9 idatm_type Npl  
atom id /R:164@C8 idatm_type Car  
atom id /R:164@N7 idatm_type N2  
atom id /R:164@C5 idatm_type Car  
atom id /R:164@C6 idatm_type Car  
atom id /R:164@N6 idatm_type Npl  
atom id /R:164@N1 idatm_type N2  
atom id /R:164@C2 idatm_type Car  
atom id /R:164@N3 idatm_type N2  
atom id /R:164@C4 idatm_type Car  
atom id /R:165@P idatm_type Pac  
atom id /R:165@OP1 idatm_type O3-  
atom id /R:165@OP2 idatm_type O3-  
atom id /R:165@O5' idatm_type O3  
atom id /R:165@C5' idatm_type C3  
atom id /R:165@C4' idatm_type C3  
atom id /R:165@O4' idatm_type O3  
atom id /R:165@C3' idatm_type C3  
atom id /R:165@O3' idatm_type O3  
atom id /R:165@C2' idatm_type C3  
atom id /R:165@O2' idatm_type O3  
atom id /R:165@C1' idatm_type C3  
atom id /R:165@N9 idatm_type Npl  
atom id /R:165@C8 idatm_type Car  
atom id /R:165@N7 idatm_type N2  
atom id /R:165@C5 idatm_type Car  
atom id /R:165@C6 idatm_type C2  
atom id /R:165@O6 idatm_type O2  
atom id /R:165@N1 idatm_type Npl  
atom id /R:165@C2 idatm_type C2  
atom id /R:165@N2 idatm_type Npl  
atom id /R:165@N3 idatm_type N2  
atom id /R:165@C4 idatm_type Car  
atom id /R:166@P idatm_type Pac  
atom id /R:166@OP1 idatm_type O3-  
atom id /R:166@OP2 idatm_type O3-  
atom id /R:166@O5' idatm_type O3  
atom id /R:166@C5' idatm_type C3  
atom id /R:166@C4' idatm_type C3  
atom id /R:166@O4' idatm_type O3  
atom id /R:166@C3' idatm_type C3  
atom id /R:166@O3' idatm_type O3  
atom id /R:166@C2' idatm_type C3  
atom id /R:166@O2' idatm_type O3  
atom id /R:166@C1' idatm_type C3  
atom id /R:166@N1 idatm_type Npl  
atom id /R:166@C2 idatm_type C2  
atom id /R:166@O2 idatm_type O2  
atom id /R:166@N3 idatm_type N2  
atom id /R:166@C4 idatm_type C2  
atom id /R:166@N4 idatm_type Npl  
atom id /R:166@C5 idatm_type C2  
atom id /R:166@C6 idatm_type C2  
atom id /R:167@P idatm_type Pac  
atom id /R:167@OP1 idatm_type O3-  
atom id /R:167@OP2 idatm_type O3-  
atom id /R:167@O5' idatm_type O3  
atom id /R:167@C5' idatm_type C3  
atom id /R:167@C4' idatm_type C3  
atom id /R:167@O4' idatm_type O3  
atom id /R:167@C3' idatm_type C3  
atom id /R:167@O3' idatm_type O3  
atom id /R:167@C2' idatm_type C3  
atom id /R:167@O2' idatm_type O3  
atom id /R:167@C1' idatm_type C3  
atom id /R:167@N9 idatm_type Npl  
atom id /R:167@C8 idatm_type Car  
atom id /R:167@N7 idatm_type N2  
atom id /R:167@C5 idatm_type Car  
atom id /R:167@C6 idatm_type Car  
atom id /R:167@N6 idatm_type Npl  
atom id /R:167@N1 idatm_type N2  
atom id /R:167@C2 idatm_type Car  
atom id /R:167@N3 idatm_type N2  
atom id /R:167@C4 idatm_type Car  
atom id /R:168@P idatm_type Pac  
atom id /R:168@OP1 idatm_type O3-  
atom id /R:168@OP2 idatm_type O3-  
atom id /R:168@O5' idatm_type O3  
atom id /R:168@C5' idatm_type C3  
atom id /R:168@C4' idatm_type C3  
atom id /R:168@O4' idatm_type O3  
atom id /R:168@C3' idatm_type C3  
atom id /R:168@O3' idatm_type O3  
atom id /R:168@C2' idatm_type C3  
atom id /R:168@O2' idatm_type O3  
atom id /R:168@C1' idatm_type C3  
atom id /R:168@N9 idatm_type Npl  
atom id /R:168@C8 idatm_type Car  
atom id /R:168@N7 idatm_type N2  
atom id /R:168@C5 idatm_type Car  
atom id /R:168@C6 idatm_type Car  
atom id /R:168@N6 idatm_type Npl  
atom id /R:168@N1 idatm_type N2  
atom id /R:168@C2 idatm_type Car  
atom id /R:168@N3 idatm_type N2  
atom id /R:168@C4 idatm_type Car  
atom id /R:169@P idatm_type Pac  
atom id /R:169@OP1 idatm_type O3-  
atom id /R:169@OP2 idatm_type O3-  
atom id /R:169@O5' idatm_type O3  
atom id /R:169@C5' idatm_type C3  
atom id /R:169@C4' idatm_type C3  
atom id /R:169@O4' idatm_type O3  
atom id /R:169@C3' idatm_type C3  
atom id /R:169@O3' idatm_type O3  
atom id /R:169@C2' idatm_type C3  
atom id /R:169@O2' idatm_type O3  
atom id /R:169@C1' idatm_type C3  
atom id /R:169@N9 idatm_type Npl  
atom id /R:169@C8 idatm_type Car  
atom id /R:169@N7 idatm_type N2  
atom id /R:169@C5 idatm_type Car  
atom id /R:169@C6 idatm_type Car  
atom id /R:169@N6 idatm_type Npl  
atom id /R:169@N1 idatm_type N2  
atom id /R:169@C2 idatm_type Car  
atom id /R:169@N3 idatm_type N2  
atom id /R:169@C4 idatm_type Car  
atom id /R:170@P idatm_type Pac  
atom id /R:170@OP1 idatm_type O3-  
atom id /R:170@OP2 idatm_type O3-  
atom id /R:170@O5' idatm_type O3  
atom id /R:170@C5' idatm_type C3  
atom id /R:170@C4' idatm_type C3  
atom id /R:170@O4' idatm_type O3  
atom id /R:170@C3' idatm_type C3  
atom id /R:170@O3' idatm_type O3  
atom id /R:170@C2' idatm_type C3  
atom id /R:170@O2' idatm_type O3  
atom id /R:170@C1' idatm_type C3  
atom id /R:170@N1 idatm_type Npl  
atom id /R:170@C2 idatm_type C2  
atom id /R:170@O2 idatm_type O2  
atom id /R:170@N3 idatm_type N2  
atom id /R:170@C4 idatm_type C2  
atom id /R:170@N4 idatm_type Npl  
atom id /R:170@C5 idatm_type C2  
atom id /R:170@C6 idatm_type C2  
atom id /R:171@P idatm_type Pac  
atom id /R:171@OP1 idatm_type O3-  
atom id /R:171@OP2 idatm_type O3-  
atom id /R:171@O5' idatm_type O3  
atom id /R:171@C5' idatm_type C3  
atom id /R:171@C4' idatm_type C3  
atom id /R:171@O4' idatm_type O3  
atom id /R:171@C3' idatm_type C3  
atom id /R:171@O3' idatm_type O3  
atom id /R:171@C2' idatm_type C3  
atom id /R:171@O2' idatm_type O3  
atom id /R:171@C1' idatm_type C3  
atom id /R:171@N9 idatm_type Npl  
atom id /R:171@C8 idatm_type Car  
atom id /R:171@N7 idatm_type N2  
atom id /R:171@C5 idatm_type Car  
atom id /R:171@C6 idatm_type Car  
atom id /R:171@N6 idatm_type Npl  
atom id /R:171@N1 idatm_type N2  
atom id /R:171@C2 idatm_type Car  
atom id /R:171@N3 idatm_type N2  
atom id /R:171@C4 idatm_type Car  
atom id /R:172@P idatm_type Pac  
atom id /R:172@OP1 idatm_type O3-  
atom id /R:172@OP2 idatm_type O3-  
atom id /R:172@O5' idatm_type O3  
atom id /R:172@C5' idatm_type C3  
atom id /R:172@C4' idatm_type C3  
atom id /R:172@O4' idatm_type O3  
atom id /R:172@C3' idatm_type C3  
atom id /R:172@O3' idatm_type O3  
atom id /R:172@C2' idatm_type C3  
atom id /R:172@O2' idatm_type O3  
atom id /R:172@C1' idatm_type C3  
atom id /R:172@N9 idatm_type Npl  
atom id /R:172@C8 idatm_type Car  
atom id /R:172@N7 idatm_type N2  
atom id /R:172@C5 idatm_type Car  
atom id /R:172@C6 idatm_type Car  
atom id /R:172@N6 idatm_type Npl  
atom id /R:172@N1 idatm_type N2  
atom id /R:172@C2 idatm_type Car  
atom id /R:172@N3 idatm_type N2  
atom id /R:172@C4 idatm_type Car  
atom id /R:173@P idatm_type Pac  
atom id /R:173@OP1 idatm_type O3-  
atom id /R:173@OP2 idatm_type O3-  
atom id /R:173@O5' idatm_type O3  
atom id /R:173@C5' idatm_type C3  
atom id /R:173@C4' idatm_type C3  
atom id /R:173@O4' idatm_type O3  
atom id /R:173@C3' idatm_type C3  
atom id /R:173@O3' idatm_type O3  
atom id /R:173@C2' idatm_type C3  
atom id /R:173@O2' idatm_type O3  
atom id /R:173@C1' idatm_type C3  
atom id /R:173@N9 idatm_type Npl  
atom id /R:173@C8 idatm_type Car  
atom id /R:173@N7 idatm_type N2  
atom id /R:173@C5 idatm_type Car  
atom id /R:173@C6 idatm_type Car  
atom id /R:173@N6 idatm_type Npl  
atom id /R:173@N1 idatm_type N2  
atom id /R:173@C2 idatm_type Car  
atom id /R:173@N3 idatm_type N2  
atom id /R:173@C4 idatm_type Car  
atom id /R:174@P idatm_type Pac  
atom id /R:174@OP1 idatm_type O3-  
atom id /R:174@OP2 idatm_type O3-  
atom id /R:174@O5' idatm_type O3  
atom id /R:174@C5' idatm_type C3  
atom id /R:174@C4' idatm_type C3  
atom id /R:174@O4' idatm_type O3  
atom id /R:174@C3' idatm_type C3  
atom id /R:174@O3' idatm_type O3  
atom id /R:174@C2' idatm_type C3  
atom id /R:174@O2' idatm_type O3  
atom id /R:174@C1' idatm_type C3  
atom id /R:174@N9 idatm_type Npl  
atom id /R:174@C8 idatm_type Car  
atom id /R:174@N7 idatm_type N2  
atom id /R:174@C5 idatm_type Car  
atom id /R:174@C6 idatm_type Car  
atom id /R:174@N6 idatm_type Npl  
atom id /R:174@N1 idatm_type N2  
atom id /R:174@C2 idatm_type Car  
atom id /R:174@N3 idatm_type N2  
atom id /R:174@C4 idatm_type Car  
atom id /R:175@P idatm_type Pac  
atom id /R:175@OP1 idatm_type O3-  
atom id /R:175@OP2 idatm_type O3-  
atom id /R:175@O5' idatm_type O3  
atom id /R:175@C5' idatm_type C3  
atom id /R:175@C4' idatm_type C3  
atom id /R:175@O4' idatm_type O3  
atom id /R:175@C3' idatm_type C3  
atom id /R:175@O3' idatm_type O3  
atom id /R:175@C2' idatm_type C3  
atom id /R:175@O2' idatm_type O3  
atom id /R:175@C1' idatm_type C3  
atom id /R:175@N9 idatm_type Npl  
atom id /R:175@C8 idatm_type Car  
atom id /R:175@N7 idatm_type N2  
atom id /R:175@C5 idatm_type Car  
atom id /R:175@C6 idatm_type Car  
atom id /R:175@N6 idatm_type Npl  
atom id /R:175@N1 idatm_type N2  
atom id /R:175@C2 idatm_type Car  
atom id /R:175@N3 idatm_type N2  
atom id /R:175@C4 idatm_type Car  
atom id /R:176@P idatm_type Pac  
atom id /R:176@OP1 idatm_type O3-  
atom id /R:176@OP2 idatm_type O3-  
atom id /R:176@O5' idatm_type O3  
atom id /R:176@C5' idatm_type C3  
atom id /R:176@C4' idatm_type C3  
atom id /R:176@O4' idatm_type O3  
atom id /R:176@C3' idatm_type C3  
atom id /R:176@O3' idatm_type O3  
atom id /R:176@C2' idatm_type C3  
atom id /R:176@O2' idatm_type O3  
atom id /R:176@C1' idatm_type C3  
atom id /R:176@N9 idatm_type Npl  
atom id /R:176@C8 idatm_type Car  
atom id /R:176@N7 idatm_type N2  
atom id /R:176@C5 idatm_type Car  
atom id /R:176@C6 idatm_type Car  
atom id /R:176@N6 idatm_type Npl  
atom id /R:176@N1 idatm_type N2  
atom id /R:176@C2 idatm_type Car  
atom id /R:176@N3 idatm_type N2  
atom id /R:176@C4 idatm_type Car  
atom id /R:177@P idatm_type Pac  
atom id /R:177@OP1 idatm_type O3-  
atom id /R:177@OP2 idatm_type O3-  
atom id /R:177@O5' idatm_type O3  
atom id /R:177@C5' idatm_type C3  
atom id /R:177@C4' idatm_type C3  
atom id /R:177@O4' idatm_type O3  
atom id /R:177@C3' idatm_type C3  
atom id /R:177@O3' idatm_type O3  
atom id /R:177@C2' idatm_type C3  
atom id /R:177@O2' idatm_type O3  
atom id /R:177@C1' idatm_type C3  
atom id /R:177@N1 idatm_type Npl  
atom id /R:177@C2 idatm_type C2  
atom id /R:177@O2 idatm_type O2  
atom id /R:177@N3 idatm_type Npl  
atom id /R:177@C4 idatm_type C2  
atom id /R:177@O4 idatm_type O2  
atom id /R:177@C5 idatm_type C2  
atom id /R:177@C6 idatm_type C2  
atom id /R:178@P idatm_type Pac  
atom id /R:178@OP1 idatm_type O3-  
atom id /R:178@OP2 idatm_type O3-  
atom id /R:178@O5' idatm_type O3  
atom id /R:178@C5' idatm_type C3  
atom id /R:178@C4' idatm_type C3  
atom id /R:178@O4' idatm_type O3  
atom id /R:178@C3' idatm_type C3  
atom id /R:178@O3' idatm_type O3  
atom id /R:178@C2' idatm_type C3  
atom id /R:178@O2' idatm_type O3  
atom id /R:178@C1' idatm_type C3  
atom id /R:178@N9 idatm_type Npl  
atom id /R:178@C8 idatm_type Car  
atom id /R:178@N7 idatm_type N2  
atom id /R:178@C5 idatm_type Car  
atom id /R:178@C6 idatm_type C2  
atom id /R:178@O6 idatm_type O2  
atom id /R:178@N1 idatm_type Npl  
atom id /R:178@C2 idatm_type C2  
atom id /R:178@N2 idatm_type Npl  
atom id /R:178@N3 idatm_type N2  
atom id /R:178@C4 idatm_type Car  
atom id /R:179@P idatm_type Pac  
atom id /R:179@OP1 idatm_type O3-  
atom id /R:179@OP2 idatm_type O3-  
atom id /R:179@O5' idatm_type O3  
atom id /R:179@C5' idatm_type C3  
atom id /R:179@C4' idatm_type C3  
atom id /R:179@O4' idatm_type O3  
atom id /R:179@C3' idatm_type C3  
atom id /R:179@O3' idatm_type O3  
atom id /R:179@C2' idatm_type C3  
atom id /R:179@O2' idatm_type O3  
atom id /R:179@C1' idatm_type C3  
atom id /R:179@N1 idatm_type Npl  
atom id /R:179@C2 idatm_type C2  
atom id /R:179@O2 idatm_type O2  
atom id /R:179@N3 idatm_type Npl  
atom id /R:179@C4 idatm_type C2  
atom id /R:179@O4 idatm_type O2  
atom id /R:179@C5 idatm_type C2  
atom id /R:179@C6 idatm_type C2  
atom id /R:180@P idatm_type Pac  
atom id /R:180@OP1 idatm_type O3-  
atom id /R:180@OP2 idatm_type O3-  
atom id /R:180@O5' idatm_type O3  
atom id /R:180@C5' idatm_type C3  
atom id /R:180@C4' idatm_type C3  
atom id /R:180@O4' idatm_type O3  
atom id /R:180@C3' idatm_type C3  
atom id /R:180@O3' idatm_type O3  
atom id /R:180@C2' idatm_type C3  
atom id /R:180@O2' idatm_type O3  
atom id /R:180@C1' idatm_type C3  
atom id /R:180@N1 idatm_type Npl  
atom id /R:180@C2 idatm_type C2  
atom id /R:180@O2 idatm_type O2  
atom id /R:180@N3 idatm_type N2  
atom id /R:180@C4 idatm_type C2  
atom id /R:180@N4 idatm_type Npl  
atom id /R:180@C5 idatm_type C2  
atom id /R:180@C6 idatm_type C2  
atom id /R:181@P idatm_type Pac  
atom id /R:181@OP1 idatm_type O3-  
atom id /R:181@OP2 idatm_type O3-  
atom id /R:181@O5' idatm_type O3  
atom id /R:181@C5' idatm_type C3  
atom id /R:181@C4' idatm_type C3  
atom id /R:181@O4' idatm_type O3  
atom id /R:181@C3' idatm_type C3  
atom id /R:181@O3' idatm_type O3  
atom id /R:181@C2' idatm_type C3  
atom id /R:181@O2' idatm_type O3  
atom id /R:181@C1' idatm_type C3  
atom id /R:181@N9 idatm_type Npl  
atom id /R:181@C8 idatm_type Car  
atom id /R:181@N7 idatm_type N2  
atom id /R:181@C5 idatm_type Car  
atom id /R:181@C6 idatm_type Car  
atom id /R:181@N6 idatm_type Npl  
atom id /R:181@N1 idatm_type N2  
atom id /R:181@C2 idatm_type Car  
atom id /R:181@N3 idatm_type N2  
atom id /R:181@C4 idatm_type Car  
atom id /R:182@P idatm_type Pac  
atom id /R:182@OP1 idatm_type O3-  
atom id /R:182@OP2 idatm_type O3-  
atom id /R:182@O5' idatm_type O3  
atom id /R:182@C5' idatm_type C3  
atom id /R:182@C4' idatm_type C3  
atom id /R:182@O4' idatm_type O3  
atom id /R:182@C3' idatm_type C3  
atom id /R:182@O3' idatm_type O3  
atom id /R:182@C2' idatm_type C3  
atom id /R:182@O2' idatm_type O3  
atom id /R:182@C1' idatm_type C3  
atom id /R:182@N9 idatm_type Npl  
atom id /R:182@C8 idatm_type Car  
atom id /R:182@N7 idatm_type N2  
atom id /R:182@C5 idatm_type Car  
atom id /R:182@C6 idatm_type C2  
atom id /R:182@O6 idatm_type O2  
atom id /R:182@N1 idatm_type Npl  
atom id /R:182@C2 idatm_type C2  
atom id /R:182@N2 idatm_type Npl  
atom id /R:182@N3 idatm_type N2  
atom id /R:182@C4 idatm_type Car  
atom id /R:183@P idatm_type Pac  
atom id /R:183@OP1 idatm_type O3-  
atom id /R:183@OP2 idatm_type O3-  
atom id /R:183@O5' idatm_type O3  
atom id /R:183@C5' idatm_type C3  
atom id /R:183@C4' idatm_type C3  
atom id /R:183@O4' idatm_type O3  
atom id /R:183@C3' idatm_type C3  
atom id /R:183@O3' idatm_type O3  
atom id /R:183@C2' idatm_type C3  
atom id /R:183@O2' idatm_type O3  
atom id /R:183@C1' idatm_type C3  
atom id /R:183@N1 idatm_type Npl  
atom id /R:183@C2 idatm_type C2  
atom id /R:183@O2 idatm_type O2  
atom id /R:183@N3 idatm_type N2  
atom id /R:183@C4 idatm_type C2  
atom id /R:183@N4 idatm_type Npl  
atom id /R:183@C5 idatm_type C2  
atom id /R:183@C6 idatm_type C2  
atom id /R:184@P idatm_type Pac  
atom id /R:184@OP1 idatm_type O3-  
atom id /R:184@OP2 idatm_type O3-  
atom id /R:184@O5' idatm_type O3  
atom id /R:184@C5' idatm_type C3  
atom id /R:184@C4' idatm_type C3  
atom id /R:184@O4' idatm_type O3  
atom id /R:184@C3' idatm_type C3  
atom id /R:184@O3' idatm_type O3  
atom id /R:184@C2' idatm_type C3  
atom id /R:184@O2' idatm_type O3  
atom id /R:184@C1' idatm_type C3  
atom id /R:184@N1 idatm_type Npl  
atom id /R:184@C2 idatm_type C2  
atom id /R:184@O2 idatm_type O2  
atom id /R:184@N3 idatm_type Npl  
atom id /R:184@C4 idatm_type C2  
atom id /R:184@O4 idatm_type O2  
atom id /R:184@C5 idatm_type C2  
atom id /R:184@C6 idatm_type C2  
atom id /R:185@P idatm_type Pac  
atom id /R:185@OP1 idatm_type O3-  
atom id /R:185@OP2 idatm_type O3-  
atom id /R:185@O5' idatm_type O3  
atom id /R:185@C5' idatm_type C3  
atom id /R:185@C4' idatm_type C3  
atom id /R:185@O4' idatm_type O3  
atom id /R:185@C3' idatm_type C3  
atom id /R:185@O3' idatm_type O3  
atom id /R:185@C2' idatm_type C3  
atom id /R:185@O2' idatm_type O3  
atom id /R:185@C1' idatm_type C3  
atom id /R:185@N9 idatm_type Npl  
atom id /R:185@C8 idatm_type Car  
atom id /R:185@N7 idatm_type N2  
atom id /R:185@C5 idatm_type Car  
atom id /R:185@C6 idatm_type C2  
atom id /R:185@O6 idatm_type O2  
atom id /R:185@N1 idatm_type Npl  
atom id /R:185@C2 idatm_type C2  
atom id /R:185@N2 idatm_type Npl  
atom id /R:185@N3 idatm_type N2  
atom id /R:185@C4 idatm_type Car  
atom id /R:186@P idatm_type Pac  
atom id /R:186@OP1 idatm_type O3-  
atom id /R:186@OP2 idatm_type O3-  
atom id /R:186@O5' idatm_type O3  
atom id /R:186@C5' idatm_type C3  
atom id /R:186@C4' idatm_type C3  
atom id /R:186@O4' idatm_type O3  
atom id /R:186@C3' idatm_type C3  
atom id /R:186@O3' idatm_type O3  
atom id /R:186@C2' idatm_type C3  
atom id /R:186@O2' idatm_type O3  
atom id /R:186@C1' idatm_type C3  
atom id /R:186@N1 idatm_type Npl  
atom id /R:186@C2 idatm_type C2  
atom id /R:186@O2 idatm_type O2  
atom id /R:186@N3 idatm_type N2  
atom id /R:186@C4 idatm_type C2  
atom id /R:186@N4 idatm_type Npl  
atom id /R:186@C5 idatm_type C2  
atom id /R:186@C6 idatm_type C2  
atom id /R:187@P idatm_type Pac  
atom id /R:187@OP1 idatm_type O3-  
atom id /R:187@OP2 idatm_type O3-  
atom id /R:187@O5' idatm_type O3  
atom id /R:187@C5' idatm_type C3  
atom id /R:187@C4' idatm_type C3  
atom id /R:187@O4' idatm_type O3  
atom id /R:187@C3' idatm_type C3  
atom id /R:187@O3' idatm_type O3  
atom id /R:187@C2' idatm_type C3  
atom id /R:187@O2' idatm_type O3  
atom id /R:187@C1' idatm_type C3  
atom id /R:187@N1 idatm_type Npl  
atom id /R:187@C2 idatm_type C2  
atom id /R:187@O2 idatm_type O2  
atom id /R:187@N3 idatm_type Npl  
atom id /R:187@C4 idatm_type C2  
atom id /R:187@O4 idatm_type O2  
atom id /R:187@C5 idatm_type C2  
atom id /R:187@C6 idatm_type C2  
atom id /R:188@P idatm_type Pac  
atom id /R:188@OP1 idatm_type O3-  
atom id /R:188@OP2 idatm_type O3-  
atom id /R:188@O5' idatm_type O3  
atom id /R:188@C5' idatm_type C3  
atom id /R:188@C4' idatm_type C3  
atom id /R:188@O4' idatm_type O3  
atom id /R:188@C3' idatm_type C3  
atom id /R:188@O3' idatm_type O3  
atom id /R:188@C2' idatm_type C3  
atom id /R:188@O2' idatm_type O3  
atom id /R:188@C1' idatm_type C3  
atom id /R:188@N9 idatm_type Npl  
atom id /R:188@C8 idatm_type Car  
atom id /R:188@N7 idatm_type N2  
atom id /R:188@C5 idatm_type Car  
atom id /R:188@C6 idatm_type C2  
atom id /R:188@O6 idatm_type O2  
atom id /R:188@N1 idatm_type Npl  
atom id /R:188@C2 idatm_type C2  
atom id /R:188@N2 idatm_type Npl  
atom id /R:188@N3 idatm_type N2  
atom id /R:188@C4 idatm_type Car  
atom id /R:189@P idatm_type Pac  
atom id /R:189@OP1 idatm_type O3-  
atom id /R:189@OP2 idatm_type O3-  
atom id /R:189@O5' idatm_type O3  
atom id /R:189@C5' idatm_type C3  
atom id /R:189@C4' idatm_type C3  
atom id /R:189@O4' idatm_type O3  
atom id /R:189@C3' idatm_type C3  
atom id /R:189@O3' idatm_type O3  
atom id /R:189@C2' idatm_type C3  
atom id /R:189@O2' idatm_type O3  
atom id /R:189@C1' idatm_type C3  
atom id /R:189@N9 idatm_type Npl  
atom id /R:189@C8 idatm_type Car  
atom id /R:189@N7 idatm_type N2  
atom id /R:189@C5 idatm_type Car  
atom id /R:189@C6 idatm_type C2  
atom id /R:189@O6 idatm_type O2  
atom id /R:189@N1 idatm_type Npl  
atom id /R:189@C2 idatm_type C2  
atom id /R:189@N2 idatm_type Npl  
atom id /R:189@N3 idatm_type N2  
atom id /R:189@C4 idatm_type Car  
atom id /R:190@P idatm_type Pac  
atom id /R:190@OP1 idatm_type O3-  
atom id /R:190@OP2 idatm_type O3-  
atom id /R:190@O5' idatm_type O3  
atom id /R:190@C5' idatm_type C3  
atom id /R:190@C4' idatm_type C3  
atom id /R:190@O4' idatm_type O3  
atom id /R:190@C3' idatm_type C3  
atom id /R:190@O3' idatm_type O3  
atom id /R:190@C2' idatm_type C3  
atom id /R:190@O2' idatm_type O3  
atom id /R:190@C1' idatm_type C3  
atom id /R:190@N1 idatm_type Npl  
atom id /R:190@C2 idatm_type C2  
atom id /R:190@O2 idatm_type O2  
atom id /R:190@N3 idatm_type N2  
atom id /R:190@C4 idatm_type C2  
atom id /R:190@N4 idatm_type Npl  
atom id /R:190@C5 idatm_type C2  
atom id /R:190@C6 idatm_type C2  
atom id /R:191@P idatm_type Pac  
atom id /R:191@OP1 idatm_type O3-  
atom id /R:191@OP2 idatm_type O3-  
atom id /R:191@O5' idatm_type O3  
atom id /R:191@C5' idatm_type C3  
atom id /R:191@C4' idatm_type C3  
atom id /R:191@O4' idatm_type O3  
atom id /R:191@C3' idatm_type C3  
atom id /R:191@O3' idatm_type O3  
atom id /R:191@C2' idatm_type C3  
atom id /R:191@O2' idatm_type O3  
atom id /R:191@C1' idatm_type C3  
atom id /R:191@N1 idatm_type Npl  
atom id /R:191@C2 idatm_type C2  
atom id /R:191@O2 idatm_type O2  
atom id /R:191@N3 idatm_type N2  
atom id /R:191@C4 idatm_type C2  
atom id /R:191@N4 idatm_type Npl  
atom id /R:191@C5 idatm_type C2  
atom id /R:191@C6 idatm_type C2  
atom id /R:192@P idatm_type Pac  
atom id /R:192@OP1 idatm_type O3-  
atom id /R:192@OP2 idatm_type O3-  
atom id /R:192@O5' idatm_type O3  
atom id /R:192@C5' idatm_type C3  
atom id /R:192@C4' idatm_type C3  
atom id /R:192@O4' idatm_type O3  
atom id /R:192@C3' idatm_type C3  
atom id /R:192@O3' idatm_type O3  
atom id /R:192@C2' idatm_type C3  
atom id /R:192@O2' idatm_type O3  
atom id /R:192@C1' idatm_type C3  
atom id /R:192@N1 idatm_type Npl  
atom id /R:192@C2 idatm_type C2  
atom id /R:192@O2 idatm_type O2  
atom id /R:192@N3 idatm_type N2  
atom id /R:192@C4 idatm_type C2  
atom id /R:192@N4 idatm_type Npl  
atom id /R:192@C5 idatm_type C2  
atom id /R:192@C6 idatm_type C2  

> info traptr

1 models  
#1, 7v99, shown  
14582 atoms, 15404 bonds, 1419 residues, 5 chains (A,K,L,R,S)  
193 hydrogen bonds, 3 missing structure  

> info beforetraptr1

1 models  
#1, 7v99, shown  
14582 atoms, 15404 bonds, 1419 residues, 5 chains (A,K,L,R,S)  
193 hydrogen bonds, 3 missing structure  

> info matt

Expected a models specifier or a keyword  

> color beforetraptr1 green

> color beforetraptr2 red

> name list

before_traptr sel  
beforetr1 sel  
beforetraptr1 sel  
beforetraptr2 sel  
test1 sel  
trapping_TR sel  
traptr sel  

> select protein

9299 atoms, 9512 bonds, 1 pseudobond, 1170 residues, 2 models selected  

> color test1 red

> color traptr blue

> name delete all

> name list

There are no user-defined specifier names.  

> name traptr select /r:237-334

"select /r:237-334": invalid atom specifier  

> name traptr selection /r:237-334

"selection /r:237-334": invalid atom specifier  

> name traptr /r:237-334

> name before_traptr1 /r:33-147

> name before_traptr2 /r:163-192

> name before_traptr /r:33-192

> color /a blue

> color /a lightblue

> color /j green

> color /k green

> color /k lightgreen

> color /l lightred

Expected a color or one of 'byatom', 'bychain', 'byelement', 'byhetero',
'byidentity', 'bymodel', 'bynucleotide', 'bypolymer', 'fromatoms',
'fromcartoons', 'fromribbons', or 'random' or a keyword  

> color /l lightred

Expected a color or one of 'byatom', 'bychain', 'byelement', 'byhetero',
'byidentity', 'bymodel', 'bynucleotide', 'bypolymer', 'fromatoms',
'fromcartoons', 'fromribbons', or 'random' or a keyword  

> color /l green

> lighting soft

> color before_traptr pink

> save "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures/7v99 chimera work.cxs"

——— End of log from Thu Jun 8 16:55:49 2023 ———

opened ChimeraX session  
UCSF ChimeraX version: 1.6.1 (2023-05-09)  
© 2016-2023 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  

> color before_traptr red

> color before_traptr pink

> lighting simple

> lighting soft

> lighting full

> lighting soft

> transparency /a 50

> transparency /a 40

> transparency /a 20

> transparency /a 10

> transparency /a 90

> transparency /a 0

> transparency /a 5

> hide /a atoms

> hide /a surfaces

> show /a surfaces

> selection /a

Unknown command: selection /a  

> select /a

7898 atoms, 8092 bonds, 1 pseudobond, 991 residues, 2 models selected  

> color sel byhetero

> color sel bychain

> color sel bypolymer

> rainbow sel

> color sel bychain

> hide sel atoms

> hide sel cartoons

> hide sel surfaces

> show sel surfaces

> surface style #1.3 mesh

> surface style #1.3 dot

> surface style #1.3 solid

> transparency (#!1 & sel) 100

> transparency (#!1 & sel) 90

> transparency (#!1 & sel) 70

> save "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures/7v99 chimera work.cxs"

> ui tool show "Surface Color"

> ui tool show "File History"

> ui tool show AlphaFold

> alphafold match #1/A

Fetching AlphaFold database settings from
https://www.rbvi.ucsf.edu/chimerax/data/status/alphafold_database3.json  
Fetching compressed AlphaFold O14746 from
https://alphafold.ebi.ac.uk/files/AF-O14746-F1-model_v4.cif  
1 AlphaFold model found using UniProt identifier: O14746 (chain A)  
AlphaFold prediction matching 7v99  
---  
Chain| UniProt Id| UniProt Name| RMSD| Length| Seen| % Id  
A | O14746 | TERT_HUMAN | 5.03 | 1132 | 991 | 100  
  
Opened 1 AlphaFold model  

> hide #!2 models

> show #!2 models

> hide #!2 models

> hide target m

> show target m

> hide #!2 models

> close #2

> roll

> roll stop

Expected an axis vector or a keyword  

> roll off

Expected an axis vector or a keyword  

> stop

> tile 2

Expected a models specifier or a keyword  

> select /R:33-192

3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected  

Unsupported scale factor (0.000000) detected on Display0  

> select /R

5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected  

> select /R

5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected  

> hide beforetraptr

Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword  

> name list

before_traptr /r:33-192  
before_traptr1 /r:33-147  
before_traptr2 /r:163-192  
beforetr1 sel  
beforetraptr1 sel  
test1 sel  
trapping_TR sel  
traptr /r:237-334  

> hide before_traptr

> hide before_traptr atoms, ribbons

> hide /a

> hide /a surfaces

> hide /s atoms, ribbons

> name long_loop_hp selection /r:276-2279

"selection /r:276-2279": invalid atom specifier  

> name long_loop_hp selection /r:276-279

"selection /r:276-279": invalid atom specifier  

> name long_loop_hp select /r:276-279

"select /r:276-279": invalid atom specifier  

> name long_loop_hp /r:276-279

> color long_loop_hp red

> save "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures/7v99 chimera work.cxs"

> save /Users/matthewcomstock/Desktop/image1.png supersample 3

QPainter::begin: Paint device returned engine == 0, type: 3  


===== Log before crash end =====

Log:
UCSF ChimeraX version: 1.6.1 (2023-05-09)  
© 2016-2023 Regents of the University of California. All rights reserved.  

> open "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures/7v99 chimera work.cxs"

Log from Mon Jun 12 09:55:11 2023UCSF ChimeraX version: 1.6.1 (2023-05-09)  
© 2016-2023 Regents of the University of California. All rights reserved.  

> open "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures/7v99 chimera work.cxs"

Log from Thu Jun 8 16:55:49 2023UCSF ChimeraX version: 1.6.1 (2023-05-09)  
© 2016-2023 Regents of the University of California. All rights reserved.  

> open "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures/7v99 chimera work.cxs"

Log from Tue Jun 6 16:44:25 2023UCSF ChimeraX version: 1.6.1 (2023-05-09)  
© 2016-2023 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  

> help help:quickstart

> open 2bbv

2bbv title:  
The refined three-dimensional structure of an insect virus At 2.8 angstroms
resolution [more info...]  
  
Chain information for 2bbv #1  
---  
Chain | Description | UniProt  
A B C | PROTEIN (BLACK BEETLE VIRUS CAPSID PROTEIN) | COAT_BBV 1-363  
D E F | PROTEIN (BLACK BEETLE VIRUS CAPSID PROTEIN) | COAT_BBV 364-407  
N | RNA (5'-R(*UP*CP*UP*UP*AP*UP*AP*UP*CP*U)-3') |  
  
Non-standard residues in 2bbv #1  
---  
CA — calcium ion  
  
2bbv mmCIF Assemblies  
---  
1| complete icosahedral assembly  
2| icosahedral asymmetric unit  
3| icosahedral pentamer  
4| icosahedral 23 hexamer  
5| icosahedral asymmetric unit, std point frame  
6| crystal asymmetric unit, crystal frame  
  

> color bychain

> style /b stick

Changed 2382 atom styles  

> color /n teal

[Repeated 1 time(s)]

> hide /c

> show /c

> hide /n

> shown /n

Unknown command: shown /n  

> show /n

[Repeated 1 time(s)]

> ribbon /c

[Repeated 1 time(s)]

> ribbon /n

> style /n ribbon

Expected a keyword  

> select /N:4@C5'

1 atom, 1 residue, 1 model selected  

> select up

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select up

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select down

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select down

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select up

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select up

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select down

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select down

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select up

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select up

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select down

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select down

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select up

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select up

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select up

7817 atoms, 7813 bonds, 1208 residues, 1 model selected  

> select down

201 atoms, 222 bonds, 10 residues, 1 model selected  

> select down

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select down

1 atom, 1 residue, 1 model selected  

> select up

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select up

201 atoms, 222 bonds, 10 residues, 1 model selected  

> color sel gold

> select clear

> color sel gold

> select clear

> color sel gold

> select clear

> color sel gold

> select clear

> color sel red

> surface #1

> color /n fromatoms

> surface #1

> surface #2

No atoms specified by #2  

> surface

> surface #1 hide

Expected a keyword  

> hide surfaces #1

Expected ',' or a keyword  

> hide surfaces

> show surfaces

> hide surfaces

> style solvent sphere

Changed 208 atom styles  

> color solvent red

> sym #1

2bbv mmCIF Assemblies  
---  
1| complete icosahedral assembly| 60 copies of chains A-F,N  
2| icosahedral asymmetric unit| 1 copy of chains A-F,N  
3| icosahedral pentamer| 5 copies of chains A-F,N  
4| icosahedral 23 hexamer| 6 copies of chains A-F,N  
5| icosahedral asymmetric unit, std point frame| 1 copy of chains A-F,N  
6| crystal asymmetric unit, crystal frame| 5 copies of chains A-F,N  
  

> hide #1 models

> show #1

> show #1 models

> sym #1 assembly 3 newModel false copies false

Made 5 graphical clones for 2bbv assembly 3  

> sym #1 assembly 1

Made 60 graphical clones for 2bbv assembly 1  

> show #!1 models

> hide #!1 models

> show #!1 models

> hide #!1 models

> hide #!2 models

> show #!2 models

> sym #1 assembly 1view

Assembly "1view" not found, have 1, 2, 3, 4, 5, 6  

> view

> set bgColor white

> set silhouettes true

> save /Users/matthewcomstock/Desktop/2bbv.png

> movie record

> turn y 2 180

> wait 180

> movie encode /Users/matthewcomstock/Desktop/movie1.mp4

Movie saved to /Users/matthewcomstock/Desktop/movie1.mp4  
  

> close #2

> sym #1 assembly 3 newModel false copies false

Made 5 graphical clones for 2bbv assembly 3  

> show #1 models

> view

> ui mousemode right zoom

> ui mousemode right translate

> ui mousemode right zoom

> surface #1

> color /n fromatoms

> style solvent sphere

Changed 208 atom styles  

> color solvent red

> view

> close

> set bgColor black

> set bgColor transparent

> set silhouettes false

> open 1080 fromDatabase emdb

Summary of feedback from opening 1080 fetched from emdb  
---  
note | Fetching compressed map 1080 from
ftp://ftp.ebi.ac.uk/pub/databases/emdb/structures/EMD-1080/map/emd_1080.map.gz  
  
Opened emdb 1080 as #1, grid size 100,100,100, pixel 2.7, shown at level 1.68,
step 1, values float32  

> lighting full

> volume #1 level 0.9

> volume #1 level .5

> volume #1 level .2

> volume #1 level .1

> volume #1 level 2

> volume #1 level .15

> volume #1 level 1.68

> ui mousemode right "contour level"

> volume #1 level 1.812

> volume #1 level 1.773

> volume #1 level 1.504

> volume #1 level 1.275

> volume #1 encloseVolume 1e6 step 1 color tan

> volume #1 1e5 step 1

Expected a keyword  

> volume #1 1e5 step 1 color tan

Expected a keyword  

> volume #1 encloseVolume 1e5 step 1

> volume #1 encloseVolume 1e4 step 1

> volume #1 encloseVolume 1e6 step 1 color tan

> set bgColor gray

> set bgColor #80808000

> set silhouettes true

> open 1grl

Summary of feedback from opening 1grl fetched from pdb  
---  
note | Fetching compressed mmCIF 1grl from
http://files.rcsb.org/download/1grl.cif  
  
1grl title:  
The crystal structure of the bacterial chaperonin groel At 2.8 angstroms [more
info...]  
  
Chain information for 1grl #2  
---  
Chain | Description | UniProt  
A B C D E F G | GROEL (HSP60 CLASS) | CH60_ECOLI 2-548  
  
1grl mmCIF Assemblies  
---  
1| author_and_software_defined_assembly  
2| software_defined_assembly  
  

> lighting default

> ui mousemode right zoom

> ui mousemode right "translate selected models"

> select /D:357@CG2

1 atom, 1 residue, 1 model selected  

> view matrix models #2,1,0,0,44.01,0,1,0,-1.4223,0,0,1,-0.37848

> ui mousemode right "rotate selected models"

> view matrix models
> #2,0.99999,-0.0041909,0.002923,44.116,0.0043018,0.99923,-0.039047,-2.5771,-0.0027571,0.039059,0.99923,-0.57913

> view matrix models
> #2,0.99572,-0.092469,0.00020636,43.966,0.092405,0.99494,-0.039468,1.1951,0.0034442,0.039318,0.99922,-0.31382

> fitmap #2 inMap #1

Fit molecule 1grl (#2) to map emdb 1080 (#1) using 29274 atoms  
average map value = 1.33, steps = 104  
shifted from previous position = 0.914  
rotated from previous position = 20.7 degrees  
atoms outside contour = 3707, contour level = 0.82501  
  
Position of 1grl (#2) relative to emdb 1080 (#1) coordinates:  
Matrix rotation and translation  
0.90168809 -0.43225449 -0.01070721 39.38415285  
0.43238288 0.90129381 0.02673023 18.93264110  
-0.00190392 -0.02873195 0.99958534 -0.07033036  
Axis -0.06401015 -0.01016007 0.99789753  
Axis point -21.87968789 95.67746379 0.00000000  
Rotation angle (degrees) 25.67269007  
Shift along axis -2.78352503  
  

> volume #1 transparency 0.5

> view matrix models
> #2,0.92048,-0.39074,-0.0062701,40.283,0.39076,0.92009,0.027407,17.143,-0.0049401,-0.027678,0.9996,-0.20146

> fitmap #2 inMap #1

Fit molecule 1grl (#2) to map emdb 1080 (#1) using 29274 atoms  
average map value = 1.33, steps = 60  
shifted from previous position = 0.0354  
rotated from previous position = 2.63 degrees  
atoms outside contour = 3704, contour level = 0.82501  
  
Position of 1grl (#2) relative to emdb 1080 (#1) coordinates:  
Matrix rotation and translation  
0.90160406 -0.43242969 -0.01070914 39.38027615  
0.43255808 0.90120994 0.02672371 18.93993563  
-0.00190494 -0.02872653 0.99958549 -0.07718132  
Axis -0.06397061 -0.01015704 0.99790009  
Axis point -21.87911091 95.63336281 0.00000000  
Rotation angle (degrees) 25.68378070  
Shift along axis -2.78857344  
  

> volume #1 transparency 0.5

> molmap #2 10

Opened 1grl map 10 as #3, grid size 63,63,41, pixel 3.33, shown at level
0.0611, step 1, values float32  

> volume #3 style mesh

> volume subtract #1 #3 minRms true

Opened volume difference as #4, grid size 100,100,100, pixel 2.7, shown at
step 1, values float32  
Minimum RMS scale factor for "1grl map 10 #3" above level 0.061077 is 4.5565  
  

> volume #4 color pink transparency 0

> hide atoms

> show ribbons

> close

> set bgColor black

> set bgColor transparent

> set silhouettes false

> open 1a0m fromDatabase eds

Summary of feedback from opening 1a0m fetched from eds  
---  
note | Fetching map 1a0m from
http://www.ebi.ac.uk/pdbe/coordinates/files/1a0m.ccp4  
  
Opened eds 1a0m as #1, grid size 97,101,88, pixel 0.37,0.37,0.367, shown at
level 2.28, step 1, values float32  

> open 1a0m

Summary of feedback from opening 1a0m fetched from pdb  
---  
note | Fetching compressed mmCIF 1a0m from
http://files.rcsb.org/download/1a0m.cif  
  
1a0m title:  
1.1 angstrom crystal structure of A-conotoxin [TYR15]-epi [more info...]  
  
Chain information for 1a0m #2  
---  
Chain | Description | UniProt  
A B | ALPHA-CONOTOXIN [TYR15]-EPI | CXA1_CONEP 1-16  
  
Non-standard residues in 1a0m #2  
---  
NH2 — amino group  
  

> hide ribbons

> show

> volume #1 level 1.0 style mesh

> ui mousemode right zoom

> volume zone #1 nearAtoms #2 range 2

> volume #1 level 0.5 transparency 0.6

> close

> open 1273 fromDatabase emdb

Summary of feedback from opening 1273 fetched from emdb  
---  
note | Fetching compressed map 1273 from
ftp://ftp.ebi.ac.uk/pub/databases/emdb/structures/EMD-1273/map/emd_1273.map.gz  
  
Opened emdb 1273 as #1, grid size 2048,2048,76, pixel 22.5, shown at step 1,
values int8  

> volume #1 region all showOutlineBox true

> close

> open 7v99

Summary of feedback from opening 7v99 fetched from pdb  
---  
note | Fetching compressed mmCIF 7v99 from
http://files.rcsb.org/download/7v99.cif  
  
7v99 title:  
catalytic core of human telomerase holoenzyme [more info...]  
  
Chain information for 7v99 #1  
---  
Chain | Description | UniProt  
A | Telomerase reverse transcriptase | TERT_HUMAN 1-1132  
K | Histone H2A type 1-B/E | H2A1B_HUMAN 1-129  
L | Histone H2B type 1-K | H2B1K_HUMAN 1-125  
R | Telomerase RNA component |  
S | Primer DNA |  
  

> color bychain

> set bgColor white

> set bgColor #ffffff00

> lighting simple

> lighting full

> hide atoms

> show cartoons

> show atoms

> show surfaces

> nucleotides ladder

> graphics silhouettes true

> volume hide

No volumes specified  

> select /R:33-334

5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected  

> hide surfaces sel

Expected ',' or a keyword  

> hide sel surfaces

> color sel orange

> hide /a

> hide /a atoms

> hide /a surfaces

> hide /a ribbons

> hide /s

> hide /s all

Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword  

> hide /s models

[Repeated 1 time(s)]

> show /s models

> show /s atoms

> hide /s atoms

> hide /s surfaces

> hide /s ribbons

> sym #1

7v99 mmCIF Assemblies  
---  
1| author_defined_assembly| 1 copy of chains A,K,L,R,S  
  

> show /a surfaces

> color /r teal

> color /r orange

> color /k green

> color /l green

> color /k red

> hide sel atoms

> show sel atoms

> color sel bynucleotide

> nucleotides sel stubs

> nucleotides sel ladder

> nucleotides sel stubs

> nucleotides sel tube/slab shape muffler

> nucleotides sel tube/slab shape ellipsoid

> nucleotides sel tube/slab shape box

> nucleotides sel slab

> style nucleic & sel stick

Changed 5156 atom styles  

> nucleotides sel fill

> style nucleic & sel stick

Changed 5156 atom styles  

> nucleotides sel stubs

> nucleotides sel ladder

> color #1.4 #ff59f5ff

> hide /k atoms

> hide /l atoms

> color #1.5 #00d301ff

> color #1.5 #00da01ff

> save "/Users/matthewcomstock/OneDrive - Michigan State University/project
> analysis/230308 telomerase RNA structure/telomerase structures/7v99 chimera
> work.cxs"

> open https://www.rbvi.ucsf.edu/chimerax/tutorials.html

Opened https://www.rbvi.ucsf.edu/chimerax/tutorials.html  

> ui tool show "Show Sequence Viewer"

> sequence chain /R

Alignment identifier is 1/R  

> select sequence
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> color sel red

> color sel orange

> save "/Users/matthewcomstock/OneDrive - Michigan State University/project
> analysis/230308 telomerase RNA structure/telomerase structures/7v99 chimera
> work.cxs"

> ui tool show "Show Sequence Viewer"

> sequence chain /R

Destroying pre-existing alignment with identifier 1/R  
Alignment identifier is 1/R  

> select /a

7898 atoms, 8092 bonds, 1 pseudobond, 991 residues, 2 models selected  

> select /r

5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected  

> select /r sequence
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> select sequence
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> select /r

5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected  

> select /r :1:10

Nothing selected  

> select /r:1:10

Nothing selected  

> select /r:10

Nothing selected  

> select /r:100

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select /r:101

20 atoms, 21 bonds, 1 residue, 1 model selected  

> select /r:237

20 atoms, 21 bonds, 1 residue, 1 model selected  

> color sel red

> color sel green

> color /r:334 red

> save /Users/matthewcomstock/Desktop/image1.png supersample 3

> hide /r:start-236

> hide ribbons /r:start-236

Expected ',' or a keyword  

> hide /r:start-236 ribbons

> hide /r:335-end atoms, ribbons

> show /r:335-end atoms, ribbons

> show /r:335-end atoms

> show /r:335-end

> hide /r:335-end

> show /r atoms, ribbons

> hide /r atoms, ribbons

> show /r atoms, ribbons

> hide sequence ggguug atoms, ribbon

Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword  

> select /r sequence
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> name trapping_TR sel

> name traptr sel

> color traptr red

> color traptr orange

> select /R:33-192

3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected  

> name before_traptr sel

> hide before_traptr atoms, ribbons

> save /Users/matthewcomstock/Desktop/image1.png supersample 3

> movie record

> turn y 2 180

> wait 180

> movie encode /Users/matthewcomstock/Desktop/movie1.mp4

Movie saved to /Users/matthewcomstock/Desktop/movie1.mp4  
  

> save "/Users/matthewcomstock/OneDrive - Michigan State University/project
> analysis/230308 telomerase RNA structure/telomerase structures/7v99 chimera
> work.cxs"

> cd "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures"

Current working directory is:
/Users/matthewcomstock/Library/CloudStorage/OneDrive-
MichiganStateUniversity/project analysis/230308 telomerase RNA
structure/telomerase structures  

> select /a

7898 atoms, 8092 bonds, 1 pseudobond, 991 residues, 2 models selected  

> transparency (#!1 & sel) 50

> show /s atoms, ribbons

> color /s red

> show before_traptr ribbons

> hide before_traptr ribbons

> ribbon before_traptr

> hide ribbons

> show ribbons

> hide /a ribbons

> hide before_traptr

> hide before_traptr ribbons

> before_traptr

Unknown command: before_traptr  

> select /R:33-192

3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected  

> hide sel

> hide sel ribbons

> hide sel ribbons, atoms

> show sel ribbons, atoms

> hide sel ribbons, atoms

> name before_traptr sel

> show before_traptr ribbons

> show before_traptr ribbons, atoms

> hide before_traptr ribbons, atoms

> show before_traptr ribbons

> show before_traptr ribbons transparency .5

Expected ',' or a keyword  

> show before_traptr ribbon, transparency .5

Missing or invalid "what" argument: Should be one of 'atoms', 'bonds',
'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces'  

> transparancy before_traptr 0.5

Unknown command: transparancy before_traptr 0.5  

> select before_traptr

5156 atoms, 3422 bonds, 104 pseudobonds, 243 residues, 3 models selected  

> transparancy 0.5

Unknown command: transparancy 0.5  

> transparency 0.5

> transparency 1

> transparency /a 50

> transparency /a 75

> transparency /a 25

> transparency /a 35

> transparency before_traptr 35

> surface before_traptr

> hide surfaces

> show /a surfaces

> show /k, /l surface

Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword  

> show /k or /l surface

Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword  

> show /k and /l surface

Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword  

> show /l surfaces

> show /k surfaces

> hide before_traptr

> hide traptr

> hide traptr ribbons

> hide traptr ribbons, atoms

> show traptr ribbons, atoms

> /r
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

Unknown command: sequence /r
ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg  

> select sequence /r
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

Expected a keyword  

> select /r sequence
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> name traptr /r sequence
> ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg

"/r sequence
ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg":
contains extra trailing text  

> name traptr sel

> select /R:33-192

3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected  

> select /R:33-192

3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected  

> name before_traptr sel

> hide before_traptr

> hide before_traptr atoms, ribbons

> hide traptr atoms, ribbons

> lighting soft

> lighting simple

> lighting full

> lighting simple

> show /r:33:147

> show /r:33-147

> show /r:33-137

> show /r:33-147

> hide /r:33-147

> select /r:237-334

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> name traptr sel

> hide traptr

> hide traptr atoms, ribbons

> show traptr atoms, ribbons

> select /R:33-192

3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected  

> select /r:163-192

643 atoms, 720 bonds, 30 residues, 1 model selected  

> name beforetr1 sel

> show beforetr1 atoms, ribbons

> hide beforetr1 atoms, ribbons

> hide traptr atoms, ribbons

[Repeated 1 time(s)]

> hide traptr

> select /r:237-334

2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected  

> select /r:33-147

2426 atoms, 2702 bonds, 59 pseudobonds, 115 residues, 2 models selected  

> show /r:33-147

> hide /r:33-147

> select /r:33-147

2426 atoms, 2702 bonds, 59 pseudobonds, 115 residues, 2 models selected  

> name test1 sel

> show test1

> hide test1

> select test1

5156 atoms, 2702 bonds, 59 pseudobonds, 243 residues, 2 models selected  

> select /r:33-147

2426 atoms, 2702 bonds, 59 pseudobonds, 115 residues, 2 models selected  

> name beforetraptr1

"beforetraptr1" is not defined  

> name beforetraptr1 sel

> show beforetraptr1

> hide beforetraptr1

> show beforetraptr1 atoms, ribbons

> hide beforetraptr1 atoms, ribbons

> show beforetraptr1 atoms, ribbons

> show beforetraptr1 atoms, ribbons, surfaces

> hide beforetraptr1 atoms, ribbons

> color beforetraptr1 teal

> hide beforetraptr1 surfaces

> show beforetraptr1 atoms, ribbons

> transparency beforetraptr1 50 target all

> transparency beforetraptr1 50 target All

Invalid "target" argument: Character 'A' is not an allowed target, must be one
of acrsbmpfl  

> transparency beforetraptr1 50 target all

> transparency beforetraptr1 10 target all

> transparency beforetraptr1 100 target all

> color beforetraptr1 red

> color beforetraptr1 pink

> select /r:163-192

643 atoms, 720 bonds, 30 residues, 1 model selected  

> select /r:163-192

643 atoms, 720 bonds, 30 residues, 1 model selected  

> name beforetraptr2 sel

> show beforetraptr2 atoms, ribbons

> color beforetraptr2 pink

> save "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures/7v99 chimera work.cxs"

——— End of log from Tue Jun 6 16:44:25 2023 ———

opened ChimeraX session  
UCSF ChimeraX version: 1.6.1 (2023-05-09)  
© 2016-2023 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  

> show traptr ribbons, atoms

> hide traptr ribbons, atoms

> show traptr ribbons, atoms

> color traptr red

> info chains

chain id /A chain_id A  
chain id /K chain_id K  
chain id /L chain_id L  
chain id /R chain_id R  
chain id /S chain_id S  

> info models

model id #1 type AtomicStructure name 7v99  
model id #1.1 type PseudobondGroup name "hydrogen bonds"  
model id #1.2 type PseudobondGroup name "missing structure"  
model id #1.3 type MolecularSurface name "7v99_A SES surface"  
model id #1.4 type MolecularSurface name "7v99_K SES surface"  
model id #1.5 type MolecularSurface name "7v99_L SES surface"  
model id #1.6 type MolecularSurface name "7v99_R SES surface"  
model id #1.7 type MolecularSurface name "7v99_S SES surface"  

> info selection

atom id /R:163@P idatm_type Pac  
atom id /R:163@OP1 idatm_type O3-  
atom id /R:163@OP2 idatm_type O3-  
atom id /R:163@O5' idatm_type O3  
atom id /R:163@C5' idatm_type C3  
atom id /R:163@C4' idatm_type C3  
atom id /R:163@O4' idatm_type O3  
atom id /R:163@C3' idatm_type C3  
atom id /R:163@O3' idatm_type O3  
atom id /R:163@C2' idatm_type C3  
atom id /R:163@O2' idatm_type O3  
atom id /R:163@C1' idatm_type C3  
atom id /R:163@N9 idatm_type Npl  
atom id /R:163@C8 idatm_type Car  
atom id /R:163@N7 idatm_type N2  
atom id /R:163@C5 idatm_type Car  
atom id /R:163@C6 idatm_type C2  
atom id /R:163@O6 idatm_type O2  
atom id /R:163@N1 idatm_type Npl  
atom id /R:163@C2 idatm_type C2  
atom id /R:163@N2 idatm_type Npl  
atom id /R:163@N3 idatm_type N2  
atom id /R:163@C4 idatm_type Car  
atom id /R:164@P idatm_type Pac  
atom id /R:164@OP1 idatm_type O3-  
atom id /R:164@OP2 idatm_type O3-  
atom id /R:164@O5' idatm_type O3  
atom id /R:164@C5' idatm_type C3  
atom id /R:164@C4' idatm_type C3  
atom id /R:164@O4' idatm_type O3  
atom id /R:164@C3' idatm_type C3  
atom id /R:164@O3' idatm_type O3  
atom id /R:164@C2' idatm_type C3  
atom id /R:164@O2' idatm_type O3  
atom id /R:164@C1' idatm_type C3  
atom id /R:164@N9 idatm_type Npl  
atom id /R:164@C8 idatm_type Car  
atom id /R:164@N7 idatm_type N2  
atom id /R:164@C5 idatm_type Car  
atom id /R:164@C6 idatm_type Car  
atom id /R:164@N6 idatm_type Npl  
atom id /R:164@N1 idatm_type N2  
atom id /R:164@C2 idatm_type Car  
atom id /R:164@N3 idatm_type N2  
atom id /R:164@C4 idatm_type Car  
atom id /R:165@P idatm_type Pac  
atom id /R:165@OP1 idatm_type O3-  
atom id /R:165@OP2 idatm_type O3-  
atom id /R:165@O5' idatm_type O3  
atom id /R:165@C5' idatm_type C3  
atom id /R:165@C4' idatm_type C3  
atom id /R:165@O4' idatm_type O3  
atom id /R:165@C3' idatm_type C3  
atom id /R:165@O3' idatm_type O3  
atom id /R:165@C2' idatm_type C3  
atom id /R:165@O2' idatm_type O3  
atom id /R:165@C1' idatm_type C3  
atom id /R:165@N9 idatm_type Npl  
atom id /R:165@C8 idatm_type Car  
atom id /R:165@N7 idatm_type N2  
atom id /R:165@C5 idatm_type Car  
atom id /R:165@C6 idatm_type C2  
atom id /R:165@O6 idatm_type O2  
atom id /R:165@N1 idatm_type Npl  
atom id /R:165@C2 idatm_type C2  
atom id /R:165@N2 idatm_type Npl  
atom id /R:165@N3 idatm_type N2  
atom id /R:165@C4 idatm_type Car  
atom id /R:166@P idatm_type Pac  
atom id /R:166@OP1 idatm_type O3-  
atom id /R:166@OP2 idatm_type O3-  
atom id /R:166@O5' idatm_type O3  
atom id /R:166@C5' idatm_type C3  
atom id /R:166@C4' idatm_type C3  
atom id /R:166@O4' idatm_type O3  
atom id /R:166@C3' idatm_type C3  
atom id /R:166@O3' idatm_type O3  
atom id /R:166@C2' idatm_type C3  
atom id /R:166@O2' idatm_type O3  
atom id /R:166@C1' idatm_type C3  
atom id /R:166@N1 idatm_type Npl  
atom id /R:166@C2 idatm_type C2  
atom id /R:166@O2 idatm_type O2  
atom id /R:166@N3 idatm_type N2  
atom id /R:166@C4 idatm_type C2  
atom id /R:166@N4 idatm_type Npl  
atom id /R:166@C5 idatm_type C2  
atom id /R:166@C6 idatm_type C2  
atom id /R:167@P idatm_type Pac  
atom id /R:167@OP1 idatm_type O3-  
atom id /R:167@OP2 idatm_type O3-  
atom id /R:167@O5' idatm_type O3  
atom id /R:167@C5' idatm_type C3  
atom id /R:167@C4' idatm_type C3  
atom id /R:167@O4' idatm_type O3  
atom id /R:167@C3' idatm_type C3  
atom id /R:167@O3' idatm_type O3  
atom id /R:167@C2' idatm_type C3  
atom id /R:167@O2' idatm_type O3  
atom id /R:167@C1' idatm_type C3  
atom id /R:167@N9 idatm_type Npl  
atom id /R:167@C8 idatm_type Car  
atom id /R:167@N7 idatm_type N2  
atom id /R:167@C5 idatm_type Car  
atom id /R:167@C6 idatm_type Car  
atom id /R:167@N6 idatm_type Npl  
atom id /R:167@N1 idatm_type N2  
atom id /R:167@C2 idatm_type Car  
atom id /R:167@N3 idatm_type N2  
atom id /R:167@C4 idatm_type Car  
atom id /R:168@P idatm_type Pac  
atom id /R:168@OP1 idatm_type O3-  
atom id /R:168@OP2 idatm_type O3-  
atom id /R:168@O5' idatm_type O3  
atom id /R:168@C5' idatm_type C3  
atom id /R:168@C4' idatm_type C3  
atom id /R:168@O4' idatm_type O3  
atom id /R:168@C3' idatm_type C3  
atom id /R:168@O3' idatm_type O3  
atom id /R:168@C2' idatm_type C3  
atom id /R:168@O2' idatm_type O3  
atom id /R:168@C1' idatm_type C3  
atom id /R:168@N9 idatm_type Npl  
atom id /R:168@C8 idatm_type Car  
atom id /R:168@N7 idatm_type N2  
atom id /R:168@C5 idatm_type Car  
atom id /R:168@C6 idatm_type Car  
atom id /R:168@N6 idatm_type Npl  
atom id /R:168@N1 idatm_type N2  
atom id /R:168@C2 idatm_type Car  
atom id /R:168@N3 idatm_type N2  
atom id /R:168@C4 idatm_type Car  
atom id /R:169@P idatm_type Pac  
atom id /R:169@OP1 idatm_type O3-  
atom id /R:169@OP2 idatm_type O3-  
atom id /R:169@O5' idatm_type O3  
atom id /R:169@C5' idatm_type C3  
atom id /R:169@C4' idatm_type C3  
atom id /R:169@O4' idatm_type O3  
atom id /R:169@C3' idatm_type C3  
atom id /R:169@O3' idatm_type O3  
atom id /R:169@C2' idatm_type C3  
atom id /R:169@O2' idatm_type O3  
atom id /R:169@C1' idatm_type C3  
atom id /R:169@N9 idatm_type Npl  
atom id /R:169@C8 idatm_type Car  
atom id /R:169@N7 idatm_type N2  
atom id /R:169@C5 idatm_type Car  
atom id /R:169@C6 idatm_type Car  
atom id /R:169@N6 idatm_type Npl  
atom id /R:169@N1 idatm_type N2  
atom id /R:169@C2 idatm_type Car  
atom id /R:169@N3 idatm_type N2  
atom id /R:169@C4 idatm_type Car  
atom id /R:170@P idatm_type Pac  
atom id /R:170@OP1 idatm_type O3-  
atom id /R:170@OP2 idatm_type O3-  
atom id /R:170@O5' idatm_type O3  
atom id /R:170@C5' idatm_type C3  
atom id /R:170@C4' idatm_type C3  
atom id /R:170@O4' idatm_type O3  
atom id /R:170@C3' idatm_type C3  
atom id /R:170@O3' idatm_type O3  
atom id /R:170@C2' idatm_type C3  
atom id /R:170@O2' idatm_type O3  
atom id /R:170@C1' idatm_type C3  
atom id /R:170@N1 idatm_type Npl  
atom id /R:170@C2 idatm_type C2  
atom id /R:170@O2 idatm_type O2  
atom id /R:170@N3 idatm_type N2  
atom id /R:170@C4 idatm_type C2  
atom id /R:170@N4 idatm_type Npl  
atom id /R:170@C5 idatm_type C2  
atom id /R:170@C6 idatm_type C2  
atom id /R:171@P idatm_type Pac  
atom id /R:171@OP1 idatm_type O3-  
atom id /R:171@OP2 idatm_type O3-  
atom id /R:171@O5' idatm_type O3  
atom id /R:171@C5' idatm_type C3  
atom id /R:171@C4' idatm_type C3  
atom id /R:171@O4' idatm_type O3  
atom id /R:171@C3' idatm_type C3  
atom id /R:171@O3' idatm_type O3  
atom id /R:171@C2' idatm_type C3  
atom id /R:171@O2' idatm_type O3  
atom id /R:171@C1' idatm_type C3  
atom id /R:171@N9 idatm_type Npl  
atom id /R:171@C8 idatm_type Car  
atom id /R:171@N7 idatm_type N2  
atom id /R:171@C5 idatm_type Car  
atom id /R:171@C6 idatm_type Car  
atom id /R:171@N6 idatm_type Npl  
atom id /R:171@N1 idatm_type N2  
atom id /R:171@C2 idatm_type Car  
atom id /R:171@N3 idatm_type N2  
atom id /R:171@C4 idatm_type Car  
atom id /R:172@P idatm_type Pac  
atom id /R:172@OP1 idatm_type O3-  
atom id /R:172@OP2 idatm_type O3-  
atom id /R:172@O5' idatm_type O3  
atom id /R:172@C5' idatm_type C3  
atom id /R:172@C4' idatm_type C3  
atom id /R:172@O4' idatm_type O3  
atom id /R:172@C3' idatm_type C3  
atom id /R:172@O3' idatm_type O3  
atom id /R:172@C2' idatm_type C3  
atom id /R:172@O2' idatm_type O3  
atom id /R:172@C1' idatm_type C3  
atom id /R:172@N9 idatm_type Npl  
atom id /R:172@C8 idatm_type Car  
atom id /R:172@N7 idatm_type N2  
atom id /R:172@C5 idatm_type Car  
atom id /R:172@C6 idatm_type Car  
atom id /R:172@N6 idatm_type Npl  
atom id /R:172@N1 idatm_type N2  
atom id /R:172@C2 idatm_type Car  
atom id /R:172@N3 idatm_type N2  
atom id /R:172@C4 idatm_type Car  
atom id /R:173@P idatm_type Pac  
atom id /R:173@OP1 idatm_type O3-  
atom id /R:173@OP2 idatm_type O3-  
atom id /R:173@O5' idatm_type O3  
atom id /R:173@C5' idatm_type C3  
atom id /R:173@C4' idatm_type C3  
atom id /R:173@O4' idatm_type O3  
atom id /R:173@C3' idatm_type C3  
atom id /R:173@O3' idatm_type O3  
atom id /R:173@C2' idatm_type C3  
atom id /R:173@O2' idatm_type O3  
atom id /R:173@C1' idatm_type C3  
atom id /R:173@N9 idatm_type Npl  
atom id /R:173@C8 idatm_type Car  
atom id /R:173@N7 idatm_type N2  
atom id /R:173@C5 idatm_type Car  
atom id /R:173@C6 idatm_type Car  
atom id /R:173@N6 idatm_type Npl  
atom id /R:173@N1 idatm_type N2  
atom id /R:173@C2 idatm_type Car  
atom id /R:173@N3 idatm_type N2  
atom id /R:173@C4 idatm_type Car  
atom id /R:174@P idatm_type Pac  
atom id /R:174@OP1 idatm_type O3-  
atom id /R:174@OP2 idatm_type O3-  
atom id /R:174@O5' idatm_type O3  
atom id /R:174@C5' idatm_type C3  
atom id /R:174@C4' idatm_type C3  
atom id /R:174@O4' idatm_type O3  
atom id /R:174@C3' idatm_type C3  
atom id /R:174@O3' idatm_type O3  
atom id /R:174@C2' idatm_type C3  
atom id /R:174@O2' idatm_type O3  
atom id /R:174@C1' idatm_type C3  
atom id /R:174@N9 idatm_type Npl  
atom id /R:174@C8 idatm_type Car  
atom id /R:174@N7 idatm_type N2  
atom id /R:174@C5 idatm_type Car  
atom id /R:174@C6 idatm_type Car  
atom id /R:174@N6 idatm_type Npl  
atom id /R:174@N1 idatm_type N2  
atom id /R:174@C2 idatm_type Car  
atom id /R:174@N3 idatm_type N2  
atom id /R:174@C4 idatm_type Car  
atom id /R:175@P idatm_type Pac  
atom id /R:175@OP1 idatm_type O3-  
atom id /R:175@OP2 idatm_type O3-  
atom id /R:175@O5' idatm_type O3  
atom id /R:175@C5' idatm_type C3  
atom id /R:175@C4' idatm_type C3  
atom id /R:175@O4' idatm_type O3  
atom id /R:175@C3' idatm_type C3  
atom id /R:175@O3' idatm_type O3  
atom id /R:175@C2' idatm_type C3  
atom id /R:175@O2' idatm_type O3  
atom id /R:175@C1' idatm_type C3  
atom id /R:175@N9 idatm_type Npl  
atom id /R:175@C8 idatm_type Car  
atom id /R:175@N7 idatm_type N2  
atom id /R:175@C5 idatm_type Car  
atom id /R:175@C6 idatm_type Car  
atom id /R:175@N6 idatm_type Npl  
atom id /R:175@N1 idatm_type N2  
atom id /R:175@C2 idatm_type Car  
atom id /R:175@N3 idatm_type N2  
atom id /R:175@C4 idatm_type Car  
atom id /R:176@P idatm_type Pac  
atom id /R:176@OP1 idatm_type O3-  
atom id /R:176@OP2 idatm_type O3-  
atom id /R:176@O5' idatm_type O3  
atom id /R:176@C5' idatm_type C3  
atom id /R:176@C4' idatm_type C3  
atom id /R:176@O4' idatm_type O3  
atom id /R:176@C3' idatm_type C3  
atom id /R:176@O3' idatm_type O3  
atom id /R:176@C2' idatm_type C3  
atom id /R:176@O2' idatm_type O3  
atom id /R:176@C1' idatm_type C3  
atom id /R:176@N9 idatm_type Npl  
atom id /R:176@C8 idatm_type Car  
atom id /R:176@N7 idatm_type N2  
atom id /R:176@C5 idatm_type Car  
atom id /R:176@C6 idatm_type Car  
atom id /R:176@N6 idatm_type Npl  
atom id /R:176@N1 idatm_type N2  
atom id /R:176@C2 idatm_type Car  
atom id /R:176@N3 idatm_type N2  
atom id /R:176@C4 idatm_type Car  
atom id /R:177@P idatm_type Pac  
atom id /R:177@OP1 idatm_type O3-  
atom id /R:177@OP2 idatm_type O3-  
atom id /R:177@O5' idatm_type O3  
atom id /R:177@C5' idatm_type C3  
atom id /R:177@C4' idatm_type C3  
atom id /R:177@O4' idatm_type O3  
atom id /R:177@C3' idatm_type C3  
atom id /R:177@O3' idatm_type O3  
atom id /R:177@C2' idatm_type C3  
atom id /R:177@O2' idatm_type O3  
atom id /R:177@C1' idatm_type C3  
atom id /R:177@N1 idatm_type Npl  
atom id /R:177@C2 idatm_type C2  
atom id /R:177@O2 idatm_type O2  
atom id /R:177@N3 idatm_type Npl  
atom id /R:177@C4 idatm_type C2  
atom id /R:177@O4 idatm_type O2  
atom id /R:177@C5 idatm_type C2  
atom id /R:177@C6 idatm_type C2  
atom id /R:178@P idatm_type Pac  
atom id /R:178@OP1 idatm_type O3-  
atom id /R:178@OP2 idatm_type O3-  
atom id /R:178@O5' idatm_type O3  
atom id /R:178@C5' idatm_type C3  
atom id /R:178@C4' idatm_type C3  
atom id /R:178@O4' idatm_type O3  
atom id /R:178@C3' idatm_type C3  
atom id /R:178@O3' idatm_type O3  
atom id /R:178@C2' idatm_type C3  
atom id /R:178@O2' idatm_type O3  
atom id /R:178@C1' idatm_type C3  
atom id /R:178@N9 idatm_type Npl  
atom id /R:178@C8 idatm_type Car  
atom id /R:178@N7 idatm_type N2  
atom id /R:178@C5 idatm_type Car  
atom id /R:178@C6 idatm_type C2  
atom id /R:178@O6 idatm_type O2  
atom id /R:178@N1 idatm_type Npl  
atom id /R:178@C2 idatm_type C2  
atom id /R:178@N2 idatm_type Npl  
atom id /R:178@N3 idatm_type N2  
atom id /R:178@C4 idatm_type Car  
atom id /R:179@P idatm_type Pac  
atom id /R:179@OP1 idatm_type O3-  
atom id /R:179@OP2 idatm_type O3-  
atom id /R:179@O5' idatm_type O3  
atom id /R:179@C5' idatm_type C3  
atom id /R:179@C4' idatm_type C3  
atom id /R:179@O4' idatm_type O3  
atom id /R:179@C3' idatm_type C3  
atom id /R:179@O3' idatm_type O3  
atom id /R:179@C2' idatm_type C3  
atom id /R:179@O2' idatm_type O3  
atom id /R:179@C1' idatm_type C3  
atom id /R:179@N1 idatm_type Npl  
atom id /R:179@C2 idatm_type C2  
atom id /R:179@O2 idatm_type O2  
atom id /R:179@N3 idatm_type Npl  
atom id /R:179@C4 idatm_type C2  
atom id /R:179@O4 idatm_type O2  
atom id /R:179@C5 idatm_type C2  
atom id /R:179@C6 idatm_type C2  
atom id /R:180@P idatm_type Pac  
atom id /R:180@OP1 idatm_type O3-  
atom id /R:180@OP2 idatm_type O3-  
atom id /R:180@O5' idatm_type O3  
atom id /R:180@C5' idatm_type C3  
atom id /R:180@C4' idatm_type C3  
atom id /R:180@O4' idatm_type O3  
atom id /R:180@C3' idatm_type C3  
atom id /R:180@O3' idatm_type O3  
atom id /R:180@C2' idatm_type C3  
atom id /R:180@O2' idatm_type O3  
atom id /R:180@C1' idatm_type C3  
atom id /R:180@N1 idatm_type Npl  
atom id /R:180@C2 idatm_type C2  
atom id /R:180@O2 idatm_type O2  
atom id /R:180@N3 idatm_type N2  
atom id /R:180@C4 idatm_type C2  
atom id /R:180@N4 idatm_type Npl  
atom id /R:180@C5 idatm_type C2  
atom id /R:180@C6 idatm_type C2  
atom id /R:181@P idatm_type Pac  
atom id /R:181@OP1 idatm_type O3-  
atom id /R:181@OP2 idatm_type O3-  
atom id /R:181@O5' idatm_type O3  
atom id /R:181@C5' idatm_type C3  
atom id /R:181@C4' idatm_type C3  
atom id /R:181@O4' idatm_type O3  
atom id /R:181@C3' idatm_type C3  
atom id /R:181@O3' idatm_type O3  
atom id /R:181@C2' idatm_type C3  
atom id /R:181@O2' idatm_type O3  
atom id /R:181@C1' idatm_type C3  
atom id /R:181@N9 idatm_type Npl  
atom id /R:181@C8 idatm_type Car  
atom id /R:181@N7 idatm_type N2  
atom id /R:181@C5 idatm_type Car  
atom id /R:181@C6 idatm_type Car  
atom id /R:181@N6 idatm_type Npl  
atom id /R:181@N1 idatm_type N2  
atom id /R:181@C2 idatm_type Car  
atom id /R:181@N3 idatm_type N2  
atom id /R:181@C4 idatm_type Car  
atom id /R:182@P idatm_type Pac  
atom id /R:182@OP1 idatm_type O3-  
atom id /R:182@OP2 idatm_type O3-  
atom id /R:182@O5' idatm_type O3  
atom id /R:182@C5' idatm_type C3  
atom id /R:182@C4' idatm_type C3  
atom id /R:182@O4' idatm_type O3  
atom id /R:182@C3' idatm_type C3  
atom id /R:182@O3' idatm_type O3  
atom id /R:182@C2' idatm_type C3  
atom id /R:182@O2' idatm_type O3  
atom id /R:182@C1' idatm_type C3  
atom id /R:182@N9 idatm_type Npl  
atom id /R:182@C8 idatm_type Car  
atom id /R:182@N7 idatm_type N2  
atom id /R:182@C5 idatm_type Car  
atom id /R:182@C6 idatm_type C2  
atom id /R:182@O6 idatm_type O2  
atom id /R:182@N1 idatm_type Npl  
atom id /R:182@C2 idatm_type C2  
atom id /R:182@N2 idatm_type Npl  
atom id /R:182@N3 idatm_type N2  
atom id /R:182@C4 idatm_type Car  
atom id /R:183@P idatm_type Pac  
atom id /R:183@OP1 idatm_type O3-  
atom id /R:183@OP2 idatm_type O3-  
atom id /R:183@O5' idatm_type O3  
atom id /R:183@C5' idatm_type C3  
atom id /R:183@C4' idatm_type C3  
atom id /R:183@O4' idatm_type O3  
atom id /R:183@C3' idatm_type C3  
atom id /R:183@O3' idatm_type O3  
atom id /R:183@C2' idatm_type C3  
atom id /R:183@O2' idatm_type O3  
atom id /R:183@C1' idatm_type C3  
atom id /R:183@N1 idatm_type Npl  
atom id /R:183@C2 idatm_type C2  
atom id /R:183@O2 idatm_type O2  
atom id /R:183@N3 idatm_type N2  
atom id /R:183@C4 idatm_type C2  
atom id /R:183@N4 idatm_type Npl  
atom id /R:183@C5 idatm_type C2  
atom id /R:183@C6 idatm_type C2  
atom id /R:184@P idatm_type Pac  
atom id /R:184@OP1 idatm_type O3-  
atom id /R:184@OP2 idatm_type O3-  
atom id /R:184@O5' idatm_type O3  
atom id /R:184@C5' idatm_type C3  
atom id /R:184@C4' idatm_type C3  
atom id /R:184@O4' idatm_type O3  
atom id /R:184@C3' idatm_type C3  
atom id /R:184@O3' idatm_type O3  
atom id /R:184@C2' idatm_type C3  
atom id /R:184@O2' idatm_type O3  
atom id /R:184@C1' idatm_type C3  
atom id /R:184@N1 idatm_type Npl  
atom id /R:184@C2 idatm_type C2  
atom id /R:184@O2 idatm_type O2  
atom id /R:184@N3 idatm_type Npl  
atom id /R:184@C4 idatm_type C2  
atom id /R:184@O4 idatm_type O2  
atom id /R:184@C5 idatm_type C2  
atom id /R:184@C6 idatm_type C2  
atom id /R:185@P idatm_type Pac  
atom id /R:185@OP1 idatm_type O3-  
atom id /R:185@OP2 idatm_type O3-  
atom id /R:185@O5' idatm_type O3  
atom id /R:185@C5' idatm_type C3  
atom id /R:185@C4' idatm_type C3  
atom id /R:185@O4' idatm_type O3  
atom id /R:185@C3' idatm_type C3  
atom id /R:185@O3' idatm_type O3  
atom id /R:185@C2' idatm_type C3  
atom id /R:185@O2' idatm_type O3  
atom id /R:185@C1' idatm_type C3  
atom id /R:185@N9 idatm_type Npl  
atom id /R:185@C8 idatm_type Car  
atom id /R:185@N7 idatm_type N2  
atom id /R:185@C5 idatm_type Car  
atom id /R:185@C6 idatm_type C2  
atom id /R:185@O6 idatm_type O2  
atom id /R:185@N1 idatm_type Npl  
atom id /R:185@C2 idatm_type C2  
atom id /R:185@N2 idatm_type Npl  
atom id /R:185@N3 idatm_type N2  
atom id /R:185@C4 idatm_type Car  
atom id /R:186@P idatm_type Pac  
atom id /R:186@OP1 idatm_type O3-  
atom id /R:186@OP2 idatm_type O3-  
atom id /R:186@O5' idatm_type O3  
atom id /R:186@C5' idatm_type C3  
atom id /R:186@C4' idatm_type C3  
atom id /R:186@O4' idatm_type O3  
atom id /R:186@C3' idatm_type C3  
atom id /R:186@O3' idatm_type O3  
atom id /R:186@C2' idatm_type C3  
atom id /R:186@O2' idatm_type O3  
atom id /R:186@C1' idatm_type C3  
atom id /R:186@N1 idatm_type Npl  
atom id /R:186@C2 idatm_type C2  
atom id /R:186@O2 idatm_type O2  
atom id /R:186@N3 idatm_type N2  
atom id /R:186@C4 idatm_type C2  
atom id /R:186@N4 idatm_type Npl  
atom id /R:186@C5 idatm_type C2  
atom id /R:186@C6 idatm_type C2  
atom id /R:187@P idatm_type Pac  
atom id /R:187@OP1 idatm_type O3-  
atom id /R:187@OP2 idatm_type O3-  
atom id /R:187@O5' idatm_type O3  
atom id /R:187@C5' idatm_type C3  
atom id /R:187@C4' idatm_type C3  
atom id /R:187@O4' idatm_type O3  
atom id /R:187@C3' idatm_type C3  
atom id /R:187@O3' idatm_type O3  
atom id /R:187@C2' idatm_type C3  
atom id /R:187@O2' idatm_type O3  
atom id /R:187@C1' idatm_type C3  
atom id /R:187@N1 idatm_type Npl  
atom id /R:187@C2 idatm_type C2  
atom id /R:187@O2 idatm_type O2  
atom id /R:187@N3 idatm_type Npl  
atom id /R:187@C4 idatm_type C2  
atom id /R:187@O4 idatm_type O2  
atom id /R:187@C5 idatm_type C2  
atom id /R:187@C6 idatm_type C2  
atom id /R:188@P idatm_type Pac  
atom id /R:188@OP1 idatm_type O3-  
atom id /R:188@OP2 idatm_type O3-  
atom id /R:188@O5' idatm_type O3  
atom id /R:188@C5' idatm_type C3  
atom id /R:188@C4' idatm_type C3  
atom id /R:188@O4' idatm_type O3  
atom id /R:188@C3' idatm_type C3  
atom id /R:188@O3' idatm_type O3  
atom id /R:188@C2' idatm_type C3  
atom id /R:188@O2' idatm_type O3  
atom id /R:188@C1' idatm_type C3  
atom id /R:188@N9 idatm_type Npl  
atom id /R:188@C8 idatm_type Car  
atom id /R:188@N7 idatm_type N2  
atom id /R:188@C5 idatm_type Car  
atom id /R:188@C6 idatm_type C2  
atom id /R:188@O6 idatm_type O2  
atom id /R:188@N1 idatm_type Npl  
atom id /R:188@C2 idatm_type C2  
atom id /R:188@N2 idatm_type Npl  
atom id /R:188@N3 idatm_type N2  
atom id /R:188@C4 idatm_type Car  
atom id /R:189@P idatm_type Pac  
atom id /R:189@OP1 idatm_type O3-  
atom id /R:189@OP2 idatm_type O3-  
atom id /R:189@O5' idatm_type O3  
atom id /R:189@C5' idatm_type C3  
atom id /R:189@C4' idatm_type C3  
atom id /R:189@O4' idatm_type O3  
atom id /R:189@C3' idatm_type C3  
atom id /R:189@O3' idatm_type O3  
atom id /R:189@C2' idatm_type C3  
atom id /R:189@O2' idatm_type O3  
atom id /R:189@C1' idatm_type C3  
atom id /R:189@N9 idatm_type Npl  
atom id /R:189@C8 idatm_type Car  
atom id /R:189@N7 idatm_type N2  
atom id /R:189@C5 idatm_type Car  
atom id /R:189@C6 idatm_type C2  
atom id /R:189@O6 idatm_type O2  
atom id /R:189@N1 idatm_type Npl  
atom id /R:189@C2 idatm_type C2  
atom id /R:189@N2 idatm_type Npl  
atom id /R:189@N3 idatm_type N2  
atom id /R:189@C4 idatm_type Car  
atom id /R:190@P idatm_type Pac  
atom id /R:190@OP1 idatm_type O3-  
atom id /R:190@OP2 idatm_type O3-  
atom id /R:190@O5' idatm_type O3  
atom id /R:190@C5' idatm_type C3  
atom id /R:190@C4' idatm_type C3  
atom id /R:190@O4' idatm_type O3  
atom id /R:190@C3' idatm_type C3  
atom id /R:190@O3' idatm_type O3  
atom id /R:190@C2' idatm_type C3  
atom id /R:190@O2' idatm_type O3  
atom id /R:190@C1' idatm_type C3  
atom id /R:190@N1 idatm_type Npl  
atom id /R:190@C2 idatm_type C2  
atom id /R:190@O2 idatm_type O2  
atom id /R:190@N3 idatm_type N2  
atom id /R:190@C4 idatm_type C2  
atom id /R:190@N4 idatm_type Npl  
atom id /R:190@C5 idatm_type C2  
atom id /R:190@C6 idatm_type C2  
atom id /R:191@P idatm_type Pac  
atom id /R:191@OP1 idatm_type O3-  
atom id /R:191@OP2 idatm_type O3-  
atom id /R:191@O5' idatm_type O3  
atom id /R:191@C5' idatm_type C3  
atom id /R:191@C4' idatm_type C3  
atom id /R:191@O4' idatm_type O3  
atom id /R:191@C3' idatm_type C3  
atom id /R:191@O3' idatm_type O3  
atom id /R:191@C2' idatm_type C3  
atom id /R:191@O2' idatm_type O3  
atom id /R:191@C1' idatm_type C3  
atom id /R:191@N1 idatm_type Npl  
atom id /R:191@C2 idatm_type C2  
atom id /R:191@O2 idatm_type O2  
atom id /R:191@N3 idatm_type N2  
atom id /R:191@C4 idatm_type C2  
atom id /R:191@N4 idatm_type Npl  
atom id /R:191@C5 idatm_type C2  
atom id /R:191@C6 idatm_type C2  
atom id /R:192@P idatm_type Pac  
atom id /R:192@OP1 idatm_type O3-  
atom id /R:192@OP2 idatm_type O3-  
atom id /R:192@O5' idatm_type O3  
atom id /R:192@C5' idatm_type C3  
atom id /R:192@C4' idatm_type C3  
atom id /R:192@O4' idatm_type O3  
atom id /R:192@C3' idatm_type C3  
atom id /R:192@O3' idatm_type O3  
atom id /R:192@C2' idatm_type C3  
atom id /R:192@O2' idatm_type O3  
atom id /R:192@C1' idatm_type C3  
atom id /R:192@N1 idatm_type Npl  
atom id /R:192@C2 idatm_type C2  
atom id /R:192@O2 idatm_type O2  
atom id /R:192@N3 idatm_type N2  
atom id /R:192@C4 idatm_type C2  
atom id /R:192@N4 idatm_type Npl  
atom id /R:192@C5 idatm_type C2  
atom id /R:192@C6 idatm_type C2  

> info selection

atom id /R:163@P idatm_type Pac  
atom id /R:163@OP1 idatm_type O3-  
atom id /R:163@OP2 idatm_type O3-  
atom id /R:163@O5' idatm_type O3  
atom id /R:163@C5' idatm_type C3  
atom id /R:163@C4' idatm_type C3  
atom id /R:163@O4' idatm_type O3  
atom id /R:163@C3' idatm_type C3  
atom id /R:163@O3' idatm_type O3  
atom id /R:163@C2' idatm_type C3  
atom id /R:163@O2' idatm_type O3  
atom id /R:163@C1' idatm_type C3  
atom id /R:163@N9 idatm_type Npl  
atom id /R:163@C8 idatm_type Car  
atom id /R:163@N7 idatm_type N2  
atom id /R:163@C5 idatm_type Car  
atom id /R:163@C6 idatm_type C2  
atom id /R:163@O6 idatm_type O2  
atom id /R:163@N1 idatm_type Npl  
atom id /R:163@C2 idatm_type C2  
atom id /R:163@N2 idatm_type Npl  
atom id /R:163@N3 idatm_type N2  
atom id /R:163@C4 idatm_type Car  
atom id /R:164@P idatm_type Pac  
atom id /R:164@OP1 idatm_type O3-  
atom id /R:164@OP2 idatm_type O3-  
atom id /R:164@O5' idatm_type O3  
atom id /R:164@C5' idatm_type C3  
atom id /R:164@C4' idatm_type C3  
atom id /R:164@O4' idatm_type O3  
atom id /R:164@C3' idatm_type C3  
atom id /R:164@O3' idatm_type O3  
atom id /R:164@C2' idatm_type C3  
atom id /R:164@O2' idatm_type O3  
atom id /R:164@C1' idatm_type C3  
atom id /R:164@N9 idatm_type Npl  
atom id /R:164@C8 idatm_type Car  
atom id /R:164@N7 idatm_type N2  
atom id /R:164@C5 idatm_type Car  
atom id /R:164@C6 idatm_type Car  
atom id /R:164@N6 idatm_type Npl  
atom id /R:164@N1 idatm_type N2  
atom id /R:164@C2 idatm_type Car  
atom id /R:164@N3 idatm_type N2  
atom id /R:164@C4 idatm_type Car  
atom id /R:165@P idatm_type Pac  
atom id /R:165@OP1 idatm_type O3-  
atom id /R:165@OP2 idatm_type O3-  
atom id /R:165@O5' idatm_type O3  
atom id /R:165@C5' idatm_type C3  
atom id /R:165@C4' idatm_type C3  
atom id /R:165@O4' idatm_type O3  
atom id /R:165@C3' idatm_type C3  
atom id /R:165@O3' idatm_type O3  
atom id /R:165@C2' idatm_type C3  
atom id /R:165@O2' idatm_type O3  
atom id /R:165@C1' idatm_type C3  
atom id /R:165@N9 idatm_type Npl  
atom id /R:165@C8 idatm_type Car  
atom id /R:165@N7 idatm_type N2  
atom id /R:165@C5 idatm_type Car  
atom id /R:165@C6 idatm_type C2  
atom id /R:165@O6 idatm_type O2  
atom id /R:165@N1 idatm_type Npl  
atom id /R:165@C2 idatm_type C2  
atom id /R:165@N2 idatm_type Npl  
atom id /R:165@N3 idatm_type N2  
atom id /R:165@C4 idatm_type Car  
atom id /R:166@P idatm_type Pac  
atom id /R:166@OP1 idatm_type O3-  
atom id /R:166@OP2 idatm_type O3-  
atom id /R:166@O5' idatm_type O3  
atom id /R:166@C5' idatm_type C3  
atom id /R:166@C4' idatm_type C3  
atom id /R:166@O4' idatm_type O3  
atom id /R:166@C3' idatm_type C3  
atom id /R:166@O3' idatm_type O3  
atom id /R:166@C2' idatm_type C3  
atom id /R:166@O2' idatm_type O3  
atom id /R:166@C1' idatm_type C3  
atom id /R:166@N1 idatm_type Npl  
atom id /R:166@C2 idatm_type C2  
atom id /R:166@O2 idatm_type O2  
atom id /R:166@N3 idatm_type N2  
atom id /R:166@C4 idatm_type C2  
atom id /R:166@N4 idatm_type Npl  
atom id /R:166@C5 idatm_type C2  
atom id /R:166@C6 idatm_type C2  
atom id /R:167@P idatm_type Pac  
atom id /R:167@OP1 idatm_type O3-  
atom id /R:167@OP2 idatm_type O3-  
atom id /R:167@O5' idatm_type O3  
atom id /R:167@C5' idatm_type C3  
atom id /R:167@C4' idatm_type C3  
atom id /R:167@O4' idatm_type O3  
atom id /R:167@C3' idatm_type C3  
atom id /R:167@O3' idatm_type O3  
atom id /R:167@C2' idatm_type C3  
atom id /R:167@O2' idatm_type O3  
atom id /R:167@C1' idatm_type C3  
atom id /R:167@N9 idatm_type Npl  
atom id /R:167@C8 idatm_type Car  
atom id /R:167@N7 idatm_type N2  
atom id /R:167@C5 idatm_type Car  
atom id /R:167@C6 idatm_type Car  
atom id /R:167@N6 idatm_type Npl  
atom id /R:167@N1 idatm_type N2  
atom id /R:167@C2 idatm_type Car  
atom id /R:167@N3 idatm_type N2  
atom id /R:167@C4 idatm_type Car  
atom id /R:168@P idatm_type Pac  
atom id /R:168@OP1 idatm_type O3-  
atom id /R:168@OP2 idatm_type O3-  
atom id /R:168@O5' idatm_type O3  
atom id /R:168@C5' idatm_type C3  
atom id /R:168@C4' idatm_type C3  
atom id /R:168@O4' idatm_type O3  
atom id /R:168@C3' idatm_type C3  
atom id /R:168@O3' idatm_type O3  
atom id /R:168@C2' idatm_type C3  
atom id /R:168@O2' idatm_type O3  
atom id /R:168@C1' idatm_type C3  
atom id /R:168@N9 idatm_type Npl  
atom id /R:168@C8 idatm_type Car  
atom id /R:168@N7 idatm_type N2  
atom id /R:168@C5 idatm_type Car  
atom id /R:168@C6 idatm_type Car  
atom id /R:168@N6 idatm_type Npl  
atom id /R:168@N1 idatm_type N2  
atom id /R:168@C2 idatm_type Car  
atom id /R:168@N3 idatm_type N2  
atom id /R:168@C4 idatm_type Car  
atom id /R:169@P idatm_type Pac  
atom id /R:169@OP1 idatm_type O3-  
atom id /R:169@OP2 idatm_type O3-  
atom id /R:169@O5' idatm_type O3  
atom id /R:169@C5' idatm_type C3  
atom id /R:169@C4' idatm_type C3  
atom id /R:169@O4' idatm_type O3  
atom id /R:169@C3' idatm_type C3  
atom id /R:169@O3' idatm_type O3  
atom id /R:169@C2' idatm_type C3  
atom id /R:169@O2' idatm_type O3  
atom id /R:169@C1' idatm_type C3  
atom id /R:169@N9 idatm_type Npl  
atom id /R:169@C8 idatm_type Car  
atom id /R:169@N7 idatm_type N2  
atom id /R:169@C5 idatm_type Car  
atom id /R:169@C6 idatm_type Car  
atom id /R:169@N6 idatm_type Npl  
atom id /R:169@N1 idatm_type N2  
atom id /R:169@C2 idatm_type Car  
atom id /R:169@N3 idatm_type N2  
atom id /R:169@C4 idatm_type Car  
atom id /R:170@P idatm_type Pac  
atom id /R:170@OP1 idatm_type O3-  
atom id /R:170@OP2 idatm_type O3-  
atom id /R:170@O5' idatm_type O3  
atom id /R:170@C5' idatm_type C3  
atom id /R:170@C4' idatm_type C3  
atom id /R:170@O4' idatm_type O3  
atom id /R:170@C3' idatm_type C3  
atom id /R:170@O3' idatm_type O3  
atom id /R:170@C2' idatm_type C3  
atom id /R:170@O2' idatm_type O3  
atom id /R:170@C1' idatm_type C3  
atom id /R:170@N1 idatm_type Npl  
atom id /R:170@C2 idatm_type C2  
atom id /R:170@O2 idatm_type O2  
atom id /R:170@N3 idatm_type N2  
atom id /R:170@C4 idatm_type C2  
atom id /R:170@N4 idatm_type Npl  
atom id /R:170@C5 idatm_type C2  
atom id /R:170@C6 idatm_type C2  
atom id /R:171@P idatm_type Pac  
atom id /R:171@OP1 idatm_type O3-  
atom id /R:171@OP2 idatm_type O3-  
atom id /R:171@O5' idatm_type O3  
atom id /R:171@C5' idatm_type C3  
atom id /R:171@C4' idatm_type C3  
atom id /R:171@O4' idatm_type O3  
atom id /R:171@C3' idatm_type C3  
atom id /R:171@O3' idatm_type O3  
atom id /R:171@C2' idatm_type C3  
atom id /R:171@O2' idatm_type O3  
atom id /R:171@C1' idatm_type C3  
atom id /R:171@N9 idatm_type Npl  
atom id /R:171@C8 idatm_type Car  
atom id /R:171@N7 idatm_type N2  
atom id /R:171@C5 idatm_type Car  
atom id /R:171@C6 idatm_type Car  
atom id /R:171@N6 idatm_type Npl  
atom id /R:171@N1 idatm_type N2  
atom id /R:171@C2 idatm_type Car  
atom id /R:171@N3 idatm_type N2  
atom id /R:171@C4 idatm_type Car  
atom id /R:172@P idatm_type Pac  
atom id /R:172@OP1 idatm_type O3-  
atom id /R:172@OP2 idatm_type O3-  
atom id /R:172@O5' idatm_type O3  
atom id /R:172@C5' idatm_type C3  
atom id /R:172@C4' idatm_type C3  
atom id /R:172@O4' idatm_type O3  
atom id /R:172@C3' idatm_type C3  
atom id /R:172@O3' idatm_type O3  
atom id /R:172@C2' idatm_type C3  
atom id /R:172@O2' idatm_type O3  
atom id /R:172@C1' idatm_type C3  
atom id /R:172@N9 idatm_type Npl  
atom id /R:172@C8 idatm_type Car  
atom id /R:172@N7 idatm_type N2  
atom id /R:172@C5 idatm_type Car  
atom id /R:172@C6 idatm_type Car  
atom id /R:172@N6 idatm_type Npl  
atom id /R:172@N1 idatm_type N2  
atom id /R:172@C2 idatm_type Car  
atom id /R:172@N3 idatm_type N2  
atom id /R:172@C4 idatm_type Car  
atom id /R:173@P idatm_type Pac  
atom id /R:173@OP1 idatm_type O3-  
atom id /R:173@OP2 idatm_type O3-  
atom id /R:173@O5' idatm_type O3  
atom id /R:173@C5' idatm_type C3  
atom id /R:173@C4' idatm_type C3  
atom id /R:173@O4' idatm_type O3  
atom id /R:173@C3' idatm_type C3  
atom id /R:173@O3' idatm_type O3  
atom id /R:173@C2' idatm_type C3  
atom id /R:173@O2' idatm_type O3  
atom id /R:173@C1' idatm_type C3  
atom id /R:173@N9 idatm_type Npl  
atom id /R:173@C8 idatm_type Car  
atom id /R:173@N7 idatm_type N2  
atom id /R:173@C5 idatm_type Car  
atom id /R:173@C6 idatm_type Car  
atom id /R:173@N6 idatm_type Npl  
atom id /R:173@N1 idatm_type N2  
atom id /R:173@C2 idatm_type Car  
atom id /R:173@N3 idatm_type N2  
atom id /R:173@C4 idatm_type Car  
atom id /R:174@P idatm_type Pac  
atom id /R:174@OP1 idatm_type O3-  
atom id /R:174@OP2 idatm_type O3-  
atom id /R:174@O5' idatm_type O3  
atom id /R:174@C5' idatm_type C3  
atom id /R:174@C4' idatm_type C3  
atom id /R:174@O4' idatm_type O3  
atom id /R:174@C3' idatm_type C3  
atom id /R:174@O3' idatm_type O3  
atom id /R:174@C2' idatm_type C3  
atom id /R:174@O2' idatm_type O3  
atom id /R:174@C1' idatm_type C3  
atom id /R:174@N9 idatm_type Npl  
atom id /R:174@C8 idatm_type Car  
atom id /R:174@N7 idatm_type N2  
atom id /R:174@C5 idatm_type Car  
atom id /R:174@C6 idatm_type Car  
atom id /R:174@N6 idatm_type Npl  
atom id /R:174@N1 idatm_type N2  
atom id /R:174@C2 idatm_type Car  
atom id /R:174@N3 idatm_type N2  
atom id /R:174@C4 idatm_type Car  
atom id /R:175@P idatm_type Pac  
atom id /R:175@OP1 idatm_type O3-  
atom id /R:175@OP2 idatm_type O3-  
atom id /R:175@O5' idatm_type O3  
atom id /R:175@C5' idatm_type C3  
atom id /R:175@C4' idatm_type C3  
atom id /R:175@O4' idatm_type O3  
atom id /R:175@C3' idatm_type C3  
atom id /R:175@O3' idatm_type O3  
atom id /R:175@C2' idatm_type C3  
atom id /R:175@O2' idatm_type O3  
atom id /R:175@C1' idatm_type C3  
atom id /R:175@N9 idatm_type Npl  
atom id /R:175@C8 idatm_type Car  
atom id /R:175@N7 idatm_type N2  
atom id /R:175@C5 idatm_type Car  
atom id /R:175@C6 idatm_type Car  
atom id /R:175@N6 idatm_type Npl  
atom id /R:175@N1 idatm_type N2  
atom id /R:175@C2 idatm_type Car  
atom id /R:175@N3 idatm_type N2  
atom id /R:175@C4 idatm_type Car  
atom id /R:176@P idatm_type Pac  
atom id /R:176@OP1 idatm_type O3-  
atom id /R:176@OP2 idatm_type O3-  
atom id /R:176@O5' idatm_type O3  
atom id /R:176@C5' idatm_type C3  
atom id /R:176@C4' idatm_type C3  
atom id /R:176@O4' idatm_type O3  
atom id /R:176@C3' idatm_type C3  
atom id /R:176@O3' idatm_type O3  
atom id /R:176@C2' idatm_type C3  
atom id /R:176@O2' idatm_type O3  
atom id /R:176@C1' idatm_type C3  
atom id /R:176@N9 idatm_type Npl  
atom id /R:176@C8 idatm_type Car  
atom id /R:176@N7 idatm_type N2  
atom id /R:176@C5 idatm_type Car  
atom id /R:176@C6 idatm_type Car  
atom id /R:176@N6 idatm_type Npl  
atom id /R:176@N1 idatm_type N2  
atom id /R:176@C2 idatm_type Car  
atom id /R:176@N3 idatm_type N2  
atom id /R:176@C4 idatm_type Car  
atom id /R:177@P idatm_type Pac  
atom id /R:177@OP1 idatm_type O3-  
atom id /R:177@OP2 idatm_type O3-  
atom id /R:177@O5' idatm_type O3  
atom id /R:177@C5' idatm_type C3  
atom id /R:177@C4' idatm_type C3  
atom id /R:177@O4' idatm_type O3  
atom id /R:177@C3' idatm_type C3  
atom id /R:177@O3' idatm_type O3  
atom id /R:177@C2' idatm_type C3  
atom id /R:177@O2' idatm_type O3  
atom id /R:177@C1' idatm_type C3  
atom id /R:177@N1 idatm_type Npl  
atom id /R:177@C2 idatm_type C2  
atom id /R:177@O2 idatm_type O2  
atom id /R:177@N3 idatm_type Npl  
atom id /R:177@C4 idatm_type C2  
atom id /R:177@O4 idatm_type O2  
atom id /R:177@C5 idatm_type C2  
atom id /R:177@C6 idatm_type C2  
atom id /R:178@P idatm_type Pac  
atom id /R:178@OP1 idatm_type O3-  
atom id /R:178@OP2 idatm_type O3-  
atom id /R:178@O5' idatm_type O3  
atom id /R:178@C5' idatm_type C3  
atom id /R:178@C4' idatm_type C3  
atom id /R:178@O4' idatm_type O3  
atom id /R:178@C3' idatm_type C3  
atom id /R:178@O3' idatm_type O3  
atom id /R:178@C2' idatm_type C3  
atom id /R:178@O2' idatm_type O3  
atom id /R:178@C1' idatm_type C3  
atom id /R:178@N9 idatm_type Npl  
atom id /R:178@C8 idatm_type Car  
atom id /R:178@N7 idatm_type N2  
atom id /R:178@C5 idatm_type Car  
atom id /R:178@C6 idatm_type C2  
atom id /R:178@O6 idatm_type O2  
atom id /R:178@N1 idatm_type Npl  
atom id /R:178@C2 idatm_type C2  
atom id /R:178@N2 idatm_type Npl  
atom id /R:178@N3 idatm_type N2  
atom id /R:178@C4 idatm_type Car  
atom id /R:179@P idatm_type Pac  
atom id /R:179@OP1 idatm_type O3-  
atom id /R:179@OP2 idatm_type O3-  
atom id /R:179@O5' idatm_type O3  
atom id /R:179@C5' idatm_type C3  
atom id /R:179@C4' idatm_type C3  
atom id /R:179@O4' idatm_type O3  
atom id /R:179@C3' idatm_type C3  
atom id /R:179@O3' idatm_type O3  
atom id /R:179@C2' idatm_type C3  
atom id /R:179@O2' idatm_type O3  
atom id /R:179@C1' idatm_type C3  
atom id /R:179@N1 idatm_type Npl  
atom id /R:179@C2 idatm_type C2  
atom id /R:179@O2 idatm_type O2  
atom id /R:179@N3 idatm_type Npl  
atom id /R:179@C4 idatm_type C2  
atom id /R:179@O4 idatm_type O2  
atom id /R:179@C5 idatm_type C2  
atom id /R:179@C6 idatm_type C2  
atom id /R:180@P idatm_type Pac  
atom id /R:180@OP1 idatm_type O3-  
atom id /R:180@OP2 idatm_type O3-  
atom id /R:180@O5' idatm_type O3  
atom id /R:180@C5' idatm_type C3  
atom id /R:180@C4' idatm_type C3  
atom id /R:180@O4' idatm_type O3  
atom id /R:180@C3' idatm_type C3  
atom id /R:180@O3' idatm_type O3  
atom id /R:180@C2' idatm_type C3  
atom id /R:180@O2' idatm_type O3  
atom id /R:180@C1' idatm_type C3  
atom id /R:180@N1 idatm_type Npl  
atom id /R:180@C2 idatm_type C2  
atom id /R:180@O2 idatm_type O2  
atom id /R:180@N3 idatm_type N2  
atom id /R:180@C4 idatm_type C2  
atom id /R:180@N4 idatm_type Npl  
atom id /R:180@C5 idatm_type C2  
atom id /R:180@C6 idatm_type C2  
atom id /R:181@P idatm_type Pac  
atom id /R:181@OP1 idatm_type O3-  
atom id /R:181@OP2 idatm_type O3-  
atom id /R:181@O5' idatm_type O3  
atom id /R:181@C5' idatm_type C3  
atom id /R:181@C4' idatm_type C3  
atom id /R:181@O4' idatm_type O3  
atom id /R:181@C3' idatm_type C3  
atom id /R:181@O3' idatm_type O3  
atom id /R:181@C2' idatm_type C3  
atom id /R:181@O2' idatm_type O3  
atom id /R:181@C1' idatm_type C3  
atom id /R:181@N9 idatm_type Npl  
atom id /R:181@C8 idatm_type Car  
atom id /R:181@N7 idatm_type N2  
atom id /R:181@C5 idatm_type Car  
atom id /R:181@C6 idatm_type Car  
atom id /R:181@N6 idatm_type Npl  
atom id /R:181@N1 idatm_type N2  
atom id /R:181@C2 idatm_type Car  
atom id /R:181@N3 idatm_type N2  
atom id /R:181@C4 idatm_type Car  
atom id /R:182@P idatm_type Pac  
atom id /R:182@OP1 idatm_type O3-  
atom id /R:182@OP2 idatm_type O3-  
atom id /R:182@O5' idatm_type O3  
atom id /R:182@C5' idatm_type C3  
atom id /R:182@C4' idatm_type C3  
atom id /R:182@O4' idatm_type O3  
atom id /R:182@C3' idatm_type C3  
atom id /R:182@O3' idatm_type O3  
atom id /R:182@C2' idatm_type C3  
atom id /R:182@O2' idatm_type O3  
atom id /R:182@C1' idatm_type C3  
atom id /R:182@N9 idatm_type Npl  
atom id /R:182@C8 idatm_type Car  
atom id /R:182@N7 idatm_type N2  
atom id /R:182@C5 idatm_type Car  
atom id /R:182@C6 idatm_type C2  
atom id /R:182@O6 idatm_type O2  
atom id /R:182@N1 idatm_type Npl  
atom id /R:182@C2 idatm_type C2  
atom id /R:182@N2 idatm_type Npl  
atom id /R:182@N3 idatm_type N2  
atom id /R:182@C4 idatm_type Car  
atom id /R:183@P idatm_type Pac  
atom id /R:183@OP1 idatm_type O3-  
atom id /R:183@OP2 idatm_type O3-  
atom id /R:183@O5' idatm_type O3  
atom id /R:183@C5' idatm_type C3  
atom id /R:183@C4' idatm_type C3  
atom id /R:183@O4' idatm_type O3  
atom id /R:183@C3' idatm_type C3  
atom id /R:183@O3' idatm_type O3  
atom id /R:183@C2' idatm_type C3  
atom id /R:183@O2' idatm_type O3  
atom id /R:183@C1' idatm_type C3  
atom id /R:183@N1 idatm_type Npl  
atom id /R:183@C2 idatm_type C2  
atom id /R:183@O2 idatm_type O2  
atom id /R:183@N3 idatm_type N2  
atom id /R:183@C4 idatm_type C2  
atom id /R:183@N4 idatm_type Npl  
atom id /R:183@C5 idatm_type C2  
atom id /R:183@C6 idatm_type C2  
atom id /R:184@P idatm_type Pac  
atom id /R:184@OP1 idatm_type O3-  
atom id /R:184@OP2 idatm_type O3-  
atom id /R:184@O5' idatm_type O3  
atom id /R:184@C5' idatm_type C3  
atom id /R:184@C4' idatm_type C3  
atom id /R:184@O4' idatm_type O3  
atom id /R:184@C3' idatm_type C3  
atom id /R:184@O3' idatm_type O3  
atom id /R:184@C2' idatm_type C3  
atom id /R:184@O2' idatm_type O3  
atom id /R:184@C1' idatm_type C3  
atom id /R:184@N1 idatm_type Npl  
atom id /R:184@C2 idatm_type C2  
atom id /R:184@O2 idatm_type O2  
atom id /R:184@N3 idatm_type Npl  
atom id /R:184@C4 idatm_type C2  
atom id /R:184@O4 idatm_type O2  
atom id /R:184@C5 idatm_type C2  
atom id /R:184@C6 idatm_type C2  
atom id /R:185@P idatm_type Pac  
atom id /R:185@OP1 idatm_type O3-  
atom id /R:185@OP2 idatm_type O3-  
atom id /R:185@O5' idatm_type O3  
atom id /R:185@C5' idatm_type C3  
atom id /R:185@C4' idatm_type C3  
atom id /R:185@O4' idatm_type O3  
atom id /R:185@C3' idatm_type C3  
atom id /R:185@O3' idatm_type O3  
atom id /R:185@C2' idatm_type C3  
atom id /R:185@O2' idatm_type O3  
atom id /R:185@C1' idatm_type C3  
atom id /R:185@N9 idatm_type Npl  
atom id /R:185@C8 idatm_type Car  
atom id /R:185@N7 idatm_type N2  
atom id /R:185@C5 idatm_type Car  
atom id /R:185@C6 idatm_type C2  
atom id /R:185@O6 idatm_type O2  
atom id /R:185@N1 idatm_type Npl  
atom id /R:185@C2 idatm_type C2  
atom id /R:185@N2 idatm_type Npl  
atom id /R:185@N3 idatm_type N2  
atom id /R:185@C4 idatm_type Car  
atom id /R:186@P idatm_type Pac  
atom id /R:186@OP1 idatm_type O3-  
atom id /R:186@OP2 idatm_type O3-  
atom id /R:186@O5' idatm_type O3  
atom id /R:186@C5' idatm_type C3  
atom id /R:186@C4' idatm_type C3  
atom id /R:186@O4' idatm_type O3  
atom id /R:186@C3' idatm_type C3  
atom id /R:186@O3' idatm_type O3  
atom id /R:186@C2' idatm_type C3  
atom id /R:186@O2' idatm_type O3  
atom id /R:186@C1' idatm_type C3  
atom id /R:186@N1 idatm_type Npl  
atom id /R:186@C2 idatm_type C2  
atom id /R:186@O2 idatm_type O2  
atom id /R:186@N3 idatm_type N2  
atom id /R:186@C4 idatm_type C2  
atom id /R:186@N4 idatm_type Npl  
atom id /R:186@C5 idatm_type C2  
atom id /R:186@C6 idatm_type C2  
atom id /R:187@P idatm_type Pac  
atom id /R:187@OP1 idatm_type O3-  
atom id /R:187@OP2 idatm_type O3-  
atom id /R:187@O5' idatm_type O3  
atom id /R:187@C5' idatm_type C3  
atom id /R:187@C4' idatm_type C3  
atom id /R:187@O4' idatm_type O3  
atom id /R:187@C3' idatm_type C3  
atom id /R:187@O3' idatm_type O3  
atom id /R:187@C2' idatm_type C3  
atom id /R:187@O2' idatm_type O3  
atom id /R:187@C1' idatm_type C3  
atom id /R:187@N1 idatm_type Npl  
atom id /R:187@C2 idatm_type C2  
atom id /R:187@O2 idatm_type O2  
atom id /R:187@N3 idatm_type Npl  
atom id /R:187@C4 idatm_type C2  
atom id /R:187@O4 idatm_type O2  
atom id /R:187@C5 idatm_type C2  
atom id /R:187@C6 idatm_type C2  
atom id /R:188@P idatm_type Pac  
atom id /R:188@OP1 idatm_type O3-  
atom id /R:188@OP2 idatm_type O3-  
atom id /R:188@O5' idatm_type O3  
atom id /R:188@C5' idatm_type C3  
atom id /R:188@C4' idatm_type C3  
atom id /R:188@O4' idatm_type O3  
atom id /R:188@C3' idatm_type C3  
atom id /R:188@O3' idatm_type O3  
atom id /R:188@C2' idatm_type C3  
atom id /R:188@O2' idatm_type O3  
atom id /R:188@C1' idatm_type C3  
atom id /R:188@N9 idatm_type Npl  
atom id /R:188@C8 idatm_type Car  
atom id /R:188@N7 idatm_type N2  
atom id /R:188@C5 idatm_type Car  
atom id /R:188@C6 idatm_type C2  
atom id /R:188@O6 idatm_type O2  
atom id /R:188@N1 idatm_type Npl  
atom id /R:188@C2 idatm_type C2  
atom id /R:188@N2 idatm_type Npl  
atom id /R:188@N3 idatm_type N2  
atom id /R:188@C4 idatm_type Car  
atom id /R:189@P idatm_type Pac  
atom id /R:189@OP1 idatm_type O3-  
atom id /R:189@OP2 idatm_type O3-  
atom id /R:189@O5' idatm_type O3  
atom id /R:189@C5' idatm_type C3  
atom id /R:189@C4' idatm_type C3  
atom id /R:189@O4' idatm_type O3  
atom id /R:189@C3' idatm_type C3  
atom id /R:189@O3' idatm_type O3  
atom id /R:189@C2' idatm_type C3  
atom id /R:189@O2' idatm_type O3  
atom id /R:189@C1' idatm_type C3  
atom id /R:189@N9 idatm_type Npl  
atom id /R:189@C8 idatm_type Car  
atom id /R:189@N7 idatm_type N2  
atom id /R:189@C5 idatm_type Car  
atom id /R:189@C6 idatm_type C2  
atom id /R:189@O6 idatm_type O2  
atom id /R:189@N1 idatm_type Npl  
atom id /R:189@C2 idatm_type C2  
atom id /R:189@N2 idatm_type Npl  
atom id /R:189@N3 idatm_type N2  
atom id /R:189@C4 idatm_type Car  
atom id /R:190@P idatm_type Pac  
atom id /R:190@OP1 idatm_type O3-  
atom id /R:190@OP2 idatm_type O3-  
atom id /R:190@O5' idatm_type O3  
atom id /R:190@C5' idatm_type C3  
atom id /R:190@C4' idatm_type C3  
atom id /R:190@O4' idatm_type O3  
atom id /R:190@C3' idatm_type C3  
atom id /R:190@O3' idatm_type O3  
atom id /R:190@C2' idatm_type C3  
atom id /R:190@O2' idatm_type O3  
atom id /R:190@C1' idatm_type C3  
atom id /R:190@N1 idatm_type Npl  
atom id /R:190@C2 idatm_type C2  
atom id /R:190@O2 idatm_type O2  
atom id /R:190@N3 idatm_type N2  
atom id /R:190@C4 idatm_type C2  
atom id /R:190@N4 idatm_type Npl  
atom id /R:190@C5 idatm_type C2  
atom id /R:190@C6 idatm_type C2  
atom id /R:191@P idatm_type Pac  
atom id /R:191@OP1 idatm_type O3-  
atom id /R:191@OP2 idatm_type O3-  
atom id /R:191@O5' idatm_type O3  
atom id /R:191@C5' idatm_type C3  
atom id /R:191@C4' idatm_type C3  
atom id /R:191@O4' idatm_type O3  
atom id /R:191@C3' idatm_type C3  
atom id /R:191@O3' idatm_type O3  
atom id /R:191@C2' idatm_type C3  
atom id /R:191@O2' idatm_type O3  
atom id /R:191@C1' idatm_type C3  
atom id /R:191@N1 idatm_type Npl  
atom id /R:191@C2 idatm_type C2  
atom id /R:191@O2 idatm_type O2  
atom id /R:191@N3 idatm_type N2  
atom id /R:191@C4 idatm_type C2  
atom id /R:191@N4 idatm_type Npl  
atom id /R:191@C5 idatm_type C2  
atom id /R:191@C6 idatm_type C2  
atom id /R:192@P idatm_type Pac  
atom id /R:192@OP1 idatm_type O3-  
atom id /R:192@OP2 idatm_type O3-  
atom id /R:192@O5' idatm_type O3  
atom id /R:192@C5' idatm_type C3  
atom id /R:192@C4' idatm_type C3  
atom id /R:192@O4' idatm_type O3  
atom id /R:192@C3' idatm_type C3  
atom id /R:192@O3' idatm_type O3  
atom id /R:192@C2' idatm_type C3  
atom id /R:192@O2' idatm_type O3  
atom id /R:192@C1' idatm_type C3  
atom id /R:192@N1 idatm_type Npl  
atom id /R:192@C2 idatm_type C2  
atom id /R:192@O2 idatm_type O2  
atom id /R:192@N3 idatm_type N2  
atom id /R:192@C4 idatm_type C2  
atom id /R:192@N4 idatm_type Npl  
atom id /R:192@C5 idatm_type C2  
atom id /R:192@C6 idatm_type C2  

> info traptr

1 models  
#1, 7v99, shown  
14582 atoms, 15404 bonds, 1419 residues, 5 chains (A,K,L,R,S)  
193 hydrogen bonds, 3 missing structure  

> info beforetraptr1

1 models  
#1, 7v99, shown  
14582 atoms, 15404 bonds, 1419 residues, 5 chains (A,K,L,R,S)  
193 hydrogen bonds, 3 missing structure  

> info matt

Expected a models specifier or a keyword  

> color beforetraptr1 green

> color beforetraptr2 red

> name list

before_traptr sel  
beforetr1 sel  
beforetraptr1 sel  
beforetraptr2 sel  
test1 sel  
trapping_TR sel  
traptr sel  

> select protein

9299 atoms, 9512 bonds, 1 pseudobond, 1170 residues, 2 models selected  

> color test1 red

> color traptr blue

> name delete all

> name list

There are no user-defined specifier names.  

> name traptr select /r:237-334

"select /r:237-334": invalid atom specifier  

> name traptr selection /r:237-334

"selection /r:237-334": invalid atom specifier  

> name traptr /r:237-334

> name before_traptr1 /r:33-147

> name before_traptr2 /r:163-192

> name before_traptr /r:33-192

> color /a blue

> color /a lightblue

> color /j green

> color /k green

> color /k lightgreen

> color /l lightred

Expected a color or one of 'byatom', 'bychain', 'byelement', 'byhetero',
'byidentity', 'bymodel', 'bynucleotide', 'bypolymer', 'fromatoms',
'fromcartoons', 'fromribbons', or 'random' or a keyword  

> color /l lightred

Expected a color or one of 'byatom', 'bychain', 'byelement', 'byhetero',
'byidentity', 'bymodel', 'bynucleotide', 'bypolymer', 'fromatoms',
'fromcartoons', 'fromribbons', or 'random' or a keyword  

> color /l green

> lighting soft

> color before_traptr pink

> save "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures/7v99 chimera work.cxs"

——— End of log from Thu Jun 8 16:55:49 2023 ———

opened ChimeraX session  
UCSF ChimeraX version: 1.6.1 (2023-05-09)  
© 2016-2023 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  

> color before_traptr red

> color before_traptr pink

> lighting simple

[Repeated 1 time(s)]

> lighting soft

[Repeated 2 time(s)]

> lighting full

> lighting soft

[Repeated 1 time(s)]

> transparency /a 50

> transparency /a 40

> transparency /a 20

> transparency /a 10

> transparency /a 90

> transparency /a 0

> transparency /a 5

> hide /a atoms

> hide /a surfaces

> show /a surfaces

> selection /a

Unknown command: selection /a  

> select /a

7898 atoms, 8092 bonds, 1 pseudobond, 991 residues, 2 models selected  

> color sel byhetero

> color sel bychain

> color sel bypolymer

> rainbow sel

> color sel bychain

> hide sel atoms

> hide sel cartoons

> hide sel surfaces

> show sel surfaces

> surface style #1.3 mesh

> surface style #1.3 dot

> surface style #1.3 solid

> transparency (#!1 & sel) 100

> transparency (#!1 & sel) 90

> transparency (#!1 & sel) 70

> save "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures/7v99 chimera work.cxs"

> ui tool show "Surface Color"

> ui tool show "File History"

> ui tool show AlphaFold

> alphafold match #1/A

Fetching AlphaFold database settings from
https://www.rbvi.ucsf.edu/chimerax/data/status/alphafold_database3.json  
Fetching compressed AlphaFold O14746 from
https://alphafold.ebi.ac.uk/files/AF-O14746-F1-model_v4.cif  
1 AlphaFold model found using UniProt identifier: O14746 (chain A)  
AlphaFold prediction matching 7v99  
---  
Chain| UniProt Id| UniProt Name| RMSD| Length| Seen| % Id  
A | O14746 | TERT_HUMAN | 5.03 | 1132 | 991 | 100  
  
Opened 1 AlphaFold model  

> hide #!2 models

> show #!2 models

> hide #!2 models

> hide target m

> show target m

> hide #!2 models

> close #2

> roll

[Repeated 1 time(s)]

> roll stop

Expected an axis vector or a keyword  

> roll off

Expected an axis vector or a keyword  

> stop

> tile 2

Expected a models specifier or a keyword  

> select /R:33-192

3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected  

Unsupported scale factor (0.000000) detected on Display0  

[Repeated 4 time(s)]

> select /R

5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected  

> select /R

5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected  

> hide beforetraptr

Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword  

> name list

before_traptr /r:33-192  
before_traptr1 /r:33-147  
before_traptr2 /r:163-192  
beforetr1 sel  
beforetraptr1 sel  
test1 sel  
trapping_TR sel  
traptr /r:237-334  

> hide before_traptr

> hide before_traptr atoms, ribbons

> hide /a

> hide /a surfaces

> hide /s atoms, ribbons

> name long_loop_hp selection /r:276-2279

"selection /r:276-2279": invalid atom specifier  

> name long_loop_hp selection /r:276-279

"selection /r:276-279": invalid atom specifier  

> name long_loop_hp select /r:276-279

"select /r:276-279": invalid atom specifier  

> name long_loop_hp /r:276-279

> color long_loop_hp red

> save "/Users/matthewcomstock/Library/CloudStorage/OneDrive-
> MichiganStateUniversity/project analysis/230308 telomerase RNA
> structure/telomerase structures/7v99 chimera work.cxs"

——— End of log from Mon Jun 12 09:55:11 2023 ———

opened ChimeraX session  
UCSF ChimeraX version: 1.6.1 (2023-05-09)  
© 2016-2023 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  




OpenGL version: 4.1 INTEL-20.5.7
OpenGL renderer: Intel(R) Iris(TM) Plus Graphics 655
OpenGL vendor: Intel Inc.

Python: 3.9.11
Locale: UTF-8
Qt version: PyQt6 6.4.2, Qt 6.4.2
Qt runtime version: 6.4.3
Qt platform: cocoa
Hardware:

    Hardware Overview:

      Model Name: MacBook Pro
      Model Identifier: MacBookPro15,2
      Processor Name: Quad-Core Intel Core i5
      Processor Speed: 2.4 GHz
      Number of Processors: 1
      Total Number of Cores: 4
      L2 Cache (per Core): 256 KB
      L3 Cache: 6 MB
      Hyper-Threading Technology: Enabled
      Memory: 8 GB
      System Firmware Version: 1968.100.17.0.0 (iBridge: 20.16.4252.0.0,0)
      OS Loader Version: 577~129

Software:

    System Software Overview:

      System Version: macOS 13.3.1 (a) (22E772610a)
      Kernel Version: Darwin 22.4.0
      Time since boot: 18 days, 10 minutes

Graphics/Displays:

    Intel Iris Plus Graphics 655:

      Chipset Model: Intel Iris Plus Graphics 655
      Type: GPU
      Bus: Built-In
      VRAM (Dynamic, Max): 1536 MB
      Vendor: Intel
      Device ID: 0x3ea5
      Revision ID: 0x0001
      Metal Support: Metal 3
      Displays:
        Color LCD:
          Display Type: Built-In Retina LCD
          Resolution: 2560 x 1600 Retina
          Framebuffer Depth: 24-Bit Color (ARGB8888)
          Mirror: Off
          Online: Yes
          Automatically Adjust Brightness: Yes
          Connection Type: Internal
        Thunderbolt Display:
          Display Type: LCD
          Resolution: 2560 x 1440 (QHD/WQHD - Wide Quad High Definition)
          UI Looks like: 2560 x 1440
          Framebuffer Depth: 30-Bit Color (ARGB2101010)
          Display Serial Number: C02HV216F2GC
          Main Display: Yes
          Mirror: Off
          Online: Yes
          Rotation: Supported
          Automatically Adjust Brightness: No
          Connection Type: Thunderbolt/DisplayPort


Installed Packages:
    alabaster: 0.7.13
    appdirs: 1.4.4
    appnope: 0.1.3
    asttokens: 2.2.1
    Babel: 2.12.1
    backcall: 0.2.0
    beautifulsoup4: 4.11.2
    blockdiag: 3.0.0
    build: 0.10.0
    certifi: 2021.10.8
    cftime: 1.6.2
    charset-normalizer: 3.1.0
    ChimeraX-AddCharge: 1.5.9.1
    ChimeraX-AddH: 2.2.5
    ChimeraX-AlignmentAlgorithms: 2.0.1
    ChimeraX-AlignmentHdrs: 3.3.1
    ChimeraX-AlignmentMatrices: 2.1
    ChimeraX-Alignments: 2.9.3
    ChimeraX-AlphaFold: 1.0
    ChimeraX-AltlocExplorer: 1.0.3
    ChimeraX-AmberInfo: 1.0
    ChimeraX-Arrays: 1.1
    ChimeraX-Atomic: 1.43.10
    ChimeraX-AtomicLibrary: 10.0.6
    ChimeraX-AtomSearch: 2.0.1
    ChimeraX-AxesPlanes: 2.3.2
    ChimeraX-BasicActions: 1.1.2
    ChimeraX-BILD: 1.0
    ChimeraX-BlastProtein: 2.1.2
    ChimeraX-BondRot: 2.0.1
    ChimeraX-BugReporter: 1.0.1
    ChimeraX-BuildStructure: 2.8
    ChimeraX-Bumps: 1.0
    ChimeraX-BundleBuilder: 1.2.2
    ChimeraX-ButtonPanel: 1.0.1
    ChimeraX-CageBuilder: 1.0.1
    ChimeraX-CellPack: 1.0
    ChimeraX-Centroids: 1.3.2
    ChimeraX-ChangeChains: 1.0.2
    ChimeraX-CheckWaters: 1.3.1
    ChimeraX-ChemGroup: 2.0.1
    ChimeraX-Clashes: 2.2.4
    ChimeraX-ColorActions: 1.0.3
    ChimeraX-ColorGlobe: 1.0
    ChimeraX-ColorKey: 1.5.3
    ChimeraX-CommandLine: 1.2.5
    ChimeraX-ConnectStructure: 2.0.1
    ChimeraX-Contacts: 1.0.1
    ChimeraX-Core: 1.6.1
    ChimeraX-CoreFormats: 1.1
    ChimeraX-coulombic: 1.4.2
    ChimeraX-Crosslinks: 1.0
    ChimeraX-Crystal: 1.0
    ChimeraX-CrystalContacts: 1.0.1
    ChimeraX-DataFormats: 1.2.3
    ChimeraX-Dicom: 1.2
    ChimeraX-DistMonitor: 1.4
    ChimeraX-DockPrep: 1.1.1
    ChimeraX-Dssp: 2.0
    ChimeraX-EMDB-SFF: 1.0
    ChimeraX-ESMFold: 1.0
    ChimeraX-FileHistory: 1.0.1
    ChimeraX-FunctionKey: 1.0.1
    ChimeraX-Geometry: 1.3
    ChimeraX-gltf: 1.0
    ChimeraX-Graphics: 1.1.1
    ChimeraX-Hbonds: 2.4
    ChimeraX-Help: 1.2.1
    ChimeraX-HKCage: 1.3
    ChimeraX-IHM: 1.1
    ChimeraX-ImageFormats: 1.2
    ChimeraX-IMOD: 1.0
    ChimeraX-IO: 1.0.1
    ChimeraX-ItemsInspection: 1.0.1
    ChimeraX-Label: 1.1.7
    ChimeraX-ListInfo: 1.1.1
    ChimeraX-Log: 1.1.5
    ChimeraX-LookingGlass: 1.1
    ChimeraX-Maestro: 1.8.2
    ChimeraX-Map: 1.1.4
    ChimeraX-MapData: 2.0
    ChimeraX-MapEraser: 1.0.1
    ChimeraX-MapFilter: 2.0.1
    ChimeraX-MapFit: 2.0
    ChimeraX-MapSeries: 2.1.1
    ChimeraX-Markers: 1.0.1
    ChimeraX-Mask: 1.0.2
    ChimeraX-MatchMaker: 2.0.12
    ChimeraX-MDcrds: 2.6
    ChimeraX-MedicalToolbar: 1.0.2
    ChimeraX-Meeting: 1.0.1
    ChimeraX-MLP: 1.1.1
    ChimeraX-mmCIF: 2.12
    ChimeraX-MMTF: 2.2
    ChimeraX-Modeller: 1.5.9
    ChimeraX-ModelPanel: 1.3.7
    ChimeraX-ModelSeries: 1.0.1
    ChimeraX-Mol2: 2.0
    ChimeraX-Mole: 1.0
    ChimeraX-Morph: 1.0.2
    ChimeraX-MouseModes: 1.2
    ChimeraX-Movie: 1.0
    ChimeraX-Neuron: 1.0
    ChimeraX-Nifti: 1.0
    ChimeraX-NRRD: 1.0
    ChimeraX-Nucleotides: 2.0.3
    ChimeraX-OpenCommand: 1.10.1
    ChimeraX-PDB: 2.7.2
    ChimeraX-PDBBio: 1.0
    ChimeraX-PDBLibrary: 1.0.2
    ChimeraX-PDBMatrices: 1.0
    ChimeraX-PickBlobs: 1.0.1
    ChimeraX-Positions: 1.0
    ChimeraX-PresetMgr: 1.1
    ChimeraX-PubChem: 2.1
    ChimeraX-ReadPbonds: 1.0.1
    ChimeraX-Registration: 1.1.1
    ChimeraX-RemoteControl: 1.0
    ChimeraX-RenderByAttr: 1.1
    ChimeraX-RenumberResidues: 1.1
    ChimeraX-ResidueFit: 1.0.1
    ChimeraX-RestServer: 1.1
    ChimeraX-RNALayout: 1.0
    ChimeraX-RotamerLibMgr: 3.0
    ChimeraX-RotamerLibsDunbrack: 2.0
    ChimeraX-RotamerLibsDynameomics: 2.0
    ChimeraX-RotamerLibsRichardson: 2.0
    ChimeraX-SaveCommand: 1.5.1
    ChimeraX-SchemeMgr: 1.0
    ChimeraX-SDF: 2.0.1
    ChimeraX-Segger: 1.0
    ChimeraX-Segment: 1.0.1
    ChimeraX-SelInspector: 1.0
    ChimeraX-SeqView: 2.8.3
    ChimeraX-Shape: 1.0.1
    ChimeraX-Shell: 1.0.1
    ChimeraX-Shortcuts: 1.1.1
    ChimeraX-ShowSequences: 1.0.1
    ChimeraX-SideView: 1.0.1
    ChimeraX-Smiles: 2.1
    ChimeraX-SmoothLines: 1.0
    ChimeraX-SpaceNavigator: 1.0
    ChimeraX-StdCommands: 1.10.3
    ChimeraX-STL: 1.0.1
    ChimeraX-Storm: 1.0
    ChimeraX-StructMeasure: 1.1.2
    ChimeraX-Struts: 1.0.1
    ChimeraX-Surface: 1.0.1
    ChimeraX-SwapAA: 2.0.1
    ChimeraX-SwapRes: 2.2.1
    ChimeraX-TapeMeasure: 1.0
    ChimeraX-Test: 1.0
    ChimeraX-Toolbar: 1.1.2
    ChimeraX-ToolshedUtils: 1.2.1
    ChimeraX-Topography: 1.0
    ChimeraX-Tug: 1.0.1
    ChimeraX-UI: 1.28.4
    ChimeraX-uniprot: 2.2.2
    ChimeraX-UnitCell: 1.0.1
    ChimeraX-ViewDockX: 1.2
    ChimeraX-VIPERdb: 1.0
    ChimeraX-Vive: 1.1
    ChimeraX-VolumeMenu: 1.0.1
    ChimeraX-VTK: 1.0
    ChimeraX-WavefrontOBJ: 1.0
    ChimeraX-WebCam: 1.0.2
    ChimeraX-WebServices: 1.1.1
    ChimeraX-Zone: 1.0.1
    colorama: 0.4.6
    comm: 0.1.3
    contourpy: 1.0.7
    cxservices: 1.2.2
    cycler: 0.11.0
    Cython: 0.29.33
    debugpy: 1.6.7
    decorator: 5.1.1
    docutils: 0.19
    executing: 1.2.0
    filelock: 3.9.0
    fonttools: 4.39.3
    funcparserlib: 1.0.1
    grako: 3.16.5
    h5py: 3.8.0
    html2text: 2020.1.16
    idna: 3.4
    ihm: 0.35
    imagecodecs: 2022.2.22
    imagesize: 1.4.1
    importlib-metadata: 6.6.0
    ipykernel: 6.21.1
    ipython: 8.10.0
    ipython-genutils: 0.2.0
    ipywidgets: 8.0.6
    jedi: 0.18.2
    Jinja2: 3.1.2
    jupyter-client: 8.0.2
    jupyter-core: 5.3.0
    jupyterlab-widgets: 3.0.7
    kiwisolver: 1.4.4
    line-profiler: 4.0.2
    lxml: 4.9.2
    lz4: 4.3.2
    MarkupSafe: 2.1.2
    matplotlib: 3.6.3
    matplotlib-inline: 0.1.6
    msgpack: 1.0.4
    nest-asyncio: 1.5.6
    netCDF4: 1.6.2
    networkx: 2.8.8
    nibabel: 5.0.1
    nptyping: 2.5.0
    numexpr: 2.8.4
    numpy: 1.23.5
    openvr: 1.23.701
    packaging: 21.3
    ParmEd: 3.4.3
    parso: 0.8.3
    pep517: 0.13.0
    pexpect: 4.8.0
    pickleshare: 0.7.5
    Pillow: 9.3.0
    pip: 23.0
    pkginfo: 1.9.6
    platformdirs: 3.5.0
    prompt-toolkit: 3.0.38
    psutil: 5.9.4
    ptyprocess: 0.7.0
    pure-eval: 0.2.2
    pycollada: 0.7.2
    pydicom: 2.3.0
    Pygments: 2.14.0
    pynrrd: 1.0.0
    PyOpenGL: 3.1.5
    PyOpenGL-accelerate: 3.1.5
    pyparsing: 3.0.9
    pyproject-hooks: 1.0.0
    PyQt6-commercial: 6.4.2
    PyQt6-Qt6: 6.4.3
    PyQt6-sip: 13.4.1
    PyQt6-WebEngine-commercial: 6.4.0
    PyQt6-WebEngine-Qt6: 6.4.3
    python-dateutil: 2.8.2
    pytz: 2023.3
    pyzmq: 25.0.2
    qtconsole: 5.4.0
    QtPy: 2.3.1
    RandomWords: 0.4.0
    requests: 2.28.2
    scipy: 1.9.3
    setuptools: 67.4.0
    setuptools-scm: 7.0.5
    sfftk-rw: 0.7.3
    six: 1.16.0
    snowballstemmer: 2.2.0
    sortedcontainers: 2.4.0
    soupsieve: 2.4.1
    sphinx: 6.1.3
    sphinx-autodoc-typehints: 1.22
    sphinxcontrib-applehelp: 1.0.4
    sphinxcontrib-blockdiag: 3.0.0
    sphinxcontrib-devhelp: 1.0.2
    sphinxcontrib-htmlhelp: 2.0.1
    sphinxcontrib-jsmath: 1.0.1
    sphinxcontrib-qthelp: 1.0.3
    sphinxcontrib-serializinghtml: 1.1.5
    stack-data: 0.6.2
    tables: 3.7.0
    tcia-utils: 1.2.0
    tifffile: 2022.10.10
    tinyarray: 1.2.4
    tomli: 2.0.1
    tornado: 6.3.1
    traitlets: 5.9.0
    typing-extensions: 4.5.0
    tzdata: 2023.3
    urllib3: 1.26.15
    wcwidth: 0.2.6
    webcolors: 1.12
    wheel: 0.38.4
    wheel-filename: 1.4.1
    widgetsnbextension: 4.0.7
    zipp: 3.15.0

Change History (0)

Note: See TracTickets for help on using tickets.