Opened 4 years ago
Closed 4 years ago
#8450 closed defect (can't reproduce)
MatchMaker: 'NoneType' object has no attribute 'setChecked'
| Reported by: | Owned by: | Eric Pettersen | |
|---|---|---|---|
| Priority: | normal | Milestone: | |
| Component: | Structure Comparison | Version: | |
| Keywords: | Cc: | ||
| Blocked By: | Blocking: | ||
| Notify when closed: | Platform: | all | |
| Project: | ChimeraX |
Description
The following bug report has been submitted:
Platform: macOS-10.14.6-x86_64-i386-64bit
ChimeraX Version: 1.5 (2022-11-24 00:03:27 UTC)
Description
(Describe the actions that caused this problem to occur here)
Log:
UCSF ChimeraX version: 1.5 (2022-11-24)
© 2016-2022 Regents of the University of California. All rights reserved.
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/H2AH2B MRGRKK.cxs" format session
Log from Fri Jan 6 13:28:28 2023UCSF ChimeraX version: 1.5 (2022-11-24)
© 2016-2022 Regents of the University of California. All rights reserved.
How to cite UCSF ChimeraX
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> color sel hot pink
> select /B:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> color sel cornflower blue
> select /C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> color sel orange
> select /A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> style sel sphere
Changed 2063 atom styles
> style sel sphere
Changed 2063 atom styles
> show target m
> style sel ball
Changed 2063 atom styles
> select clear
> style sphere
Changed 4347 atom styles
> select /A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> surface sel
> select /B:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> show sel surfaces
> select clear
> coulombic
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -15.50, mean
3.92, maximum 18.48
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -8.85, mean
4.00, maximum 21.45
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -9.90, mean
4.01, maximum 12.56
To also show corresponding color key, enter the above coulombic command and
add key true
> undo
> select /C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> hide sel surfaces
> select /B:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> coulombic sel
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -8.85, mean
4.00, maximum 21.45
To also show corresponding color key, enter the above coulombic command and
add key true
> select /A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> coulombic sel
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -15.50, mean
3.92, maximum 18.48
To also show corresponding color key, enter the above coulombic command and
add key true
> select /C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> show sel atoms
> hide sel atoms
> hide sel cartoons
> show sel cartoons
> nucleotides sel atoms
> style nucleic & sel stick
Changed 0 atom styles
> nucleotides sel atoms
> style nucleic & sel stick
Changed 0 atom styles
> style sel ball
Changed 260 atom styles
> show sel cartoons
> nucleotides sel atoms
> style nucleic & sel stick
Changed 0 atom styles
> show sel atoms
> toolshed show
> select clear
[Repeated 1 time(s)]
> select /C:10@CA
1 atom, 1 residue, 1 model selected
> select clear
[Repeated 2 time(s)]
> select /C:10@NH2
1 atom, 1 residue, 1 model selected
> label (#!1 & sel) text "{0.name} {0.number}{0.insertion_code}"
> label (#!1 & sel) attribute name
> select clear
> select /C:5@CA
1 atom, 1 residue, 1 model selected
> label (#!1 & sel) text "ARG 134"
> ui tool show "Color Actions"
> color sel black target l
> label height 3
> undo
> redo
> label height 1
> label height 1.5
> select clear
> select /C:6@CA
1 atom, 1 residue, 1 model selected
> label (#!1 & sel) text "LYS 135"
> select /C:7@CA
1 atom, 1 residue, 1 model selected
> label (#!1 & sel) text "LYS 136"
> select /C:8@CA
1 atom, 1 residue, 1 model selected
> label (#!1 & sel) text "ARG 137"
> select /C:10
24 atoms, 23 bonds, 1 residue, 1 model selected
> select /C:11
16 atoms, 15 bonds, 1 residue, 1 model selected
> select /C:10
24 atoms, 23 bonds, 1 residue, 1 model selected
> label (#!1 & sel) text ARG139
> select clear
> label height 1.5
> ui tool show "Color Actions"
> color black target l
> sequence chain #1/A
Alignment identifier is 1/A
> ui tool show "Change Chain IDs"
> changechains A H2A
Chain IDs of 130 residues changed
> changechains C MRG15
Proposed chain ID change would produce multiple residues with the samechain-
ID/number/insertion-code combo (MRG15/1/)
> changechains C MRG
Proposed chain ID change would produce multiple residues with the samechain-
ID/number/insertion-code combo (MRG/1/)
> help help:user/tools/changechains.html
> changechains C MRG
Proposed chain ID change would produce multiple residues with the samechain-
ID/number/insertion-code combo (MRG/1/)
> changechains B H2B
No residues specified
> changechains B H2B
No residues specified
> select /A:1-130
Nothing selected
> ui tool show "Change Chain IDs"
> changechains B H2B
No residues specified
Cannot change to an empty ID
[Repeated 1 time(s)]
> select /A:1-130
Nothing selected
> sequence chain #1/A
Chains must have same sequence
> sequence chain #1/A
Chains must have same sequence
> undo
[Repeated 2 time(s)]
> redo
> select /A:1-130
Nothing selected
> sequence chain #1/A
Chains must have same sequence
> ui tool show "Change Chain IDs"
Must select one or more chain IDs from the list on the left
> changechains H2A A
Chain IDs of 130 residues changed
> sequence chain #1/A
Alignment identifier is 1/A
> ui mousemode right "move label"
[Repeated 1 time(s)]
> ui mousemode right select
> ui mousemode right rotate
> ui mousemode right translate
> ui mousemode right rotate
> ui mousemode right translate
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/Image1.tif" width 704 height 533 supersample 3
> ui tool show Contacts
> select /C:10@CA
1 atom, 1 residue, 1 model selected
> select /C:8
24 atoms, 23 bonds, 1 residue, 1 model selected
> select add /C:10
48 atoms, 46 bonds, 2 residues, 2 models selected
> select add /C:7
70 atoms, 67 bonds, 3 residues, 2 models selected
> select add /A:61@CB
71 atoms, 67 bonds, 4 residues, 2 models selected
> select subtract /A:61@CB
70 atoms, 67 bonds, 3 residues, 3 models selected
> select add /C:6
92 atoms, 88 bonds, 4 residues, 2 models selected
> select add /C:5@CA
93 atoms, 88 bonds, 5 residues, 2 models selected
> select subtract /C:5
92 atoms, 88 bonds, 4 residues, 2 models selected
> select add /C:5
116 atoms, 111 bonds, 5 residues, 2 models selected
> style sel stick
Changed 116 atom styles
> show sel cartoons
> hbonds sel reveal true
3 hydrogen bonds found
> hbonds sel reveal true
3 hydrogen bonds found
> undo
> ~hbonds
[Repeated 2 time(s)]
> undo
> hbonds sel reveal true
3 hydrogen bonds found
> ~hbonds
> ui tool show H-Bonds
> hbonds sel interModel false intraModel false saltOnly true intraMol false
> intraRes false reveal true
0 hydrogen bonds found
> select clear
> ~hbonds
[Repeated 5 time(s)]
> select /A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> hide sel surfaces
> select /B:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> hide sel surfaces
> ~hbonds
[Repeated 2 time(s)]
> select /A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> ~hbonds
> select /C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> ~hbonds
[Repeated 1 time(s)]
> select clear
> style stick
Changed 4347 atom styles
> hide cartoons
> show cartoons
> nucleotides atoms
> style nucleic stick
Changed 0 atom styles
> hide atoms
> select /A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> show sel surfaces
> select /B:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> show sel surfaces
> select clear
> select /C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> show sel atoms
> style sel stick
Changed 260 atom styles
> style sel sphere
Changed 260 atom styles
> style sel ball
Changed 260 atom styles
> nucleotides sel atoms
> style nucleic & sel stick
Changed 0 atom styles
> style sel stick
Changed 260 atom styles
> color sel byhetero
> select clear
> select /C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> coulombic sel
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -9.90, mean
4.01, maximum 12.56
To also show corresponding color key, enter the above coulombic command and
add key true
> color sel byhetero
> coulombic sel
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -9.90, mean
4.01, maximum 12.56
To also show corresponding color key, enter the above coulombic command and
add key true
> hide sel surfaces
> color (#!1 & sel) byelement
> undo
> select clear
> select /C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> select clear
> ui tool show Contacts
> contacts intraModel false intraMol false ignoreHiddenModels true
No contacts
> ui tool show H-Bonds
> hbonds interModel false intraModel false saltOnly true intraMol false
> intraRes false reveal true
0 hydrogen bonds found
> ui tool show H-Bonds
> hbonds sel saltOnly true reveal true
Atom specifier selects no atoms
> ui tool show H-Bonds
> hbonds saltOnly true reveal true
14 hydrogen bonds found
> ~hbonds
> select clear
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/Image2.tif" width 704 height 533 supersample 3
> save /Users/Gareth/Desktop/image1.png supersample 3
> ui tool show Matchmaker
> save /Users/Gareth/Desktop/image2.png supersample 3
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/H2AH2B MRGRKK.cxs"
——— End of log from Fri Jan 6 13:28:28 2023 ———
opened ChimeraX session
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> close
> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRFAP1/MRFAP1-MRGBP/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel cornflower blue
> select /B:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> color sel hot pink
> select clear
> select /A:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -25.57, mean
-2.342, maximum 23.27
To also show corresponding color key, enter the above mlp command and add key
true
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> color sel cornflower blue
> select /B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel hot pink
> select /C:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> color sel light sea green
> select clear
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -27.56, mean
-2.658, maximum 22.41
To also show corresponding color key, enter the above mlp command and add key
true
> select clear
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_1.pdb"
Chain information for ranked_1.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> color sel hot pink
> select /B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel medium blue
> select /C:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> color sel forest green
> select clear
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> mlp sel
Map values for surface "ranked_1.pdb_A SES surface": minimum -27.86, mean
-2.711, maximum 24.32
To also show corresponding color key, enter the above mlp command and add key
true
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_2.pdb"
Chain information for ranked_2.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_2.pdb_A SES surface": minimum -26.55, mean
-2.543, maximum 23.83
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel orange
> select clear
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_3.pdb"
Chain information for ranked_3.pdb #2
---
Chain | Description
A | No description available
B | No description available
C | No description available
> close #1
> select #2/A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_3.pdb_A SES surface": minimum -27.31, mean
-2.509, maximum 23.55
To also show corresponding color key, enter the above mlp command and add key
true
> select #2/B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel orange
> close
> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRFAP1/MRFAP1-MRGBP/ranked_1.pdb"
Chain information for ranked_1.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> select /B:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> show sel surfaces
> close
> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRFAP1/MRFAP1-MRGBP/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> select /B:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> show sel surfaces
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> show cartoons
> hide atoms
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> color sel hot pink
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -15.29, mean
4.32, maximum 18.71
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -17.23, mean
3.98, maximum 19.16
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -9.58, mean
5.06, maximum 15.99
Coulombic values for ranked_0.pdb_D SES surface #1.4: minimum, -10.13, mean
4.57, maximum 16.13
Coulombic values for ranked_0.pdb_E SES surface #1.5: minimum, -16.33, mean
2.45, maximum 16.99
Coulombic values for ranked_0.pdb_F SES surface #1.6: minimum, -14.44, mean
2.30, maximum 14.81
Coulombic values for ranked_0.pdb_G SES surface #1.7: minimum, -9.16, mean
5.77, maximum 16.03
Coulombic values for ranked_0.pdb_H SES surface #1.8: minimum, -8.89, mean
5.66, maximum 16.30
To also show corresponding color key, enter the above coulombic command and
add key true
> select clear
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> show sel atoms
> style sel stick
Changed 329 atom styles
> color sel byhetero
> select clear
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/ranked_0.pdb"
Chain information for ranked_0.pdb #2
---
Chain | Description
A | No description available
B | No description available
C | No description available
> ui tool show Matchmaker
> matchmaker #2 to #1
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain B (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 608.6
RMSD between 89 pruned atom pairs is 0.844 angstroms; (across all 130 pairs:
22.712)
> ui tool show Matchmaker
> select /A:1-130
4126 atoms, 4150 bonds, 260 residues, 2 models selected
> ui tool show Matchmaker
> matchmaker #2 to #1/A pairing bs
Parameters
---
Chain pairing | bs
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 591.8
RMSD between 87 pruned atom pairs is 1.118 angstroms; (across all 130 pairs:
21.387)
> select clear
> select #2/C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> color sel orange
> select clear
> select #2/C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> show sel atoms
> color sel byhetero
> close #2
> open 3x1s
3x1s title:
Crystal structure of the nucleosome core particle [more info...]
Chain information for 3x1s #2
---
Chain | Description | UniProt
A E | Histone H3.1 | H31_HUMAN
B F | Histone H4 | H4_HUMAN
C G | Histone H2A type 1-B/E | H2A1B_HUMAN
D H | Histone H2B type 1-B | H2B1B_HUMAN
I J | DNA (146-MER) |
Non-standard residues in 3x1s #2
---
CL — chloride ion
MN — manganese (II) ion
> hide surfaces
> show cartoons
> hide atoms
> ui tool show Matchmaker
> matchmaker #!2 to #1
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain B (#1) with 3x1s, chain G (#2), sequence
alignment score = 568.5
RMSD between 94 pruned atom pairs is 0.976 angstroms; (across all 104 pairs:
1.568)
> select #1/A
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> show sel surfaces
> select #1/B
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> show sel surfaces
> select #1/C
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> show sel surfaces
> select clear
> select #2/C:14-118
810 atoms, 820 bonds, 105 residues, 1 model selected
> show sel surfaces
> hide sel surfaces
> close #2
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_1.pdb"
Chain information for ranked_1.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> show cartoons
> hide atoms
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> color sel yellow
> select clear
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_1.pdb_A SES surface #1.1: minimum, -21.67, mean
4.74, maximum 18.97
Coulombic values for ranked_1.pdb_B SES surface #1.2: minimum, -12.65, mean
4.63, maximum 17.40
Coulombic values for ranked_1.pdb_C SES surface #1.3: minimum, -9.89, mean
5.22, maximum 18.92
Coulombic values for ranked_1.pdb_D SES surface #1.4: minimum, -9.69, mean
5.37, maximum 22.95
Coulombic values for ranked_1.pdb_E SES surface #1.5: minimum, -14.14, mean
2.22, maximum 14.80
Coulombic values for ranked_1.pdb_F SES surface #1.6: minimum, -15.51, mean
2.19, maximum 16.93
Coulombic values for ranked_1.pdb_G SES surface #1.7: minimum, -8.06, mean
7.15, maximum 21.55
Coulombic values for ranked_1.pdb_H SES surface #1.8: minimum, -8.79, mean
6.38, maximum 21.21
To also show corresponding color key, enter the above coulombic command and
add key true
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_2.pdb"
Chain information for ranked_2.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> select clear
> show cartoons
> hide atoms
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_3.pdb"
Chain information for ranked_3.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide atoms
> show cartoons
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_4.pdb"
Chain information for ranked_4.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide atoms
> show cartoons
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_0.pdb" format pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> show cartoons
> hide atoms
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> color sel cornflower blue
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> color sel hot pink
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -15.29, mean
4.32, maximum 18.71
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -17.23, mean
3.98, maximum 19.16
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -9.58, mean
5.06, maximum 15.99
Coulombic values for ranked_0.pdb_D SES surface #1.4: minimum, -10.13, mean
4.57, maximum 16.13
Coulombic values for ranked_0.pdb_E SES surface #1.5: minimum, -16.33, mean
2.45, maximum 16.99
Coulombic values for ranked_0.pdb_F SES surface #1.6: minimum, -14.44, mean
2.30, maximum 14.81
Coulombic values for ranked_0.pdb_G SES surface #1.7: minimum, -9.16, mean
5.77, maximum 16.03
Coulombic values for ranked_0.pdb_H SES surface #1.8: minimum, -8.89, mean
5.66, maximum 16.30
To also show corresponding color key, enter the above coulombic command and
add key true
> select /D:28@CG
1 atom, 1 residue, 1 model selected
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> show sel atoms
> style sel stick
Changed 329 atom styles
> color sel byhetero
> select clear
> select /B:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> select /A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> select /C:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> select /E:1-103
1703 atoms, 1714 bonds, 103 residues, 1 model selected
> select clear
> hide surfaces
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/ranked_0.pdb"
Chain information for ranked_0.pdb #2
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select #2/A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> color sel orange
> select #2/B:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> color sel orange
> select #2/C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> color sel light sea green
> show sel atoms
> color sel byhetero
> select clear
> ui tool show Matchmaker
> matchmaker #2 to #1/A pairing bs
Parameters
---
Chain pairing | bs
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 591.8
RMSD between 87 pruned atom pairs is 1.118 angstroms; (across all 130 pairs:
21.387)
> select clear
> show surfaces
> select #2/A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> hide sel surfaces
> select #2/A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> select #2/B:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> hide sel surfaces
> show sel cartoons
> select clear
> select #2/C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> hide sel surfaces
> select clear
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_I SES surface #1.9: minimum, -12.27, mean
2.58, maximum 12.25
To also show corresponding color key, enter the above coulombic command and
add key true
> hide sel surfaces
> select clear
> open 3x1s
3x1s title:
Crystal structure of the nucleosome core particle [more info...]
Chain information for 3x1s #3
---
Chain | Description | UniProt
A E | Histone H3.1 | H31_HUMAN
B F | Histone H4 | H4_HUMAN
C G | Histone H2A type 1-B/E | H2A1B_HUMAN
D H | Histone H2B type 1-B | H2B1B_HUMAN
I J | DNA (146-MER) |
Non-standard residues in 3x1s #3
---
CL — chloride ion
MN — manganese (II) ion
> show cartoons
> hide atoms
> ui tool show Matchmaker
Traceback (most recent call last):
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/core/triggerset.py", line 134, in invoke
return self._func(self._name, data)
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 50, in <lambda>
data[0] == pself.attr_name and (setattr(pself, "value", pself.get_attribute())
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 342, in set_value
self.__button_group.button(self.values.index(value)).setChecked(True)
AttributeError: 'NoneType' object has no attribute 'setChecked'
Error processing trigger "setting changed":
AttributeError: 'NoneType' object has no attribute 'setChecked'
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 342, in set_value
self.__button_group.button(self.values.index(value)).setChecked(True)
See log for complete Python traceback.
> matchmaker #!3 to #1
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain B (#1) with 3x1s, chain G (#3), sequence
alignment score = 568.5
RMSD between 94 pruned atom pairs is 0.976 angstroms; (across all 104 pairs:
1.568)
> close #3
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer H2AH2B RKK comparison 1.tif" width
> 704 height 533 supersample 3
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer H2AH2B RKK comparison 2.tif" width
> 704 height 533 supersample 3
> select #2/C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> show sel atoms
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> show sel atoms
> select clear
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer H2AH2B RKK comparison 3.tif" width
> 704 height 533 supersample 3
> select #2/C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> hide sel cartoons
> hide sel atoms
> select #1/I:8
24 atoms, 23 bonds, 1 residue, 1 model selected
> select add #1/I:9
46 atoms, 44 bonds, 2 residues, 2 models selected
> select add #1/I:10
68 atoms, 65 bonds, 3 residues, 2 models selected
> select add #1/I:11
92 atoms, 88 bonds, 4 residues, 2 models selected
> select add #1/I:12
102 atoms, 97 bonds, 5 residues, 2 models selected
> select add #1/I:13
126 atoms, 120 bonds, 6 residues, 2 models selected
> label (#!1 & sel) attribute name
> label height 1
> ui tool show "Color Actions"
> color sel black target l
> color sel light gray target l
> color sel dark gray target l
> color sel lime target l
> color sel orange red target l
> color sel yellow target l
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer RKK 1.tif" width 704 height 533
> supersample 3
> select clear
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer RKK 2.tif" width 704 height 533
> supersample 3
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer RKK 3.tif" width 704 height 533
> supersample 3
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer RKK 4.tif" width 704 height 533
> supersample 3
> close
> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRFAP1/MRFAP1-MRGBP/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -25.57, mean
-2.342, maximum 23.27
To also show corresponding color key, enter the above mlp command and add key
true
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -18.85, mean
-3.64, maximum 9.54
To also show corresponding color key, enter the above coulombic command and
add key true
> select /B:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
Alignment identifier is 1/B
> select /B:4
10 atoms, 9 bonds, 1 residue, 1 model selected
> select /B:4-6
41 atoms, 40 bonds, 3 residues, 1 model selected
> select /B:33
14 atoms, 14 bonds, 1 residue, 1 model selected
> select /B:33-42
153 atoms, 155 bonds, 10 residues, 1 model selected
> select /B:74
11 atoms, 10 bonds, 1 residue, 1 model selected
> select /B:74-84
182 atoms, 184 bonds, 11 residues, 1 model selected
> select /B:87-88
34 atoms, 33 bonds, 2 residues, 1 model selected
> select /B:87-95
140 atoms, 140 bonds, 9 residues, 1 model selected
> select /B:109
15 atoms, 14 bonds, 1 residue, 1 model selected
> select /B:109-116
140 atoms, 139 bonds, 8 residues, 1 model selected
> select /B:53
24 atoms, 23 bonds, 1 residue, 1 model selected
> select /B:53-68
283 atoms, 286 bonds, 16 residues, 1 model selected
> show sel atoms
> nucleotides sel atoms
> style nucleic & sel stick
Changed 0 atom styles
> select /B:105
20 atoms, 20 bonds, 1 residue, 1 model selected
> select /B:105-108
69 atoms, 70 bonds, 4 residues, 1 model selected
> show sel atoms
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-BRD8/ranked_2.pdb"
Chain information for ranked_2.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_2.pdb_A SES surface": minimum -26.17, mean
-2.868, maximum 26.88
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel cornflower blue
Alignment identifier is 1/B
> select /B:28
19 atoms, 18 bonds, 1 residue, 1 model selected
> select /B:28-29
38 atoms, 37 bonds, 2 residues, 1 model selected
> select /B:27
20 atoms, 20 bonds, 1 residue, 1 model selected
> select /B:27-30
72 atoms, 73 bonds, 4 residues, 1 model selected
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-BRD8/ranked_1.pdb"
Chain information for ranked_1.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /C:1-169
2723 atoms, 2753 bonds, 169 residues, 1 model selected
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_1.pdb_A SES surface": minimum -26.28, mean
-2.805, maximum 23.27
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel cornflower blue
Alignment identifier is 1/B
> select /B:27
20 atoms, 20 bonds, 1 residue, 1 model selected
> select /B:27-31
88 atoms, 89 bonds, 5 residues, 1 model selected
> select /B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_1.pdb_B SES surface #1.2: minimum, -19.57, mean
-3.44, maximum 10.58
To also show corresponding color key, enter the above coulombic command and
add key true
> select /C:1-169
2723 atoms, 2753 bonds, 169 residues, 1 model selected
> show sel surfaces
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-BRD8/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -25.69, mean
-2.822, maximum 22.88
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel cornflower blue
> select clear
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-Dimer + 2 AI
> Chromo/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -26.23, mean
-2.904, maximum 24.13
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_B SES surface": minimum -25.68, mean
-3.058, maximum 24.88
To also show corresponding color key, enter the above mlp command and add key
true
> select clear
> select /D:74
20 atoms, 20 bonds, 1 residue, 1 model selected
> select /D:75
14 atoms, 14 bonds, 1 residue, 1 model selected
> select /D:76
16 atoms, 15 bonds, 1 residue, 1 model selected
> select /D:77
14 atoms, 14 bonds, 1 residue, 1 model selected
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-Dimer-
> AIChromo/MRGDimer-Chromo.pdb"
Chain information for MRGDimer-Chromo.pdb #1
---
Chain | Description
A B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "MRGDimer-Chromo.pdb_A SES surface": minimum -26.93,
mean -2.801, maximum 25.03
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> mlp sel
Map values for surface "MRGDimer-Chromo.pdb_B SES surface": minimum -25.16,
mean -2.832, maximum 22.62
To also show corresponding color key, enter the above mlp command and add key
true
> close
> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRFAP1/MRFAP1-MRGBP/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_4.pdb"
Chain information for ranked_4.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_3.pdb"
Chain information for ranked_3.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_2.pdb"
Chain information for ranked_2.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> mlp sel
Map values for surface "ranked_2.pdb_A SES surface": minimum -26.55, mean
-2.543, maximum 23.83
To also show corresponding color key, enter the above mlp command and add key
true
> select clear
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_1.pdb"
Chain information for ranked_1.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> mlp sel
Map values for surface "ranked_1.pdb_A SES surface": minimum -27.86, mean
-2.711, maximum 24.32
To also show corresponding color key, enter the above mlp command and add key
true
> select clear
> select /B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel cornflower blue
> select clear
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_0.pdb"
Chain information for ranked_0.pdb #2
---
Chain | Description
A | No description available
B | No description available
C | No description available
> ui tool show Matchmaker
> matchmaker #2 to #1
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_1.pdb, chain C (#1) with ranked_0.pdb, chain C (#2),
sequence alignment score = 1009.7
RMSD between 115 pruned atom pairs is 0.680 angstroms; (across all 204 pairs:
18.787)
> select #2/B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel hot pink
> select clear
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-BRD8/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -25.69, mean
-2.822, maximum 22.88
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel cornflower blue
Alignment identifier is 1/B
> select /B:27
20 atoms, 20 bonds, 1 residue, 1 model selected
> select /B:27-30
72 atoms, 73 bonds, 4 residues, 1 model selected
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-BRD8/ranked_1.pdb"
Chain information for ranked_1.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> mlp sel
Map values for surface "ranked_1.pdb_A SES surface": minimum -26.28, mean
-2.805, maximum 23.27
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
Alignment identifier is 1/B
> color sel cornflower blue
> select clear
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1/ranked_0.pdb"
Chain information for ranked_0.pdb #2
---
Chain | Description
A | No description available
B | No description available
> select #2/A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> color sel orange
> select #2/B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel hot pink
> ui tool show Matchmaker
> matchmaker #!1 to #2/A pairing bs
Parameters
---
Chain pairing | bs
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain A (#2) with ranked_1.pdb, chain A (#1),
sequence alignment score = 846.6
RMSD between 152 pruned atom pairs is 0.674 angstroms; (across all 168 pairs:
1.074)
> select clear
> select #2/B:27
20 atoms, 20 bonds, 1 residue, 1 model selected
> select add #1/B:27
40 atoms, 40 bonds, 2 residues, 2 models selected
> select add #2/B:28
59 atoms, 58 bonds, 3 residues, 2 models selected
> select add #1/B:28
78 atoms, 76 bonds, 4 residues, 2 models selected
> select add #2/B:29
97 atoms, 94 bonds, 5 residues, 2 models selected
> select add #2/B:30
111 atoms, 108 bonds, 6 residues, 2 models selected
> select add #1/B:29
130 atoms, 126 bonds, 7 residues, 2 models selected
> select add #1/B:30
144 atoms, 140 bonds, 8 residues, 2 models selected
> show sel atoms
> color sel byhetero
> select #1/A:2@CE
1 atom, 1 residue, 1 model selected
> select clear
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide atoms
> show cartoons
> color cornflower blue
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> color sel orange
> select clear
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #2
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide cartoons
> hide atoms
> show cartoons
> ui tool show Matchmaker
> matchmaker #2 to #1
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain C (#1) with ranked_0.pdb, chain D (#2),
sequence alignment score = 627.4
RMSD between 105 pruned atom pairs is 0.661 angstroms; (across all 126 pairs:
1.964)
> select #2/A
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> color sel hot pink
> select #2/B
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> color sel hot pink
> select #2/C
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> color sel hot pink
> select #2/D
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> color sel hot pink
> select #2/E
1703 atoms, 1714 bonds, 103 residues, 1 model selected
> color sel hot pink
> select #2/F
1703 atoms, 1714 bonds, 103 residues, 1 model selected
> color sel hot pink
[Repeated 1 time(s)]
> select #2/H
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> color sel hot pink
> select #2/H
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> select clear
> select #2/G
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> color sel hot pink
> select clear
> select #2/I
329 atoms, 332 bonds, 20 residues, 1 model selected
> color sel yellow
> select clear
> ui tool show Matchmaker
Traceback (most recent call last):
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/core/triggerset.py", line 134, in invoke
return self._func(self._name, data)
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 50, in <lambda>
data[0] == pself.attr_name and (setattr(pself, "value", pself.get_attribute())
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 342, in set_value
self.__button_group.button(self.values.index(value)).setChecked(True)
AttributeError: 'NoneType' object has no attribute 'setChecked'
Error processing trigger "setting changed":
AttributeError: 'NoneType' object has no attribute 'setChecked'
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 342, in set_value
self.__button_group.button(self.values.index(value)).setChecked(True)
See log for complete Python traceback.
> matchmaker #2 to #1/I pairing bs
Parameters
---
Chain pairing | bs
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain I (#1) with ranked_0.pdb, chain I (#2),
sequence alignment score = 86.8
RMSD between 15 pruned atom pairs is 1.213 angstroms; (across all 20 pairs:
1.970)
> ui tool show H-Bonds
> ui tool show Matchmaker
> matchmaker #2/A to #1/A pairing ss
Parameters
---
Chain pairing | ss
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 626
RMSD between 111 pruned atom pairs is 0.786 angstroms; (across all 130 pairs:
1.652)
> show surfaces
> coulombic
Using Amber 20 recommended default charges and atom types for standard
residues
[Repeated 1 time(s)]Coulombic values for ranked_0.pdb_A SES surface #1.1:
minimum, -15.29, mean 4.32, maximum 18.71
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -17.23, mean
3.98, maximum 19.16
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -9.58, mean
5.06, maximum 15.99
Coulombic values for ranked_0.pdb_D SES surface #1.4: minimum, -10.13, mean
4.57, maximum 16.13
Coulombic values for ranked_0.pdb_E SES surface #1.5: minimum, -16.33, mean
2.45, maximum 16.99
Coulombic values for ranked_0.pdb_F SES surface #1.6: minimum, -14.44, mean
2.30, maximum 14.81
Coulombic values for ranked_0.pdb_G SES surface #1.7: minimum, -9.16, mean
5.77, maximum 16.03
Coulombic values for ranked_0.pdb_H SES surface #1.8: minimum, -8.89, mean
5.66, maximum 16.30
Coulombic values for ranked_0.pdb_I SES surface #1.9: minimum, -12.27, mean
2.58, maximum 12.25
Coulombic values for ranked_0.pdb_A SES surface #2.1: minimum, -17.25, mean
4.62, maximum 19.62
Coulombic values for ranked_0.pdb_B SES surface #2.2: minimum, -16.67, mean
4.25, maximum 21.71
Coulombic values for ranked_0.pdb_C SES surface #2.3: minimum, -10.17, mean
5.19, maximum 16.79
Coulombic values for ranked_0.pdb_D SES surface #2.4: minimum, -10.16, mean
5.01, maximum 16.53
Coulombic values for ranked_0.pdb_E SES surface #2.5: minimum, -16.57, mean
2.42, maximum 12.88
Coulombic values for ranked_0.pdb_F SES surface #2.6: minimum, -16.19, mean
2.43, maximum 13.05
Coulombic values for ranked_0.pdb_G SES surface #2.7: minimum, -7.63, mean
6.00, maximum 17.63
Coulombic values for ranked_0.pdb_H SES surface #2.8: minimum, -8.32, mean
5.87, maximum 24.96
Coulombic values for ranked_0.pdb_I SES surface #2.9: minimum, -11.73, mean
2.88, maximum 15.96
To also show corresponding color key, enter the above coulombic command and
add key true
> select #2/I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> hide sel surfaces
> show sel atoms
> color sel byhetero
> style sel stick
Changed 329 atom styles
> select /I:1-20
658 atoms, 664 bonds, 40 residues, 2 models selected
> hide sel surfaces
> show sel atoms
> style sel stick
Changed 658 atom styles
> color sel byhetero
> select clear
> close #1
> hide surfaces
> open 3x1s
3x1s title:
Crystal structure of the nucleosome core particle [more info...]
Chain information for 3x1s #1
---
Chain | Description | UniProt
A E | Histone H3.1 | H31_HUMAN
B F | Histone H4 | H4_HUMAN
C G | Histone H2A type 1-B/E | H2A1B_HUMAN
D H | Histone H2B type 1-B | H2B1B_HUMAN
I J | DNA (146-MER) |
Non-standard residues in 3x1s #1
---
CL — chloride ion
MN — manganese (II) ion
> hide cartoons
> hide atoms
> show cartoons
> ui tool show Matchmaker
> matchmaker #!1 to #2
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain C (#2) with 3x1s, chain D (#1), sequence
alignment score = 565.1
RMSD between 83 pruned atom pairs is 1.259 angstroms; (across all 94 pairs:
2.166)
> show surfaces
> hide surfaces
> close #1
> open 1kx5
Summary of feedback from opening 1kx5 fetched from pdb
---
note | Fetching compressed mmCIF 1kx5 from
http://files.rcsb.org/download/1kx5.cif
1kx5 title:
X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution
[more info...]
Chain information for 1kx5 #1
---
Chain | Description | UniProt
A E | histone H3 | H32_BOVIN
B F | histone H4 | H4_HUMANX
C G | histone H2A.1 | H2A1_XENLA
D H | histone H2B.2 | H2B1_XENLA
I | DNA
(5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')
|
J | DNA
(5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')
|
Non-standard residues in 1kx5 #1
---
CL — chloride ion
MN — manganese (II) ion
> select :CL
4 atoms, 4 residues, 1 model selected
> select :CL
4 atoms, 4 residues, 1 model selected
> select :MN
14 atoms, 14 residues, 1 model selected
> select :CL
4 atoms, 4 residues, 1 model selected
> select clear
Drag select of 3 residues, 16753 atoms, 410 pseudobonds
> color (#!1-2 & sel) cornflower blue
> hide sel atoms
> show sel cartoons
> select clear
> ui tool show Matchmaker
> matchmaker #!2 to #1
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker 1kx5, chain G (#1) with ranked_0.pdb, chain A (#2), sequence
alignment score = 535.6
RMSD between 77 pruned atom pairs is 1.313 angstroms; (across all 128 pairs:
7.017)
> close
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -25.35, mean
-2.756, maximum 24.2
To also show corresponding color key, enter the above mlp command and add key
true
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-BRD8/ranked_0.pdb"
Chain information for ranked_0.pdb #2
---
Chain | Description
A | No description available
B | No description available
C | No description available
> ui tool show Matchmaker
> matchmaker #2 to #1/A pairing bs
Parameters
---
Chain pairing | bs
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 875.4
RMSD between 168 pruned atom pairs is 0.344 angstroms; (across all 168 pairs:
0.344)
> select /B:1-127
4084 atoms, 4106 bonds, 254 residues, 2 models selected
> color sel cornflower blue
> select clear
> select #2/B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel orange
> select clear
> close #2
> select #2/A:1-168
Nothing selected
> select /B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -17.71, mean
-3.38, maximum 17.10
To also show corresponding color key, enter the above coulombic command and
add key true
> select #2/C:1-169
Nothing selected
> select #2/C:1-169
Nothing selected
> select /C:1-169
2723 atoms, 2753 bonds, 169 residues, 1 model selected
Alignment identifier is 1/C
> select /C:7-8
34 atoms, 34 bonds, 2 residues, 1 model selected
> select /C:7-11
90 atoms, 90 bonds, 5 residues, 1 model selected
> select /C:84
19 atoms, 18 bonds, 1 residue, 1 model selected
> select /C:84-92
153 atoms, 152 bonds, 9 residues, 1 model selected
> select /C:74
21 atoms, 21 bonds, 1 residue, 1 model selected
> select /C:74-77
71 atoms, 71 bonds, 4 residues, 1 model selected
> select /C:101
17 atoms, 16 bonds, 1 residue, 1 model selected
> select /C:101-116
279 atoms, 281 bonds, 16 residues, 1 model selected
> select /C:99
17 atoms, 16 bonds, 1 residue, 1 model selected
> select /C:99-116
306 atoms, 308 bonds, 18 residues, 1 model selected
> show sel atoms
> select clear
> select /B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> hide sel surfaces
> select clear
> select /B:27
20 atoms, 20 bonds, 1 residue, 1 model selected
> show sel atoms
> select /B:28
19 atoms, 18 bonds, 1 residue, 1 model selected
> show sel atoms
> select /B:29
19 atoms, 18 bonds, 1 residue, 1 model selected
> show sel atoms
> select /B:24
20 atoms, 20 bonds, 1 residue, 1 model selected
> show sel atoms
> close
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel cornflower blue
> select /B:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> color sel hot pink
> select clear
> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRFAP1/MRFAP1-MRGBP/ranked_0.pdb"
Chain information for ranked_0.pdb #2
---
Chain | Description
A | No description available
B | No description available
> ui tool show Matchmaker
> matchmaker #2 to #1
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain B (#1) with ranked_0.pdb, chain B (#2),
sequence alignment score = 970.1
RMSD between 102 pruned atom pairs is 0.694 angstroms; (across all 204 pairs:
12.546)
> close
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -27.67, mean
-2.586, maximum 24.72
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> select clear
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_0.pdb"
Chain information for ranked_0.pdb #2
---
Chain | Description
A | No description available
B | No description available
C | No description available
> ui tool show Matchmaker
> matchmaker #2 to #1/A pairing bs
Parameters
---
Chain pairing | bs
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 873.6
RMSD between 166 pruned atom pairs is 0.254 angstroms; (across all 168 pairs:
0.367)
> select #2/C:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> color sel hot pink
> select clear
> close
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide atoms
> show cartoons
> select /I:1-323
5271 atoms, 5335 bonds, 323 residues, 1 model selected
> color sel cornflower blue
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -16.17, mean
4.46, maximum 19.51
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -13.65, mean
4.36, maximum 19.24
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -10.36, mean
4.80, maximum 16.39
Coulombic values for ranked_0.pdb_D SES surface #1.4: minimum, -10.42, mean
4.86, maximum 17.37
Coulombic values for ranked_0.pdb_E SES surface #1.5: minimum, -14.07, mean
2.28, maximum 12.93
Coulombic values for ranked_0.pdb_F SES surface #1.6: minimum, -13.53, mean
2.26, maximum 12.79
Coulombic values for ranked_0.pdb_G SES surface #1.7: minimum, -8.63, mean
5.55, maximum 16.43
Coulombic values for ranked_0.pdb_H SES surface #1.8: minimum, -8.19, mean
5.67, maximum 15.08
To also show corresponding color key, enter the above coulombic command and
add key true
> select clear
> select /I:1-323
5271 atoms, 5335 bonds, 323 residues, 1 model selected
Alignment identifier is 1/I
> select /I:113
14 atoms, 13 bonds, 1 residue, 1 model selected
> select /I:113-116
75 atoms, 74 bonds, 4 residues, 1 model selected
> select /I:132
14 atoms, 14 bonds, 1 residue, 1 model selected
> select /I:132-139
154 atoms, 155 bonds, 8 residues, 1 model selected
> select /I:111
22 atoms, 21 bonds, 1 residue, 1 model selected
> select /I:111-115
97 atoms, 96 bonds, 5 residues, 1 model selected
> select /I:93-94
24 atoms, 24 bonds, 2 residues, 1 model selected
> select /I:93-99
100 atoms, 100 bonds, 7 residues, 1 model selected
> select /I:106-107
31 atoms, 30 bonds, 2 residues, 1 model selected
> select /I:106-118
230 atoms, 230 bonds, 13 residues, 1 model selected
> open 1kx5
1kx5 title:
X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution
[more info...]
Chain information for 1kx5 #2
---
Chain | Description | UniProt
A E | histone H3 | H32_BOVIN
B F | histone H4 | H4_HUMANX
C G | histone H2A.1 | H2A1_XENLA
D H | histone H2B.2 | H2B1_XENLA
I | DNA
(5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')
|
J | DNA
(5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')
|
Non-standard residues in 1kx5 #2
---
CL — chloride ion
MN — manganese (II) ion
> hide sel atoms
[Repeated 1 time(s)]
> show sel cartoons
[Repeated 1 time(s)]
> sequence chain #2/A#2/E
Alignment identifier is 1
> select #2/A:1-135
1074 atoms, 1088 bonds, 135 residues, 1 model selected
> hide sel atoms
> show sel cartoons
> select #2/E:1-135
1074 atoms, 1088 bonds, 135 residues, 1 model selected
> hide sel atoms
> show sel cartoons
> select #2/B:1-102
792 atoms, 800 bonds, 102 residues, 1 model selected
> hide sel atoms
> show sel cartoons
> select #2/F:1-102
792 atoms, 800 bonds, 102 residues, 1 model selected
> hide sel atoms
> show sel cartoons
> select #2/C:1-128
978 atoms, 988 bonds, 128 residues, 1 model selected
> hide sel atoms
> show sel cartoons
> select #2/G:1-128
978 atoms, 988 bonds, 128 residues, 1 model selected
> hide sel atoms
> show sel cartoons
> select #2/D:1-122
949 atoms, 962 bonds, 122 residues, 1 model selected
> hide sel atoms
> show sel cartoons
> select :MN
14 atoms, 14 residues, 1 model selected
> hide sel atoms
> hide sel cartoons
> select :CL
4 atoms, 4 residues, 1 model selected
> hide sel atoms
> hide sel cartoons
> select #2/D:1-122
949 atoms, 962 bonds, 122 residues, 1 model selected
> select #2/H:1-122
949 atoms, 962 bonds, 122 residues, 1 model selected
> hide sel atoms
> show sel cartoons
> select #2/D:1-122
949 atoms, 962 bonds, 122 residues, 1 model selected
> hide sel atoms
> show sel cartoons
> select #2/I:-73-73
3011 atoms, 3378 bonds, 147 residues, 1 model selected
> hide sel atoms
> show sel cartoons
> select #2/J:-73-73
3010 atoms, 3376 bonds, 147 residues, 1 model selected
> hide sel atoms
> show sel cartoons
> select clear
> select ::name="CL"::name="HOH"::name="MN"
3148 atoms, 55 pseudobonds, 3148 residues, 2 models selected
> hide sel atoms
> ui tool show Matchmaker
> matchmaker #!2 to #1/A pairing bs
Parameters
---
Chain pairing | bs
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain A (#1) with 1kx5, chain G (#2), sequence
alignment score = 532.6
RMSD between 95 pruned atom pairs is 0.824 angstroms; (across all 128 pairs:
6.767)
> hide sel surfaces
[Repeated 1 time(s)]Drag select of ranked_0.pdb_A SES surface, ranked_0.pdb_B
SES surface, ranked_0.pdb_C SES surface, ranked_0.pdb_D SES surface,
ranked_0.pdb_E SES surface, ranked_0.pdb_F SES surface, ranked_0.pdb_G SES
surface, ranked_0.pdb_H SES surface, 2515 residues
> hide sel surfaces
> select clear
> show cartoons
> close #2
> select /I:1-323
5271 atoms, 5335 bonds, 323 residues, 1 model selected
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> color (#!1 & sel) hot pink
> show sel surfaces
> coulombic sel
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -16.17, mean
4.46, maximum 19.51
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -13.65, mean
4.36, maximum 19.24
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -10.36, mean
4.80, maximum 16.39
Coulombic values for ranked_0.pdb_D SES surface #1.4: minimum, -10.42, mean
4.86, maximum 17.37
Coulombic values for ranked_0.pdb_E SES surface #1.5: minimum, -14.07, mean
2.28, maximum 12.93
Coulombic values for ranked_0.pdb_F SES surface #1.6: minimum, -13.53, mean
2.26, maximum 12.79
Coulombic values for ranked_0.pdb_G SES surface #1.7: minimum, -8.63, mean
5.55, maximum 16.43
Coulombic values for ranked_0.pdb_H SES surface #1.8: minimum, -8.19, mean
5.67, maximum 15.08
To also show corresponding color key, enter the above coulombic command and
add key true
> select clear
> close
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel cornflower blue
> select /B:1-198
3031 atoms, 3066 bonds, 198 residues, 1 model selected
> color sel hot pink
> select clear
> select /A:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -27.67, mean
-2.552, maximum 24.45
To also show corresponding color key, enter the above mlp command and add key
true
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -29.80, mean
-3.95, maximum 10.63
To also show corresponding color key, enter the above coulombic command and
add key true
> close
> open /Users/Gareth/Documents/ranked_1.pdb
Chain information for ranked_1.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_1.pdb_A SES surface #1.1: minimum, -19.24, mean
-4.27, maximum 9.24
To also show corresponding color key, enter the above coulombic command and
add key true
> close
> open /Users/Gareth/Documents/ranked_2.pdb
Chain information for ranked_2.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> show sel surfaces
> hide sel surfaces
> close
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /B:1-198
3031 atoms, 3066 bonds, 198 residues, 1 model selected
Alignment identifier is 1/B
> select /B:5
24 atoms, 23 bonds, 1 residue, 1 model selected
> select /B:5-13
127 atoms, 127 bonds, 9 residues, 1 model selected
> select /B:51
12 atoms, 11 bonds, 1 residue, 1 model selected
> select /B:51-59
143 atoms, 142 bonds, 9 residues, 1 model selected
> select /B:61-62
34 atoms, 34 bonds, 2 residues, 1 model selected
> select /B:61-65
83 atoms, 84 bonds, 5 residues, 1 model selected
> select /B:45
19 atoms, 18 bonds, 1 residue, 1 model selected
> select /B:45-59
251 atoms, 251 bonds, 15 residues, 1 model selected
> select /B:41
19 atoms, 18 bonds, 1 residue, 1 model selected
> select /B:41-68
480 atoms, 485 bonds, 28 residues, 1 model selected
> select /B:30
24 atoms, 23 bonds, 1 residue, 1 model selected
> select /B:30-88
982 atoms, 997 bonds, 59 residues, 1 model selected
> select /B:1
19 atoms, 18 bonds, 1 residue, 1 model selected
> select /B:1-29
430 atoms, 433 bonds, 29 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select /B:89
21 atoms, 21 bonds, 1 residue, 1 model selected
> select /B:89-198
1619 atoms, 1634 bonds, 110 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select /B:1-198
982 atoms, 997 bonds, 59 residues, 1 model selected
> color sel hot pink
> select /A:1-127
2042 atoms, 2053 bonds, 127 residues, 1 model selected
> color sel cornflower blue
> show sel surfaces
> close
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> close
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> color sel hot pink
> select clear
> select /A:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
Alignment identifier is 1/A
> select /A:168
19 atoms, 18 bonds, 1 residue, 1 model selected
> select /A:168-170
37 atoms, 36 bonds, 3 residues, 1 model selected
> select /A:104
14 atoms, 13 bonds, 1 residue, 1 model selected
> select /A:104-110
113 atoms, 114 bonds, 7 residues, 1 model selected
> select /A:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> show sel surfaces
> select clear
> select /B:1-169
2723 atoms, 2753 bonds, 169 residues, 1 model selected
Alignment identifier is 1/B
> select clear
> select /B:99
17 atoms, 16 bonds, 1 residue, 1 model selected
> select /B:99-116
306 atoms, 308 bonds, 18 residues, 1 model selected
> show sel atoms
> select /A:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -27.01, mean
-4.49, maximum 23.98
To also show corresponding color key, enter the above mlp command and add key
true
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -20.86, mean
-1.03, maximum 10.53
To also show corresponding color key, enter the above coulombic command and
add key true
> select clear
> close
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -25.45, mean
-2.812, maximum 24.26
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-364
5612 atoms, 5673 bonds, 364 residues, 1 model selected
Alignment identifier is 1/B
> select /B:321
20 atoms, 20 bonds, 1 residue, 1 model selected
> select /B:321-324
69 atoms, 70 bonds, 4 residues, 1 model selected
> show sel atoms
> select /B:269-270
31 atoms, 32 bonds, 2 residues, 1 model selected
> select /B:269-284
233 atoms, 239 bonds, 16 residues, 1 model selected
> show sel atoms
> close
> open /Users/Gareth/Documents/ranked_1.pdb
Chain information for ranked_1.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> mlp sel
Map values for surface "ranked_1.pdb_A SES surface": minimum -25.58, mean
-2.936, maximum 24.61
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-364
5612 atoms, 5673 bonds, 364 residues, 1 model selected
Alignment identifier is 1/B
> select /B:259
17 atoms, 16 bonds, 1 residue, 1 model selected
> select /B:259-315
830 atoms, 844 bonds, 57 residues, 1 model selected
> select /B:321
20 atoms, 20 bonds, 1 residue, 1 model selected
> select /B:321-325
84 atoms, 85 bonds, 5 residues, 1 model selected
> close
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -25.45, mean
-2.812, maximum 24.26
To also show corresponding color key, enter the above mlp command and add key
true
> select clear
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGBP/MRGBP-
> BRD8/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> close
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -25.45, mean
-2.812, maximum 24.26
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-364
5612 atoms, 5673 bonds, 364 residues, 1 model selected
Alignment identifier is 1/B
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> HNRPU/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -27.18, mean
-1.674, maximum 25.48
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-825
12459 atoms, 12583 bonds, 825 residues, 1 model selected
Alignment identifier is 1/B
> select /B:640
20 atoms, 20 bonds, 1 residue, 1 model selected
> select /B:640-643
67 atoms, 68 bonds, 4 residues, 1 model selected
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> HNRPU/ranked_1.pdb"
Chain information for ranked_1.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_1.pdb_A SES surface": minimum -29.07, mean
-2.496, maximum 27.08
To also show corresponding color key, enter the above mlp command and add key
true
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide atoms
> show cartoons
> select /I:1-20
343 atoms, 343 bonds, 20 residues, 1 model selected
> color sel yellow
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> color sel cornflower blue
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -15.47, mean
3.94, maximum 17.14
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -14.98, mean
3.84, maximum 18.15
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -10.27, mean
4.76, maximum 16.75
Coulombic values for ranked_0.pdb_D SES surface #1.4: minimum, -10.23, mean
4.46, maximum 15.94
Coulombic values for ranked_0.pdb_E SES surface #1.5: minimum, -12.99, mean
2.30, maximum 14.71
Coulombic values for ranked_0.pdb_F SES surface #1.6: minimum, -19.28, mean
2.25, maximum 13.65
Coulombic values for ranked_0.pdb_G SES surface #1.7: minimum, -8.87, mean
5.22, maximum 15.87
Coulombic values for ranked_0.pdb_H SES surface #1.8: minimum, -8.85, mean
5.14, maximum 27.95
To also show corresponding color key, enter the above coulombic command and
add key true
> select clear
> select /I:1-20
343 atoms, 343 bonds, 20 residues, 1 model selected
> show sel atoms
> style sel stick
Changed 343 atom styles
> color sel byhetero
> select /E:21@NE
1 atom, 1 residue, 1 model selected
> select clear
> hide surfaces
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_0.pdb"
Chain information for ranked_0.pdb #2
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide atoms
> show cartoons
> select #2/A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> color sel hot pink
> select #2/B:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> color sel hot pink
> select #2/C:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> color sel hot pink
> select #2/D:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> color sel hot pink
> select #2/E:1-103
1703 atoms, 1714 bonds, 103 residues, 1 model selected
> color sel hot pink
> select #2/F:1-103
1703 atoms, 1714 bonds, 103 residues, 1 model selected
> color sel hot pink
> select #2/F:1-103
1703 atoms, 1714 bonds, 103 residues, 1 model selected
> select #2/G:1-103
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> color sel hot pink
> select #2/H:1-103
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> color sel hot pink
> select #2/I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> color sel light sea green
> ui tool show "Color Actions"
> color sel orange red target l
[Repeated 2 time(s)]
> color sel orange red
> select clear
> select #2/I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> color sel cyan
> select clear
> select #2/I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> color sel forest green
> select clear
> ui tool show Matchmaker
> matchmaker #2/A to #1/A pairing ss
Parameters
---
Chain pairing | ss
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 603.2
RMSD between 94 pruned atom pairs is 0.866 angstroms; (across all 130 pairs:
3.895)
> select #1/A
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> show sel surfaces
> hide sel surfaces
> select #2/A
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_A SES surface #2.1: minimum, -15.29, mean
4.32, maximum 18.71
To also show corresponding color key, enter the above coulombic command and
add key true
> select #2/B
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_B SES surface #2.2: minimum, -17.23, mean
3.98, maximum 19.16
To also show corresponding color key, enter the above coulombic command and
add key true
> select #2/C
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_C SES surface #2.3: minimum, -9.58, mean
5.06, maximum 15.99
To also show corresponding color key, enter the above coulombic command and
add key true
> select #2/D
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_D SES surface #2.4: minimum, -10.13, mean
4.57, maximum 16.13
To also show corresponding color key, enter the above coulombic command and
add key true
> select #2/E
1703 atoms, 1714 bonds, 103 residues, 1 model selected
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_E SES surface #2.5: minimum, -16.33, mean
2.45, maximum 16.99
To also show corresponding color key, enter the above coulombic command and
add key true
> select #2/F
1703 atoms, 1714 bonds, 103 residues, 1 model selected
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_F SES surface #2.6: minimum, -14.44, mean
2.30, maximum 14.81
To also show corresponding color key, enter the above coulombic command and
add key true
> select #2/H
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_H SES surface #2.7: minimum, -8.89, mean
5.66, maximum 16.30
To also show corresponding color key, enter the above coulombic command and
add key true
> select clear
> select #2/H
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> select #2/G
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_G SES surface #2.8: minimum, -9.16, mean
5.77, maximum 16.03
To also show corresponding color key, enter the above coulombic command and
add key true
> select clear
> select #1/I
343 atoms, 343 bonds, 20 residues, 1 model selected
> show sel atoms
> select #2/I
329 atoms, 332 bonds, 20 residues, 1 model selected
> show sel atoms
> color sel byhetero
> style sel stick
Changed 329 atom styles
> color sel cyan
> color sel byhetero
> select clear
> select #2/C
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> select #2/G
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> select clear
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/comparison with RKK 1.tif" width 704 height 533
> supersample 3
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/comparison with RKK 2.tif" width 704 height 533
> supersample 3
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/comparison with RKK 3.tif" width 704 height 533
> supersample 3
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/Histone-Octamer-RKK-KTKK.cxs"
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/ranked_1.pdb"
Chain information for ranked_1.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide atoms
> show cartoons
> select /I:1-20
343 atoms, 343 bonds, 20 residues, 1 model selected
> show sel atoms
> style sel stick
Changed 343 atom styles
> color sel byhetero
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_1.pdb_A SES surface #1.1: minimum, -20.91, mean
3.63, maximum 16.26
Coulombic values for ranked_1.pdb_B SES surface #1.2: minimum, -13.26, mean
3.65, maximum 18.85
Coulombic values for ranked_1.pdb_C SES surface #1.3: minimum, -10.67, mean
4.28, maximum 15.64
Coulombic values for ranked_1.pdb_D SES surface #1.4: minimum, -11.50, mean
3.84, maximum 13.94
Coulombic values for ranked_1.pdb_E SES surface #1.5: minimum, -12.92, mean
2.00, maximum 12.92
Coulombic values for ranked_1.pdb_F SES surface #1.6: minimum, -15.93, mean
2.06, maximum 15.18
Coulombic values for ranked_1.pdb_G SES surface #1.7: minimum, -9.30, mean
4.54, maximum 14.73
Coulombic values for ranked_1.pdb_H SES surface #1.8: minimum, -9.19, mean
4.60, maximum 16.14
To also show corresponding color key, enter the above coulombic command and
add key true
> select clear
> select /C
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> select /G
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_1.pdb"
Chain information for ranked_1.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide atoms
> show cartoons
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> show sel atoms
> color sel byhetero
> style sel stick
Changed 329 atom styles
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_1.pdb_A SES surface #1.1: minimum, -21.67, mean
4.74, maximum 18.97
Coulombic values for ranked_1.pdb_B SES surface #1.2: minimum, -12.65, mean
4.63, maximum 17.40
Coulombic values for ranked_1.pdb_C SES surface #1.3: minimum, -9.89, mean
5.22, maximum 18.92
Coulombic values for ranked_1.pdb_D SES surface #1.4: minimum, -9.69, mean
5.37, maximum 22.95
Coulombic values for ranked_1.pdb_E SES surface #1.5: minimum, -14.14, mean
2.22, maximum 14.80
Coulombic values for ranked_1.pdb_F SES surface #1.6: minimum, -15.51, mean
2.19, maximum 16.93
Coulombic values for ranked_1.pdb_G SES surface #1.7: minimum, -8.06, mean
7.15, maximum 21.55
Coulombic values for ranked_1.pdb_H SES surface #1.8: minimum, -8.79, mean
6.38, maximum 21.21
To also show corresponding color key, enter the above coulombic command and
add key true
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/ranked_2.pdb"
Chain information for ranked_2.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide atoms
> show cartoons
> select /I:1-20
343 atoms, 343 bonds, 20 residues, 1 model selected
> show sel atoms
> style sel stick
Changed 343 atom styles
> color sel byhetero
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_2.pdb_A SES surface #1.1: minimum, -18.56, mean
4.77, maximum 19.89
Coulombic values for ranked_2.pdb_B SES surface #1.2: minimum, -13.98, mean
4.51, maximum 17.22
Coulombic values for ranked_2.pdb_C SES surface #1.3: minimum, -10.01, mean
5.64, maximum 22.21
Coulombic values for ranked_2.pdb_D SES surface #1.4: minimum, -10.50, mean
5.23, maximum 19.20
Coulombic values for ranked_2.pdb_E SES surface #1.5: minimum, -15.11, mean
2.14, maximum 15.16
Coulombic values for ranked_2.pdb_F SES surface #1.6: minimum, -13.75, mean
2.05, maximum 13.10
Coulombic values for ranked_2.pdb_G SES surface #1.7: minimum, -7.80, mean
6.98, maximum 22.67
Coulombic values for ranked_2.pdb_H SES surface #1.8: minimum, -8.45, mean
6.51, maximum 20.32
To also show corresponding color key, enter the above coulombic command and
add key true
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone-Octamer-RKK.pdb"
Chain information for Histone-Octamer-RKK.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> style sel stick
Changed 329 atom styles
> color sel byhetero
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> show sel cartoons
> hide sel atoms
> select clear
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> color sel cornflower blue
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> color sel yellow
> color sel byhetero
> select clear
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/ranked_0.pdb"
Chain information for ranked_0.pdb #2
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select #2/A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> color sel purple
> color sel hot pink
> select #2/B:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> color sel hot pink
> select #2/C:1-15
260 atoms, 263 bonds, 15 residues, 1 model selected
> color sel orange
> show sel atoms
> color sel byhetero
> select clear
> select #2/A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> ui tool show Matchmaker
> matchmaker #2/A to #1/A pairing ss
Parameters
---
Chain pairing | ss
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker Histone-Octamer-RKK.pdb, chain A (#1) with ranked_0.pdb, chain A
(#2), sequence alignment score = 591.8
RMSD between 87 pruned atom pairs is 1.118 angstroms; (across all 130 pairs:
21.387)
> select clear
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> show sel cartoons
> select clear
> select #2/A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> show sel surfaces
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_A SES surface #2.1: minimum, -15.50, mean
3.92, maximum 18.48
To also show corresponding color key, enter the above coulombic command and
add key true
> close #2
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGBP/MRGBP-
> BRD8/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> show sel surfaces
Alignment identifier is 1/A
> select /A:105
20 atoms, 20 bonds, 1 residue, 1 model selected
> select /A:105-112
137 atoms, 138 bonds, 8 residues, 1 model selected
> select /B:1-169
2723 atoms, 2753 bonds, 169 residues, 1 model selected
> show sel atoms
> select clear
> select /A:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -20.86, mean
-1.03, maximum 10.53
To also show corresponding color key, enter the above coulombic command and
add key true
> hide sel surfaces
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG15/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
> select /A:1-323
5271 atoms, 5335 bonds, 323 residues, 1 model selected
Alignment identifier is 1/A
> select /A:149
14 atoms, 13 bonds, 1 residue, 1 model selected
> select /A:149
14 atoms, 13 bonds, 1 residue, 1 model selected
> select /A:92
10 atoms, 9 bonds, 1 residue, 1 model selected
> select /A:92-94
34 atoms, 34 bonds, 3 residues, 1 model selected
> close
> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRG15/MRG15-AI_Isoform/AF-Q9UBU8-F1-model_v4.pdb"
AF-Q9UBU8-F1-model_v4.pdb title:
Alphafold monomer V2.0 prediction for mortality factor 4-like protein 1
(Q9UBU8) [more info...]
Chain information for AF-Q9UBU8-F1-model_v4.pdb #1
---
Chain | Description | UniProt
A | mortality factor 4-like protein 1 | MO4L1_HUMAN
> select /A:1-362
2929 atoms, 3002 bonds, 362 residues, 1 model selected
Alignment identifier is 1/A
> select /A:268
8 atoms, 7 bonds, 1 residue, 1 model selected
> select /A:268-272
36 atoms, 35 bonds, 5 residues, 1 model selected
> select /A:148
9 atoms, 8 bonds, 1 residue, 1 model selected
> select /A:148
9 atoms, 8 bonds, 1 residue, 1 model selected
> ui tool show "AlphaFold Error Plot"
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone-Octamer-RKK.pdb"
Chain information for Histone-Octamer-RKK.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> ui tool show "AlphaFold Error Plot"
> alphafold pae #1 file /Users/Gareth/Documents/result_model_1_multimer.pkl
> alphafold pae #1 colorDomains true
> help help:user/tools/alphafold.html#pae
> hide atoms
> show cartoons
> color #1/A:119-119 lime
> color #1/C:96-96 magenta
> color #1/C:69-69 lime
> color #1/C:72-72 magenta
> color #1/I:9-9 lime
> color #1/H:69-69 magenta
> color #1/A:88-88 lime
> color #1/I:15-15 magenta
> color #1/A:93-93 lime
> color #1/I:14-14 magenta
> color #1/D:61-61 lime
> color #1/D:66-66 magenta
> color #1/F:61-61 lime
> color #1/H:67-67 magenta
> close
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -26.17, mean
-2.324, maximum 24.92
To also show corresponding color key, enter the above mlp command and add key
true
> select clear
> select /B:1-111
1653 atoms, 1666 bonds, 111 residues, 1 model selected
Alignment identifier is 1/B
> select /B:95
20 atoms, 20 bonds, 1 residue, 1 model selected
> select /B:95-98
67 atoms, 68 bonds, 4 residues, 1 model selected
> select /B:59
11 atoms, 10 bonds, 1 residue, 1 model selected
> select /B:59-69
170 atoms, 171 bonds, 11 residues, 1 model selected
> select /B:77-78
26 atoms, 25 bonds, 2 residues, 1 model selected
> select /B:77-80
61 atoms, 60 bonds, 4 residues, 1 model selected
> close
> open /Users/Gareth/Documents/ranked_1.pdb
Chain information for ranked_1.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_1.pdb_A SES surface": minimum -26.3, mean
-2.42, maximum 27.86
To also show corresponding color key, enter the above mlp command and add key
true
> close
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -25.88, mean
-2.21, maximum 26.06
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-56
872 atoms, 881 bonds, 56 residues, 1 model selected
Alignment identifier is 1/B
> select /B:18
20 atoms, 20 bonds, 1 residue, 1 model selected
> select /B:18-21
67 atoms, 68 bonds, 4 residues, 1 model selected
> close
> open /Users/Gareth/Documents/ranked_1.pdb
Chain information for ranked_1.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_1.pdb_A SES surface": minimum -26.18, mean
-2.31, maximum 24.21
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-56
872 atoms, 881 bonds, 56 residues, 1 model selected
> show sel atoms
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG15/ranked_0.pdb"
Chain information for ranked_0.pdb #2
---
Chain | Description
A | No description available
> ui tool show Matchmaker
> matchmaker #2 to #1
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_1.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 854.4
RMSD between 151 pruned atom pairs is 0.826 angstroms; (across all 168 pairs:
1.693)
> hide sel surfaces
> select clear
> hide surfaces
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone-Octamer-RKK.pdb"
Chain information for Histone-Octamer-RKK.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide atoms
> show cartoons
> select /I:1-20
329 atoms, 332 bonds, 20 residues, 1 model selected
> select ~sel
14908 atoms, 15000 bonds, 924 residues, 1 model selected
> color sel hot pink
> select clear
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/Histone-Octamer-KTKK.pdb"
Chain information for Histone-Octamer-KTKK.pdb #2
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide atoms
> show cartoons
> ui tool show Matchmaker
> matchmaker #2/A to #1/A pairing ss
Parameters
---
Chain pairing | ss
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker Histone-Octamer-RKK.pdb, chain A (#1) with Histone-Octamer-
KTKK.pdb, chain A (#2), sequence alignment score = 603.2
RMSD between 94 pruned atom pairs is 0.866 angstroms; (across all 130 pairs:
3.895)
> select #2/A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/B:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/C:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/D:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/E:1-103
1703 atoms, 1714 bonds, 103 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/E:1-103
Nothing selected
> select #2/E:1-103
Nothing selected
> select #2/F:1-103
1703 atoms, 1714 bonds, 103 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/G:1-103
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/H:1-103
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> ui tool show "Add Hydrogens"
> addh inIsolation false
Summary of feedback from adding hydrogens to multiple structures
---
notes | No usable SEQRES records for Histone-Octamer-RKK.pdb (#1) chain A;
guessing termini instead
No usable SEQRES records for Histone-Octamer-RKK.pdb (#1) chain B; guessing
termini instead
No usable SEQRES records for Histone-Octamer-RKK.pdb (#1) chain C; guessing
termini instead
No usable SEQRES records for Histone-Octamer-RKK.pdb (#1) chain D; guessing
termini instead
No usable SEQRES records for Histone-Octamer-RKK.pdb (#1) chain E; guessing
termini instead
5 messages similar to the above omitted
Chain-initial residues that are actual N termini: Histone-Octamer-RKK.pdb #1/A
MET 1, Histone-Octamer-RKK.pdb #1/B MET 1, Histone-Octamer-RKK.pdb #1/C MET 1,
Histone-Octamer-RKK.pdb #1/D MET 1, Histone-Octamer-RKK.pdb #1/E THR 1,
Histone-Octamer-RKK.pdb #1/F THR 1, Histone-Octamer-RKK.pdb #1/G MET 1,
Histone-Octamer-RKK.pdb #1/H MET 1, Histone-Octamer-RKK.pdb #1/I SER 1,
Histone-Octamer-KTKK.pdb #2/I LEU 1
Chain-initial residues that are not actual N termini:
Chain-final residues that are actual C termini: Histone-Octamer-RKK.pdb #1/A
LYS 130, Histone-Octamer-RKK.pdb #1/B LYS 130, Histone-Octamer-RKK.pdb #1/C
LYS 126, Histone-Octamer-RKK.pdb #1/D LYS 126, Histone-Octamer-RKK.pdb #1/E
ALA 103, Histone-Octamer-RKK.pdb #1/F ALA 103, Histone-Octamer-RKK.pdb #1/G
GLY 103, Histone-Octamer-RKK.pdb #1/H GLY 103, Histone-Octamer-RKK.pdb #1/I
ASN 20, Histone-Octamer-KTKK.pdb #2/I ASN 20
Chain-final residues that are not actual C termini:
985 hydrogen bonds
1 hydrogens added
> ui tool show "Build Structure"
> save /Users/Gareth/Desktop/RKK.pdb
> close
> open /Users/Gareth/Desktop/RKK.pdb
Summary of feedback from opening /Users/Gareth/Desktop/RKK.pdb
---
warnings | Start residue of secondary structure not found: HELIX 1 1 ALA A 13
THR A 17 1 5
Start residue of secondary structure not found: HELIX 2 2 SER A 20 ALA A 22 1
3
Start residue of secondary structure not found: HELIX 3 3 VAL A 28 LYS A 37 1
10
Start residue of secondary structure not found: HELIX 4 4 GLY A 47 ALA A 71 1
25
Start residue of secondary structure not found: HELIX 5 5 ARG A 72 ASN A 74 1
3
58 messages similar to the above omitted
End residue of secondary structure not found: HELIX 64 64 LYS I 9 ARG I 11 1 3
Start residue of secondary structure not found: SHEET 1 1 1 VAL A 101 ILE A
103 0
Start residue of secondary structure not found: SHEET 2 2 1 VAL B 101 ILE B
103 0
Start residue of secondary structure not found: SHEET 3 3 1 THR G 97 TYR G 99
0
Start residue of secondary structure not found: SHEET 4 4 1 THR H 97 TYR H 99
0
Chain information for RKK.pdb
---
Chain | Description
1.1/A 1.1/B | No description available
1.1/C 1.1/D | No description available
1.1/E 1.1/F | No description available
1.1/G 1.1/H | No description available
1.1/I | No description available
1.2/I | No description available
> hide atoms
> show cartoons
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone-Octamer-RKK.pdb"
Chain information for Histone-Octamer-RKK.pdb #1
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide atoms
> show cartoons
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/Histone-Octamer-KTKK.pdb"
Chain information for Histone-Octamer-KTKK.pdb #2
---
Chain | Description
A B | No description available
C D | No description available
E F | No description available
G H | No description available
I | No description available
> hide atoms
> show cartoons
> ui tool show Matchmaker
> matchmaker #2/A to #1/A pairing ss
Parameters
---
Chain pairing | ss
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker Histone-Octamer-RKK.pdb, chain A (#1) with Histone-Octamer-
KTKK.pdb, chain A (#2), sequence alignment score = 603.2
RMSD between 94 pruned atom pairs is 0.866 angstroms; (across all 130 pairs:
3.895)
> select #2/A:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/B:1-130
2063 atoms, 2075 bonds, 130 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/C:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/D:1-126
2024 atoms, 2039 bonds, 126 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/E:1-103
1703 atoms, 1714 bonds, 103 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/F:1-103
1703 atoms, 1714 bonds, 103 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/G:1-103
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/H:1-103
1664 atoms, 1672 bonds, 103 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/F:1-103
Nothing selected
> select add #1
15237 atoms, 15332 bonds, 944 residues, 1 model selected
> select add #2
15580 atoms, 15675 bonds, 964 residues, 2 models selected
> select subtract #2
15237 atoms, 15332 bonds, 944 residues, 1 model selected
> select add #2
15580 atoms, 15675 bonds, 964 residues, 2 models selected
> select subtract #2
15237 atoms, 15332 bonds, 944 residues, 1 model selected
> select subtract #1
Nothing selected
> ui tool show "Change Chain IDs"
> view clip false
> select add #1
15237 atoms, 15332 bonds, 944 residues, 1 model selected
> select add #2
15580 atoms, 15675 bonds, 964 residues, 2 models selected
>
Incomplete command: modeller
> join models
Unknown command: join models
> combine
Remapping chain ID 'I' in Histone-Octamer-KTKK.pdb #2 to 'J'
> close #1
> close #2
> save /Users/Gareth/Desktop/RKK.pdb relModel #3
> close
> open /Users/Gareth/Downloads/step1_pdbreader.pdb
Summary of feedback from opening /Users/Gareth/Downloads/step1_pdbreader.pdb
---
warnings | Ignored bad PDB record found on line 1
REMARK GENERATED BY CHARMM-GUI (HTTP://WWW.CHARMM-GUI.ORG) V3.7 ON FEB, 02.
2023. JOB
Ignored bad PDB record found on line 2
REMARK READ PDB, MANIPULATE STRUCTURE IF NEEDED, AND GENERATE TOPOLOGY FILE
Ignored bad PDB record found on line 3
REMARK DATE: 2/ 2/23 11:37:31 CREATED BY USER: apache
Chain information for step1_pdbreader.pdb #1
---
Chain | Description
P | No description available
> close
> open /Users/Gareth/Desktop/MD/RKK.pdb
Summary of feedback from opening /Users/Gareth/Desktop/MD/RKK.pdb
---
warnings | Ignored bad PDB record found on line 1
REMARK GENERATED BY CHARMM-GUI (HTTP://WWW.CHARMM-GUI.ORG) V3.7 ON FEB, 03.
2023. JOB
Ignored bad PDB record found on line 2
REMARK READ PDB, MANIPULATE STRUCTURE IF NEEDED, AND GENERATE TOPOLOGY FILE
Ignored bad PDB record found on line 3
REMARK DATE: 2/ 3/23 7:23: 2 CREATED BY USER: apache
Chain information for RKK.pdb #1
---
Chain | Description
P | No description available
Alignment identifier is 1/P
> select clear
> select /P:130
46 atoms, 44 bonds, 2 residues, 1 model selected
> select /P:130
46 atoms, 44 bonds, 2 residues, 1 model selected
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGBP/MRGBP-
> BRD8/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> show sel surfaces
> select /A:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> close
> close #
Expected a models specifier or a keyword
> open /Users/Gareth/Documents/ranked_0.pdb
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -25.88, mean
-2.21, maximum 26.06
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-56
872 atoms, 881 bonds, 56 residues, 1 model selected
Alignment identifier is 1/B
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-MRGBP-
> BRD8/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
B | No description available
C | No description available
> select /A:1-168
2756 atoms, 2792 bonds, 168 residues, 1 model selected
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -26.9, mean
-2.559, maximum 25.42
To also show corresponding color key, enter the above mlp command and add key
true
> select /B:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> color sel cornflower blue
> select clear
> select /C:1-169
2723 atoms, 2753 bonds, 169 residues, 1 model selected
> color sel hot pink
> select /B:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
Alignment identifier is 1/B
> select /B:105
20 atoms, 20 bonds, 1 residue, 1 model selected
> select /B:105-108
69 atoms, 70 bonds, 4 residues, 1 model selected
> select /C:1-169
2723 atoms, 2753 bonds, 169 residues, 1 model selected
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for ranked_0.pdb_C SES surface #1.2: minimum, -14.15, mean
0.59, maximum 16.76
To also show corresponding color key, enter the above coulombic command and
add key true
> select clear
> select /B:33
14 atoms, 14 bonds, 1 residue, 1 model selected
> select /B:33-42
153 atoms, 155 bonds, 10 residues, 1 model selected
> show sel atoms
> style sel stick
Changed 153 atom styles
> color sel byhetero
> select /B:74
11 atoms, 10 bonds, 1 residue, 1 model selected
> select /B:74-83
165 atoms, 167 bonds, 10 residues, 1 model selected
> show sel atoms
> color sel byhetero
> select /B:84
17 atoms, 16 bonds, 1 residue, 1 model selected
> select /B:84-89
94 atoms, 94 bonds, 6 residues, 1 model selected
> color sel byhetero
> show sel atoms
> select /C:111@C
1 atom, 1 residue, 1 model selected
> select /B:43-44
36 atoms, 35 bonds, 2 residues, 1 model selected
> select /B:43-49
112 atoms, 113 bonds, 7 residues, 1 model selected
> show sel atoms
> color sel byhetero
> select /B:33-42,50-68,74-83,87-93,109-133,176-186,198-200
1409 atoms, 1413 bonds, 85 residues, 1 model selected
> select /B:96-97
33 atoms, 33 bonds, 2 residues, 1 model selected
> select /B:96-99
67 atoms, 69 bonds, 4 residues, 1 model selected
> select /B:54
17 atoms, 17 bonds, 1 residue, 1 model selected
> select /B:54-67
240 atoms, 243 bonds, 14 residues, 1 model selected
> show sel atoms
> color sel byhetero
> select /B:1-204
3097 atoms, 3126 bonds, 204 residues, 1 model selected
> hide sel cartoons
> hide sel atoms
> select /C:1-169
2723 atoms, 2753 bonds, 169 residues, 1 model selected
> hide sel surfaces
> hide sel cartoons
> close
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG15/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
> mlp
Map values for surface "ranked_0.pdb_A SES surface": minimum -25.17, mean
-3.564, maximum 24.96
To also show corresponding color key, enter the above mlp command and add key
true
> hide surfaces
> show surfaces
> hide surfaces
> show surfaces
> select /A:265@O
1 atom, 1 residue, 1 model selected
> select /A:233@CA
1 atom, 1 residue, 1 model selected
> select add /A:265@CA
2 atoms, 2 residues, 2 models selected
> select add /A:233@CD2
3 atoms, 2 residues, 2 models selected
> select add /A:265@HB2
4 atoms, 2 residues, 2 models selected
> select add /A:268@HG23
5 atoms, 3 residues, 2 models selected
> select add /A:268@HG11
6 atoms, 3 residues, 2 models selected
> select add /A:160@HG12
7 atoms, 4 residues, 2 models selected
> select add /A:168@HB3
8 atoms, 5 residues, 2 models selected
> select add /A:168@CD2
9 atoms, 5 residues, 2 models selected
> select add /A:168@HD11
10 atoms, 5 residues, 2 models selected
> select add /A:168@HD12
11 atoms, 5 residues, 2 models selected
> select add /A:160@HG13
12 atoms, 5 residues, 2 models selected
> select add /A:160@CB
13 atoms, 5 residues, 2 models selected
> select add /A:165@HG3
14 atoms, 6 residues, 2 models selected
> select add /A:168@CD1
15 atoms, 6 residues, 2 models selected
> select add /A:268@CG2
16 atoms, 6 residues, 2 models selected
> select add /A:268@CG1
17 atoms, 6 residues, 2 models selected
> select add /A:265@CG
18 atoms, 6 residues, 2 models selected
> select add /A:265@O
19 atoms, 6 residues, 2 models selected
> select add /A:265@HD2
20 atoms, 6 residues, 2 models selected
> select add /A:265@CB
21 atoms, 6 residues, 2 models selected
> select add /A:233@O
22 atoms, 6 residues, 2 models selected
> select add /A:233@C
23 atoms, 6 residues, 2 models selected
> select add /A:233@HA
24 atoms, 6 residues, 2 models selected
> select add /A:265@CD
25 atoms, 6 residues, 2 models selected
> select add /A:265@HG2
26 atoms, 6 residues, 2 models selected
> select add /A:168@HD23
27 atoms, 6 residues, 2 models selected
> select add /A:265@HA
28 atoms, 6 residues, 2 models selected
> select add /A:268@HB
29 atoms, 6 residues, 2 models selected
> select add /A:268@CB
30 atoms, 6 residues, 2 models selected
> select add /A:268@HG13
31 atoms, 6 residues, 2 models selected
> select add /A:268@HG12
32 atoms, 6 residues, 2 models selected
> select add /A:160@CG1
33 atoms, 6 residues, 2 models selected
> select add /A:268@HG21
34 atoms, 6 residues, 2 models selected
> select subtract /A:165@HG3
33 atoms, 5 residues, 2 models selected
> select add /A:165@CA
34 atoms, 6 residues, 2 models selected
> select add /A:165@CG
35 atoms, 6 residues, 2 models selected
> select add /A:165@HG3
36 atoms, 6 residues, 2 models selected
> select add /A:165@HA
37 atoms, 6 residues, 2 models selected
> select add /A:160@CG2
38 atoms, 6 residues, 2 models selected
> select add /A:160@HB
39 atoms, 6 residues, 2 models selected
> select add /A:168@CB
40 atoms, 6 residues, 2 models selected
> select add /A:168@HB2
41 atoms, 6 residues, 2 models selected
> select add /A:172@HB2
42 atoms, 7 residues, 2 models selected
> select add /A:235@CE1
43 atoms, 8 residues, 2 models selected
> select add /A:235@HH
44 atoms, 8 residues, 2 models selected
> select subtract /A:235@HH
43 atoms, 8 residues, 2 models selected
> select add /A:235@OH
44 atoms, 8 residues, 2 models selected
> select add /A:235@HH
45 atoms, 8 residues, 2 models selected
> select add /A:235@HE1
46 atoms, 8 residues, 2 models selected
> select add /A:168@O
47 atoms, 8 residues, 2 models selected
> select add /A:169@N
48 atoms, 9 residues, 2 models selected
> select add /A:172@CE3
49 atoms, 9 residues, 2 models selected
> select add /A:172@CE2
50 atoms, 9 residues, 2 models selected
> select add /A:172@CD2
51 atoms, 9 residues, 2 models selected
> select add /A:172@CB
52 atoms, 9 residues, 2 models selected
> select subtract /A:172@CE3
51 atoms, 9 residues, 2 models selected
> select add /A:172@CZ3
52 atoms, 9 residues, 2 models selected
> select add /A:172@CH2
53 atoms, 9 residues, 2 models selected
> select add /A:172@CZ2
54 atoms, 9 residues, 2 models selected
> select add /A:172@NE1
55 atoms, 9 residues, 2 models selected
> select add /A:172@CD1
56 atoms, 9 residues, 2 models selected
> select add /A:172@CG
57 atoms, 9 residues, 2 models selected
> select add /A:169@CG2
58 atoms, 9 residues, 2 models selected
> select add /A:169@HG11
59 atoms, 9 residues, 2 models selected
> select add /A:172@CE3
60 atoms, 9 residues, 2 models selected
> select add /A:169@HA
61 atoms, 9 residues, 2 models selected
> select add /A:169@HG21
62 atoms, 9 residues, 2 models selected
> select subtract /A:169@HG11
61 atoms, 9 residues, 2 models selected
> select add /A:169@CG1
62 atoms, 9 residues, 2 models selected
> select add /A:169@HG11
63 atoms, 9 residues, 2 models selected
> select subtract /A:169@HA
62 atoms, 9 residues, 2 models selected
> select subtract /A:169@N
61 atoms, 9 residues, 2 models selected
> select add /A:169@N
62 atoms, 9 residues, 2 models selected
> select add /A:169@HA
63 atoms, 9 residues, 2 models selected
> select add /A:168@C
64 atoms, 9 residues, 2 models selected
> select add /A:169@CA
65 atoms, 9 residues, 2 models selected
> show sel atoms
> hide sel surfaces
Alignment identifier is 1/A
> select /A:250@HB2
1 atom, 1 residue, 1 model selected
> hide sel surfaces
[Repeated 5 time(s)]
> select /A:1-323
5271 atoms, 5335 bonds, 323 residues, 1 model selected
> hide sel surfaces
> select clear
> show cartoons
[Repeated 1 time(s)]
> select /A
5271 atoms, 5335 bonds, 323 residues, 1 model selected
> show sel cartoons
> select clear
> select /A:172
24 atoms, 25 bonds, 1 residue, 1 model selected
> style sel stick
Changed 24 atom styles
> show sel atoms
> select /A:265
24 atoms, 23 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:268
16 atoms, 15 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:160
19 atoms, 18 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:165
22 atoms, 21 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:168
19 atoms, 18 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:169
16 atoms, 15 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:235
21 atoms, 21 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:233
19 atoms, 18 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:235
21 atoms, 21 bonds, 1 residue, 1 model selected
> select add /A:233
40 atoms, 39 bonds, 2 residues, 2 models selected
> select add /A:265
64 atoms, 62 bonds, 3 residues, 2 models selected
> select add /A:268
80 atoms, 77 bonds, 4 residues, 2 models selected
> select add /A:160
99 atoms, 95 bonds, 5 residues, 2 models selected
> select add /A:168
118 atoms, 113 bonds, 6 residues, 2 models selected
> select add /A:169
134 atoms, 128 bonds, 7 residues, 2 models selected
> select add /A:172
158 atoms, 153 bonds, 8 residues, 2 models selected
> select add /A:165
180 atoms, 174 bonds, 9 residues, 2 models selected
> select clear
> show surfaces
> select /A:286@CD2
1 atom, 1 residue, 1 model selected
> select /A:286@CD1
1 atom, 1 residue, 1 model selected
> select add /A:286@CD2
2 atoms, 1 residue, 2 models selected
> select add /A:290@HH
3 atoms, 2 residues, 2 models selected
> select add /A:212@CD1
4 atoms, 3 residues, 2 models selected
> select add /A:217@CG2
5 atoms, 4 residues, 2 models selected
> select add /A:270@HD13
6 atoms, 5 residues, 2 models selected
> select add /A:287@HD23
7 atoms, 6 residues, 2 models selected
> select add /A:279@CD2
8 atoms, 7 residues, 2 models selected
> select add /A:277@CG2
9 atoms, 8 residues, 2 models selected
> select add /A:224@CE2
10 atoms, 9 residues, 2 models selected
> select add /A:224@CG
11 atoms, 9 residues, 2 models selected
> select add /A:270@CD1
12 atoms, 9 residues, 2 models selected
> select add /A:287@HD11
13 atoms, 9 residues, 2 models selected
> select add /A:287@CB
14 atoms, 9 residues, 2 models selected
> select add /A:290@CE2
15 atoms, 9 residues, 2 models selected
> select add /A:290@CD2
16 atoms, 9 residues, 2 models selected
> select add /A:213@HB3
17 atoms, 10 residues, 2 models selected
> select add /A:212@HE1
18 atoms, 10 residues, 2 models selected
> select add /A:216@OE1
19 atoms, 11 residues, 2 models selected
> select add /A:216@OE2
20 atoms, 11 residues, 2 models selected
> select add /A:213@O
21 atoms, 11 residues, 2 models selected
> select add /A:216@CB
22 atoms, 11 residues, 2 models selected
> select add /A:217@CA
23 atoms, 11 residues, 2 models selected
> select add /A:221@N
24 atoms, 12 residues, 2 models selected
> select add /A:220@CA
25 atoms, 13 residues, 2 models selected
> select add /A:224@CD2
26 atoms, 13 residues, 2 models selected
> select add /A:283@HA
27 atoms, 14 residues, 2 models selected
> select add /A:283@OG
28 atoms, 14 residues, 2 models selected
> select add /A:283@HB2
29 atoms, 14 residues, 2 models selected
> select add /A:279@HD21
30 atoms, 14 residues, 2 models selected
> select add /A:224@OH
31 atoms, 14 residues, 2 models selected
> select add /A:287@HA
32 atoms, 14 residues, 2 models selected
> select add /A:283@O
33 atoms, 14 residues, 2 models selected
> select add /A:279@CD1
34 atoms, 14 residues, 2 models selected
> select add /A:287@CD1
35 atoms, 14 residues, 2 models selected
> select add /A:274@CD2
36 atoms, 15 residues, 2 models selected
> select add /A:291@HD11
37 atoms, 16 residues, 2 models selected
> select add /A:291@CD2
38 atoms, 16 residues, 2 models selected
> select subtract /A:274@CD2
37 atoms, 15 residues, 2 models selected
> select subtract /A:270@CD1
36 atoms, 15 residues, 2 models selected
> select add /A:270@CD1
37 atoms, 15 residues, 2 models selected
> select add /A:291@CD1
38 atoms, 15 residues, 2 models selected
> select add /A:291@HD22
39 atoms, 15 residues, 2 models selected
> select add /A:287@HD13
40 atoms, 15 residues, 2 models selected
> select add /A:224@HE2
41 atoms, 15 residues, 2 models selected
> select add /A:274@CD2
42 atoms, 16 residues, 2 models selected
> select add /A:274@HD22
43 atoms, 16 residues, 2 models selected
> select add /A:287@CD2
44 atoms, 16 residues, 2 models selected
> select add /A:287@HD21
45 atoms, 16 residues, 2 models selected
> select add /A:279@HD11
46 atoms, 16 residues, 2 models selected
> select add /A:277@HG22
47 atoms, 16 residues, 2 models selected
> select add /A:277@HG23
48 atoms, 16 residues, 2 models selected
> select add /A:279@HD23
49 atoms, 16 residues, 2 models selected
> select subtract /A:283@OG
48 atoms, 16 residues, 2 models selected
> select add /A:283@OG
49 atoms, 16 residues, 2 models selected
> select add /A:283@CB
50 atoms, 16 residues, 2 models selected
> select add /A:283@CA
51 atoms, 16 residues, 2 models selected
> select add /A:286@CB
52 atoms, 16 residues, 2 models selected
> select add /A:286@HD23
53 atoms, 16 residues, 2 models selected
> select add /A:286@HD11
54 atoms, 16 residues, 2 models selected
> select add /A:286@HD12
55 atoms, 16 residues, 2 models selected
> select add /A:286@HD22
56 atoms, 16 residues, 2 models selected
> select subtract /A:213@HB3
55 atoms, 16 residues, 2 models selected
> select add /A:209@O
56 atoms, 17 residues, 2 models selected
> select add /A:213@CB
57 atoms, 17 residues, 2 models selected
> select add /A:213@HB3
58 atoms, 17 residues, 2 models selected
> select add /A:213@CA
59 atoms, 17 residues, 2 models selected
> select add /A:212@HD1
60 atoms, 17 residues, 2 models selected
> select add /A:212@OH
61 atoms, 17 residues, 2 models selected
> select add /A:212@CZ
62 atoms, 17 residues, 2 models selected
> select add /A:212@CE1
63 atoms, 17 residues, 2 models selected
> select add /A:212@CD2
64 atoms, 17 residues, 2 models selected
> select add /A:212@CE2
65 atoms, 17 residues, 2 models selected
> select add /A:287@HB3
66 atoms, 17 residues, 2 models selected
> select add /A:287@N
67 atoms, 17 residues, 2 models selected
> select add /A:287@CA
68 atoms, 17 residues, 2 models selected
> select add /A:286@C
69 atoms, 17 residues, 2 models selected
> select add /A:290@HD2
70 atoms, 17 residues, 2 models selected
> select add /A:290@HE2
71 atoms, 17 residues, 2 models selected
> select add /A:286@HD21
72 atoms, 17 residues, 2 models selected
> select add /A:286@CG
73 atoms, 17 residues, 2 models selected
> select add /A:286@HB2
74 atoms, 17 residues, 2 models selected
> select add /A:286@HG
75 atoms, 17 residues, 2 models selected
> select add /A:279@HD12
76 atoms, 17 residues, 2 models selected
> select add /A:283@C
77 atoms, 17 residues, 2 models selected
> select add /A:217@HG22
78 atoms, 17 residues, 2 models selected
> select add /A:217@N
79 atoms, 17 residues, 2 models selected
> select add /A:216@O
80 atoms, 17 residues, 2 models selected
> select add /A:216@C
81 atoms, 17 residues, 2 models selected
> select add /A:216@HB3
82 atoms, 17 residues, 2 models selected
> select add /A:216@CD
83 atoms, 17 residues, 2 models selected
> select add /A:213@HA
84 atoms, 17 residues, 2 models selected
> select add /A:213@HB1
85 atoms, 17 residues, 2 models selected
> select add /A:213@N
86 atoms, 17 residues, 2 models selected
> select add /A:220@HA3
87 atoms, 17 residues, 2 models selected
> select subtract /A:221@N
86 atoms, 16 residues, 2 models selected
> select add /A:221@N
87 atoms, 17 residues, 2 models selected
> select subtract /A:291@CD2
86 atoms, 17 residues, 2 models selected
> select add /A:221@HG12
87 atoms, 17 residues, 2 models selected
> select add /A:217@CG1
88 atoms, 17 residues, 2 models selected
> select add /A:217@O
89 atoms, 17 residues, 2 models selected
> select add /A:217@HA
90 atoms, 17 residues, 2 models selected
> select add /A:217@HG13
91 atoms, 17 residues, 2 models selected
> select add /A:217@HG23
92 atoms, 17 residues, 2 models selected
> select add /A:221@CG1
93 atoms, 17 residues, 2 models selected
> select add /A:291@CD2
94 atoms, 17 residues, 2 models selected
> select add /A:221@CA
95 atoms, 17 residues, 2 models selected
> select subtract /A:224@CD2
94 atoms, 17 residues, 2 models selected
> select add /A:224@CD2
95 atoms, 17 residues, 2 models selected
> select add /A:220@C
96 atoms, 17 residues, 2 models selected
> select add /A:221@HA
97 atoms, 17 residues, 2 models selected
> select add /A:224@HD2
98 atoms, 17 residues, 2 models selected
> show sel atoms
> select clear
> hide surfaces
> select /A:213
10 atoms, 9 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:212
21 atoms, 21 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:216
15 atoms, 14 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:286
19 atoms, 18 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:283@CB
1 atom, 1 residue, 1 model selected
> show sel atoms
> select /A:290
21 atoms, 21 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:287
19 atoms, 18 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:279
19 atoms, 18 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:277
14 atoms, 13 bonds, 1 residue, 1 model selected
> show sel atoms
> select clear
> select /A:224@OH
1 atom, 1 residue, 1 model selected
> show sel atoms
[Repeated 1 time(s)]
> select subtract /A:224
1 model selected
> select add /A:224
21 atoms, 21 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:217
16 atoms, 15 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:221
19 atoms, 18 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:291
19 atoms, 18 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:158
16 atoms, 15 bonds, 1 residue, 1 model selected
> select /A:157
22 atoms, 21 bonds, 1 residue, 1 model selected
> select /A:274
19 atoms, 18 bonds, 1 residue, 1 model selected
> show sel atoms
> select /A:270@CD1
1 atom, 1 residue, 1 model selected
> select /A:269
24 atoms, 23 bonds, 1 residue, 1 model selected
> select /A:270
19 atoms, 18 bonds, 1 residue, 1 model selected
> show sel atoms
> select clear
> select /A:212
21 atoms, 21 bonds, 1 residue, 1 model selected
> select add /A:213
31 atoms, 30 bonds, 2 residues, 2 models selected
> select add /A:216
46 atoms, 44 bonds, 3 residues, 2 models selected
> select add /A:286
65 atoms, 62 bonds, 4 residues, 2 models selected
> select add /A:290
86 atoms, 83 bonds, 5 residues, 2 models selected
> select add /A:217
102 atoms, 98 bonds, 6 residues, 2 models selected
> select add /A:220
109 atoms, 104 bonds, 7 residues, 2 models selected
> select subtract /A:220
102 atoms, 98 bonds, 6 residues, 2 models selected
> select add /A:221
121 atoms, 116 bonds, 7 residues, 2 models selected
> select add /A:224
142 atoms, 137 bonds, 8 residues, 2 models selected
> select add /A:279@CA
143 atoms, 137 bonds, 9 residues, 2 models selected
> select add /A:278
157 atoms, 152 bonds, 10 residues, 2 models selected
> select subtract /A:278
143 atoms, 138 bonds, 9 residues, 2 models selected
> select add /A:280
155 atoms, 149 bonds, 10 residues, 2 models selected
> select subtract /A:279
154 atoms, 148 bonds, 9 residues, 2 models selected
> select subtract /A:280
142 atoms, 137 bonds, 8 residues, 2 models selected
> select add /A:279
161 atoms, 155 bonds, 9 residues, 2 models selected
> select add /A:283
172 atoms, 165 bonds, 10 residues, 2 models selected
> select add /A:277
186 atoms, 178 bonds, 11 residues, 2 models selected
> select add /A:287
205 atoms, 196 bonds, 12 residues, 2 models selected
> select add /A:291
224 atoms, 214 bonds, 13 residues, 2 models selected
> select add /A:274
243 atoms, 232 bonds, 14 residues, 2 models selected
> select add /A:270
262 atoms, 250 bonds, 15 residues, 2 models selected
> select add /A:233
281 atoms, 268 bonds, 16 residues, 2 models selected
> select subtract /A:233
262 atoms, 250 bonds, 15 residues, 2 models selected
> select /A
5271 atoms, 5335 bonds, 323 residues, 1 model selected
> color (#!1 & sel) blue
> color (#!1 & sel) cornflower blue
> color sel byhetero
> select clear
> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRGX/AF-Q15014-F1-model_v4.pdb"
AF-Q15014-F1-model_v4.pdb title:
Alphafold monomer V2.0 prediction for mortality factor 4-like protein 2
(Q15014) [more info...]
Chain information for AF-Q15014-F1-model_v4.pdb #2
---
Chain | Description | UniProt
A | mortality factor 4-like protein 2 | MO4L2_HUMAN
> sequence chain #2/A
Alignment identifier is 2/A
> select #2/A:1-288
2275 atoms, 2323 bonds, 288 residues, 1 model selected
> color sel hot pink
> ui tool show Matchmaker
> matchmaker #2 to #1
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain A (#1) with AF-Q15014-F1-model_v4.pdb, chain A
(#2), sequence alignment score = 1033.9
RMSD between 165 pruned atom pairs is 0.252 angstroms; (across all 267 pairs:
31.035)
> select clear
> select #2/A:1-288
2275 atoms, 2323 bonds, 288 residues, 1 model selected
> mlp sel
Map values for surface "AF-Q15014-F1-model_v4.pdb_A SES surface": minimum
-26.64, mean -5.47, maximum 23.64
To also show corresponding color key, enter the above mlp command and add key
true
> select #1/A
5271 atoms, 5335 bonds, 323 residues, 1 model selected
> show sel surfaces
> color (#!1 & sel) cornflower blue
> hide sel surfaces
> select clear
> hide surfaces
> select #2/A:1-288
2275 atoms, 2323 bonds, 288 residues, 1 model selected
Alignment identifier is 2/A
> select clear
> hide atoms
> select #2/A:76
11 atoms, 10 bonds, 1 residue, 1 model selected
> select #2/A:76
11 atoms, 10 bonds, 1 residue, 1 model selected
> select #1/A:170
12 atoms, 11 bonds, 1 residue, 1 model selected
> select #1/A:170
12 atoms, 11 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:135
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:135
9 atoms, 8 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:140
7 atoms, 6 bonds, 1 residue, 1 model selected
> select #2/A:140
7 atoms, 6 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #1/A:175
19 atoms, 18 bonds, 1 residue, 1 model selected
> select #1/A:175
19 atoms, 18 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:140
7 atoms, 6 bonds, 1 residue, 1 model selected
> select #2/A:140
7 atoms, 6 bonds, 1 residue, 1 model selected
> color sel byhetero
> show sel atoms
> hide sel atoms
> show sel atoms
> color sel byhetero
> nucleotides sel atoms
> style nucleic & sel stick
Changed 0 atom styles
> style sel stick
Changed 7 atom styles
> color sel byhetero
> select #1/A:183
21 atoms, 21 bonds, 1 residue, 1 model selected
> select #1/A:183
21 atoms, 21 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:148
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:148-149
17 atoms, 16 bonds, 2 residues, 1 model selected
> select #2/A:147-148
20 atoms, 20 bonds, 2 residues, 1 model selected
> select #2/A:147-148
20 atoms, 20 bonds, 2 residues, 1 model selected
> select #2/A:149-150
15 atoms, 15 bonds, 2 residues, 1 model selected
> select #2/A:149-151
20 atoms, 20 bonds, 3 residues, 1 model selected
> select #2/A:148
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:148
9 atoms, 8 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:157
5 atoms, 4 bonds, 1 residue, 1 model selected
> select #2/A:157
5 atoms, 4 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
[Repeated 1 time(s)]
> nucleotides sel atoms
> style nucleic & sel stick
Changed 0 atom styles
> select #1/A:192
11 atoms, 10 bonds, 1 residue, 1 model selected
> select #1/A:192
11 atoms, 10 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:161
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:161
9 atoms, 8 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #1/A:196
12 atoms, 11 bonds, 1 residue, 1 model selected
> select #1/A:196
12 atoms, 11 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #1/A:200
21 atoms, 21 bonds, 1 residue, 1 model selected
> select #1/A:200
21 atoms, 21 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:165
6 atoms, 5 bonds, 1 residue, 1 model selected
> select #2/A:165
6 atoms, 5 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:169
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:169
9 atoms, 8 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #1/A:204
24 atoms, 23 bonds, 1 residue, 1 model selected
> select #1/A:204
24 atoms, 23 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #1/A:207
14 atoms, 13 bonds, 1 residue, 1 model selected
> select #1/A:207
14 atoms, 13 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:172
7 atoms, 6 bonds, 1 residue, 1 model selected
> select #2/A:172
7 atoms, 6 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:213
5 atoms, 4 bonds, 1 residue, 1 model selected
> select #2/A:213
5 atoms, 4 bonds, 1 residue, 1 model selected
> select
> #2/A:112-116,127-129,131-141,155-169,173-198,201-203,205-213,219-221,225-241,246-265,267-270,273-275,281-287
1019 atoms, 1029 bonds, 126 residues, 1 model selected
> select #2/A:212
8 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:212-213
13 atoms, 12 bonds, 2 residues, 1 model selected
> show sel atoms
> color sel byhetero
> addH
Unknown command: addH
> addcharge H
Using Amber 20 recommended default charges and atom types for standard
residues
> show sel atoms
> color sel byhetero
> show H
> undo
> ui tool show H-Bonds
> select #1/A:247
10 atoms, 9 bonds, 1 residue, 1 model selected
> select #1/A:247-248
22 atoms, 21 bonds, 2 residues, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:254
4 atoms, 3 bonds, 1 residue, 1 model selected
> select #2/A:254
4 atoms, 3 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> show sel atoms
[Repeated 1 time(s)]
> select #1/A:289
14 atoms, 13 bonds, 1 residue, 1 model selected
> select #1/A:289
14 atoms, 13 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:269
6 atoms, 5 bonds, 1 residue, 1 model selected
> select #2/A:269
6 atoms, 5 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #1/A:304
14 atoms, 13 bonds, 1 residue, 1 model selected
> select #1/A:304
14 atoms, 13 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #1/A:307
11 atoms, 10 bonds, 1 residue, 1 model selected
> select #1/A:307
11 atoms, 10 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:272
7 atoms, 6 bonds, 1 residue, 1 model selected
> select #2/A:272
7 atoms, 6 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:277
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:277
9 atoms, 8 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #1/A:312
15 atoms, 14 bonds, 1 residue, 1 model selected
> select #1/A:312
15 atoms, 14 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #1/A:315
14 atoms, 14 bonds, 1 residue, 1 model selected
> select #1/A:315-316
28 atoms, 29 bonds, 2 residues, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:280
6 atoms, 5 bonds, 1 residue, 1 model selected
> select #2/A:280-281
11 atoms, 10 bonds, 2 residues, 1 model selected
> show sel atoms
> color sel byhetero
> select #1/A:323
17 atoms, 16 bonds, 1 residue, 1 model selected
> select #1/A:323
17 atoms, 16 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:288
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:288
9 atoms, 8 bonds, 1 residue, 1 model selected
> show sel atoms
> color sel byhetero
> select #2/A:1
8 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A
2275 atoms, 2323 bonds, 288 residues, 1 model selected
> select #2/A:126
7 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:126-288
1318 atoms, 1350 bonds, 163 residues, 1 model selected
> select #2/A:112
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:112-288
1437 atoms, 1470 bonds, 177 residues, 1 model selected
> coulombic sel
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for AF-Q15014-F1-model_v4.pdb_A SES surface #2.1: minimum,
-17.15, mean 0.84, maximum 16.70
To also show corresponding color key, enter the above coulombic command and
add key true
> select clear
> select #1/A:212
21 atoms, 21 bonds, 1 residue, 1 model selected
> select #1/A:212
21 atoms, 21 bonds, 1 residue, 1 model selected
> select #1/A:200
21 atoms, 21 bonds, 1 residue, 1 model selected
> select #1/A:200
21 atoms, 21 bonds, 1 residue, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -25.17, mean
-3.564, maximum 24.96
To also show corresponding color key, enter the above mlp command and add key
true
> coulombic sel
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -15.58, mean
1.22, maximum 17.31
To also show corresponding color key, enter the above coulombic command and
add key true
> select #1/A:202
22 atoms, 21 bonds, 1 residue, 1 model selected
> select #1/A:202
22 atoms, 21 bonds, 1 residue, 1 model selected
> select #1/A:204
24 atoms, 23 bonds, 1 residue, 1 model selected
> select #1/A:204
24 atoms, 23 bonds, 1 residue, 1 model selected
> show sel atoms
> show sel surfaces
> select #1/A:200
21 atoms, 21 bonds, 1 residue, 1 model selected
> select #1/A:200
21 atoms, 21 bonds, 1 residue, 1 model selected
> select #1/A:200,204
45 atoms, 44 bonds, 2 residues, 1 model selected
> hide sel surfaces
> select #1/A:289
14 atoms, 13 bonds, 1 residue, 1 model selected
> select #1/A:289
14 atoms, 13 bonds, 1 residue, 1 model selected
> select #1/A:200,289
35 atoms, 34 bonds, 2 residues, 1 model selected
> select #1/A:200,204,289
59 atoms, 57 bonds, 3 residues, 1 model selected
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> select #2/A:112
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:112-288
1437 atoms, 1470 bonds, 177 residues, 1 model selected
> hide sel surfaces
> select clear
> select #2/A:60
4 atoms, 3 bonds, 1 residue, 1 model selected
> select #2/A:60-62
19 atoms, 18 bonds, 3 residues, 1 model selected
> select #2/A:273-274
11 atoms, 10 bonds, 2 residues, 1 model selected
> select #2/A:273-288
128 atoms, 130 bonds, 16 residues, 1 model selected
> select #2/A:267
6 atoms, 5 bonds, 1 residue, 1 model selected
> select #2/A:267-288
171 atoms, 174 bonds, 22 residues, 1 model selected
> show sel surfaces
> select
> #2/A:112-116,127-129,131-141,155-169,173-198,201-203,205-213,219-221,225-241,246-265,267-270,273-275,281-287
1019 atoms, 1029 bonds, 126 residues, 1 model selected
> select #2/A:155
7 atoms, 6 bonds, 1 residue, 1 model selected
> select #2/A:155-160
45 atoms, 44 bonds, 6 residues, 1 model selected
> select #2/A:145
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:145-149
45 atoms, 45 bonds, 5 residues, 1 model selected
> select #2/A:142
11 atoms, 10 bonds, 1 residue, 1 model selected
> select #2/A:142-155
119 atoms, 120 bonds, 14 residues, 1 model selected
> select #2/A:137-138
22 atoms, 23 bonds, 2 residues, 1 model selected
> select #2/A:137-154
156 atoms, 159 bonds, 18 residues, 1 model selected
> show sel surfaces
> select clear
> select #2/A:156
8 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:156
8 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:131-132
21 atoms, 23 bonds, 2 residues, 1 model selected
> select #2/A:131-141
97 atoms, 101 bonds, 11 residues, 1 model selected
> show sel surfaces
> select clear
> select #1/A:170
12 atoms, 11 bonds, 1 residue, 1 model selected
> select #1/A:170-177
136 atoms, 137 bonds, 8 residues, 1 model selected
> show sel surfaces
> select #1/A:302
11 atoms, 10 bonds, 1 residue, 1 model selected
> select #1/A:302-323
334 atoms, 339 bonds, 22 residues, 1 model selected
> show sel surfaces
> select #1/A:290-291
40 atoms, 40 bonds, 2 residues, 1 model selected
> select #1/A:290-323
550 atoms, 559 bonds, 34 residues, 1 model selected
> show sel surfaces
> select #1/A:271
7 atoms, 6 bonds, 1 residue, 1 model selected
> select #1/A:271-323
841 atoms, 852 bonds, 53 residues, 1 model selected
> show sel surfaces
> select #2/A:112
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:112-288
1437 atoms, 1470 bonds, 177 residues, 1 model selected
> hide sel surfaces
> select #1/A:166-167
38 atoms, 40 bonds, 2 residues, 1 model selected
> select #1/A:166-192
465 atoms, 472 bonds, 27 residues, 1 model selected
> show sel surfaces
> select #1/A:248
12 atoms, 11 bonds, 1 residue, 1 model selected
> select add #2/A:212
20 atoms, 18 bonds, 2 residues, 3 models selected
> select subtract #2/A:212
12 atoms, 11 bonds, 1 residue, 3 models selected
> select add #2/A:212
20 atoms, 18 bonds, 2 residues, 3 models selected
> select add #1/A:247
30 atoms, 27 bonds, 3 residues, 4 models selected
> select #2/A:112-288
1437 atoms, 1470 bonds, 177 residues, 1 model selected
> select #1/A:247
10 atoms, 9 bonds, 1 residue, 1 model selected
> select #1/A:247-248
22 atoms, 21 bonds, 2 residues, 1 model selected
> show sel surfaces
> hide sel surfaces
> select #1/A:236-237
42 atoms, 42 bonds, 2 residues, 1 model selected
> select #1/A:236-248
218 atoms, 220 bonds, 13 residues, 1 model selected
> show sel surfaces
> select #1/A:207
14 atoms, 13 bonds, 1 residue, 1 model selected
> select #1/A:207-323
1878 atoms, 1903 bonds, 117 residues, 1 model selected
> hide sel surfaces
> select #1/A:162-163
30 atoms, 29 bonds, 2 residues, 1 model selected
> select #1/A:162-323
2645 atoms, 2680 bonds, 162 residues, 1 model selected
> hide sel surfaces
> select clear
Drag select of 21 atoms, 18 residues, 17 bonds
Drag select of 11 atoms, 26 residues, 6 bonds
Drag select of 31 atoms, 18 residues, 30 bonds
Drag select of 6 residues, 1 atoms
> select add #1/A:321
516 atoms, 57 bonds, 41 residues, 4 models selected
> select add #1/A:183
537 atoms, 78 bonds, 42 residues, 4 models selected
> select add #2/A:149
545 atoms, 85 bonds, 43 residues, 4 models selected
> show sel surfaces
> select clear
[Repeated 2 time(s)]
> select #1/A:50
14 atoms, 13 bonds, 1 residue, 1 model selected
> select clear
> select #2/A:280
6 atoms, 5 bonds, 1 residue, 1 model selected
> show sel surfaces
> select clear
> hide surfaces
> select #1/A:154
16 atoms, 15 bonds, 1 residue, 1 model selected
> select #1/A:154
16 atoms, 15 bonds, 1 residue, 1 model selected
> select #1/A:302
11 atoms, 10 bonds, 1 residue, 1 model selected
> select #1/A:302-323
334 atoms, 339 bonds, 22 residues, 1 model selected
> show sel surfaces
> select #1/A:170
12 atoms, 11 bonds, 1 residue, 1 model selected
> select #1/A:170-189
353 atoms, 357 bonds, 20 residues, 1 model selected
> show sel surfaces
> select clear
> select #2/A:78
8 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:78-81
35 atoms, 34 bonds, 4 residues, 1 model selected
> select #2/A:135
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:135-154
173 atoms, 176 bonds, 20 residues, 1 model selected
> select #2/A:262
12 atoms, 12 bonds, 1 residue, 1 model selected
> select #2/A:262-288
213 atoms, 217 bonds, 27 residues, 1 model selected
> select #2/A:266
8 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:266-288
179 atoms, 182 bonds, 23 residues, 1 model selected
> select #2/A:267
6 atoms, 5 bonds, 1 residue, 1 model selected
> select #2/A:267-288
171 atoms, 174 bonds, 22 residues, 1 model selected
> select #2/A:131,267-288
178 atoms, 181 bonds, 23 residues, 1 model selected
> select #2/A:131,267-288
178 atoms, 181 bonds, 23 residues, 1 model selected
> select #2/A:131,267-288
178 atoms, 181 bonds, 23 residues, 1 model selected
> select #2/A:131,135-154,267-288
351 atoms, 357 bonds, 43 residues, 1 model selected
> select #2/A:131,135-154,267-288
351 atoms, 357 bonds, 43 residues, 1 model selected
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
[Repeated 1 time(s)]
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
No map chosen to save
[Repeated 1 time(s)]
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRG15 Surface 1.tif" width 749 height 533 supersample 3
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> select #1/A:170-171
24 atoms, 23 bonds, 2 residues, 1 model selected
> select #1/A:170-196
457 atoms, 461 bonds, 27 residues, 1 model selected
> hide sel surfaces
> select #1/A:295
19 atoms, 18 bonds, 1 residue, 1 model selected
> select #1/A:295-323
461 atoms, 467 bonds, 29 residues, 1 model selected
> hide sel surfaces
> select clear
> select #2/A:131-154,267-288
380 atoms, 389 bonds, 46 residues, 1 model selected
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> select #1/A:166
14 atoms, 14 bonds, 1 residue, 1 model selected
> select #1/A:166-189
426 atoms, 433 bonds, 24 residues, 1 model selected
> select #1/A:166-189,307-323
686 atoms, 697 bonds, 41 residues, 1 model selected
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> select clear
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRGX Surface 1.tif" width 749 height 533 supersample 3
> select #1/A:166
14 atoms, 14 bonds, 1 residue, 1 model selected
> select #1/A:166-323
2574 atoms, 2609 bonds, 158 residues, 1 model selected
> show sel surfaces
> select #2/A:127
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:127-288
1311 atoms, 1342 bonds, 162 residues, 1 model selected
> hide sel surfaces
> select clear
> select #1/A:161
14 atoms, 14 bonds, 1 residue, 1 model selected
> select #1/A:161-323
2659 atoms, 2695 bonds, 163 residues, 1 model selected
> show sel surfaces
> select clear
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRG15 Surface 2.tif" width 749 height 533 supersample 3
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRG15 Surface 3.tif" width 749 height 533 supersample 3
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRG15 Surface 4.tif" width 749 height 533 supersample 3
> select #1/A:161
14 atoms, 14 bonds, 1 residue, 1 model selected
> select #1/A:161-323
2659 atoms, 2695 bonds, 163 residues, 1 model selected
> hide sel surfaces
> select #2/A:126-127
16 atoms, 16 bonds, 2 residues, 1 model selected
> select #2/A:126-288
1318 atoms, 1350 bonds, 163 residues, 1 model selected
> show sel surfaces
> select clear
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRGX Surface 2.tif" width 749 height 533 supersample 3
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRGX Surface 3.tif" width 749 height 533 supersample 3
> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRGX Surface 4.tif" width 749 height 533 supersample 3
> select #1/A:161
14 atoms, 14 bonds, 1 residue, 1 model selected
> select #1/A:161-323
2659 atoms, 2695 bonds, 163 residues, 1 model selected
> select #2/A:126
7 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:126-288
1318 atoms, 1350 bonds, 163 residues, 1 model selected
> hide sel surfaces
> select clear
> select #1/A:161
14 atoms, 14 bonds, 1 residue, 1 model selected
> select #1/A:161-323
2659 atoms, 2695 bonds, 163 residues, 1 model selected
> mlp sel
Map values for surface "ranked_0.pdb_A SES surface": minimum -25.17, mean
-3.564, maximum 24.96
To also show corresponding color key, enter the above mlp command and add key
true
> select clear
> select #1/A:161
14 atoms, 14 bonds, 1 residue, 1 model selected
> select #1/A:161-323
2659 atoms, 2695 bonds, 163 residues, 1 model selected
> hide sel surfaces
> select #2/A:126
7 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:126-288
1318 atoms, 1350 bonds, 163 residues, 1 model selected
> show sel surfaces
> mlp sel
Map values for surface "AF-Q15014-F1-model_v4.pdb_A SES surface": minimum
-26.64, mean -5.47, maximum 23.64
To also show corresponding color key, enter the above mlp command and add key
true
> select clear
> select #1/A:161
14 atoms, 14 bonds, 1 residue, 1 model selected
> select #1/A:161-323
2659 atoms, 2695 bonds, 163 residues, 1 model selected
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> hide sel surfaces
> select clear
> select #1/A:161
14 atoms, 14 bonds, 1 residue, 1 model selected
> select #1/A:161-323
2659 atoms, 2695 bonds, 163 residues, 1 model selected
> hide sel surfaces
> select #2/A:126
7 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:126-288
1318 atoms, 1350 bonds, 163 residues, 1 model selected
> hide sel surfaces
> select clear
> select #1/A:140-141
28 atoms, 27 bonds, 2 residues, 1 model selected
> select #1/A:140-141
28 atoms, 27 bonds, 2 residues, 1 model selected
> select #2/A:112
9 atoms, 8 bonds, 1 residue, 1 model selected
> select #2/A:112-116
43 atoms, 43 bonds, 5 residues, 1 model selected
> select #1/A:89
17 atoms, 16 bonds, 1 residue, 1 model selected
> select #1/A:89-93
68 atoms, 67 bonds, 5 residues, 1 model selected
> select #2/A:1
8 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:1-33
265 atoms, 267 bonds, 33 residues, 1 model selected
> select #2/A:56-57
11 atoms, 11 bonds, 2 residues, 1 model selected
> select #2/A:56-62
55 atoms, 57 bonds, 7 residues, 1 model selected
> select #2/A:34
8 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:34-111
573 atoms, 584 bonds, 78 residues, 1 model selected
> mlp sel
Map values for surface "AF-Q15014-F1-model_v4.pdb_A SES surface": minimum
-26.64, mean -5.47, maximum 23.64
To also show corresponding color key, enter the above mlp command and add key
true
> coulombic sel
Coulombic values for AF-Q15014-F1-model_v4.pdb_A SES surface #2.1: minimum,
-17.15, mean 0.84, maximum 16.70
To also show corresponding color key, enter the above coulombic command and
add key true
> select #2/A:53
7 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:53-71
133 atoms, 138 bonds, 19 residues, 1 model selected
> mlp sel
Map values for surface "AF-Q15014-F1-model_v4.pdb_A SES surface": minimum
-26.64, mean -5.47, maximum 23.64
To also show corresponding color key, enter the above mlp command and add key
true
> coulombic sel
Coulombic values for AF-Q15014-F1-model_v4.pdb_A SES surface #2.1: minimum,
-17.15, mean 0.84, maximum 16.70
To also show corresponding color key, enter the above coulombic command and
add key true
> select #1/A:88
22 atoms, 21 bonds, 1 residue, 1 model selected
> select #1/A:88-161
1170 atoms, 1177 bonds, 74 residues, 1 model selected
> hide sel surfaces
> select #2/A:53
7 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:53-115
470 atoms, 481 bonds, 63 residues, 1 model selected
> hide sel surfaces
> select clear
> select #2/A:1
8 atoms, 7 bonds, 1 residue, 1 model selected
> select #2/A:1-33
265 atoms, 267 bonds, 33 residues, 1 model selected
> show sel surfaces
> hide sel surfaces
> select clear
> close session
> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG15/ranked_0.pdb"
Chain information for ranked_0.pdb #1
---
Chain | Description
A | No description available
> select /A:1-323
5271 atoms, 5335 bonds, 323 residues, 1 model selected
> color sel cornflower blue
> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MSLH3/AF-Q8N5Y2-F1-model_v4.pdb"
AF-Q8N5Y2-F1-model_v4.pdb title:
Alphafold monomer V2.0 prediction for male-specific lethal 3 homolog (Q8N5Y2)
[more info...]
Chain information for AF-Q8N5Y2-F1-model_v4.pdb #2
---
Chain | Description | UniProt
A | male-specific lethal 3 homolog | MS3L1_HUMAN
> select #2/A:1-521
4212 atoms, 4311 bonds, 521 residues, 1 model selected
> color sel hot pink
> ui tool show Matchmaker
> matchmaker #2 to #1
Parameters
---
Chain pairing | bb
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker ranked_0.pdb, chain A (#1) with AF-Q8N5Y2-F1-model_v4.pdb, chain A
(#2), sequence alignment score = 494.6
RMSD between 136 pruned atom pairs is 0.606 angstroms; (across all 320 pairs:
37.193)
> select clear
> ui tool show Matchmaker
Traceback (most recent call last):
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/core/triggerset.py", line 134, in invoke
return self._func(self._name, data)
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 50, in <lambda>
data[0] == pself.attr_name and (setattr(pself, "value", pself.get_attribute())
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 342, in set_value
self.__button_group.button(self.values.index(value)).setChecked(True)
AttributeError: 'NoneType' object has no attribute 'setChecked'
Error processing trigger "setting changed":
AttributeError: 'NoneType' object has no attribute 'setChecked'
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 342, in set_value
self.__button_group.button(self.values.index(value)).setChecked(True)
See log for complete Python traceback.
OpenGL version: 4.1 INTEL-12.10.12
OpenGL renderer: Intel Iris OpenGL Engine
OpenGL vendor: Intel Inc.
Python: 3.9.11
Locale: UTF-8
Qt version: PyQt6 6.3.1, Qt 6.3.1
Qt runtime version: 6.3.2
Qt platform: cocoa
Hardware:
Hardware Overview:
Model Name: MacBook Pro
Model Identifier: MacBookPro11,1
Processor Name: Intel Core i5
Processor Speed: 2.6 GHz
Number of Processors: 1
Total Number of Cores: 2
L2 Cache (per Core): 256 KB
L3 Cache: 3 MB
Hyper-Threading Technology: Enabled
Memory: 8 GB
Boot ROM Version: 156.0.0.0.0
SMC Version (system): 2.16f68
Software:
System Software Overview:
System Version: macOS 10.14.6 (18G103)
Kernel Version: Darwin 18.7.0
Time since boot: 96 days 3:37
Graphics/Displays:
Intel Iris:
Chipset Model: Intel Iris
Type: GPU
Bus: Built-In
VRAM (Dynamic, Max): 1536 MB
Vendor: Intel
Device ID: 0x0a2e
Revision ID: 0x0009
Metal: Supported, feature set macOS GPUFamily1 v4
Displays:
Color LCD:
Display Type: Built-In Retina LCD
Resolution: 2560 x 1600 Retina
Framebuffer Depth: 24-Bit Color (ARGB8888)
Main Display: Yes
Mirror: Off
Online: Yes
Rotation: Supported
Automatically Adjust Brightness: No
Installed Packages:
alabaster: 0.7.12
appdirs: 1.4.4
appnope: 0.1.3
asttokens: 2.1.0
Babel: 2.11.0
backcall: 0.2.0
blockdiag: 3.0.0
build: 0.8.0
certifi: 2021.10.8
cftime: 1.6.2
charset-normalizer: 2.1.1
ChimeraX-AddCharge: 1.4
ChimeraX-AddH: 2.2.1
ChimeraX-AlignmentAlgorithms: 2.0
ChimeraX-AlignmentHdrs: 3.2.1
ChimeraX-AlignmentMatrices: 2.0
ChimeraX-Alignments: 2.6
ChimeraX-AlphaFold: 1.0
ChimeraX-AltlocExplorer: 1.0.3
ChimeraX-AmberInfo: 1.0
ChimeraX-Arrays: 1.0
ChimeraX-Atomic: 1.41.5
ChimeraX-AtomicLibrary: 8.0.3
ChimeraX-AtomSearch: 2.0.1
ChimeraX-AxesPlanes: 2.3
ChimeraX-BasicActions: 1.1.2
ChimeraX-BILD: 1.0
ChimeraX-BlastProtein: 2.1.2
ChimeraX-BondRot: 2.0.1
ChimeraX-BugReporter: 1.0.1
ChimeraX-BuildStructure: 2.7.1
ChimeraX-Bumps: 1.0
ChimeraX-BundleBuilder: 1.2
ChimeraX-ButtonPanel: 1.0.1
ChimeraX-CageBuilder: 1.0.1
ChimeraX-CellPack: 1.0
ChimeraX-Centroids: 1.3.1
ChimeraX-ChangeChains: 1.0.2
ChimeraX-CheckWaters: 1.3
ChimeraX-ChemGroup: 2.0
ChimeraX-Clashes: 2.2.4
ChimeraX-ColorActions: 1.0.3
ChimeraX-ColorGlobe: 1.0
ChimeraX-ColorKey: 1.5.2
ChimeraX-CommandLine: 1.2.4
ChimeraX-ConnectStructure: 2.0.1
ChimeraX-Contacts: 1.0.1
ChimeraX-Core: 1.5
ChimeraX-CoreFormats: 1.1
ChimeraX-coulombic: 1.3.2
ChimeraX-Crosslinks: 1.0
ChimeraX-Crystal: 1.0
ChimeraX-CrystalContacts: 1.0.1
ChimeraX-DataFormats: 1.2.2
ChimeraX-Dicom: 1.1
ChimeraX-DistMonitor: 1.3
ChimeraX-DockPrep: 1.0
ChimeraX-Dssp: 2.0
ChimeraX-EMDB-SFF: 1.0
ChimeraX-ExperimentalCommands: 1.0
ChimeraX-FileHistory: 1.0.1
ChimeraX-FunctionKey: 1.0.1
ChimeraX-Geometry: 1.2
ChimeraX-gltf: 1.0
ChimeraX-Graphics: 1.1
ChimeraX-Hbonds: 2.4
ChimeraX-Help: 1.2.1
ChimeraX-HKCage: 1.3
ChimeraX-IHM: 1.1
ChimeraX-ImageFormats: 1.2
ChimeraX-IMOD: 1.0
ChimeraX-IO: 1.0.1
ChimeraX-ItemsInspection: 1.0.1
ChimeraX-Label: 1.1.7
ChimeraX-ListInfo: 1.1.1
ChimeraX-Log: 1.1.5
ChimeraX-LookingGlass: 1.1
ChimeraX-Maestro: 1.8.2
ChimeraX-Map: 1.1.2
ChimeraX-MapData: 2.0
ChimeraX-MapEraser: 1.0.1
ChimeraX-MapFilter: 2.0
ChimeraX-MapFit: 2.0
ChimeraX-MapSeries: 2.1.1
ChimeraX-Markers: 1.0.1
ChimeraX-Mask: 1.0.1
ChimeraX-MatchMaker: 2.0.9
ChimeraX-MDcrds: 2.6
ChimeraX-MedicalToolbar: 1.0.2
ChimeraX-Meeting: 1.0.1
ChimeraX-MLP: 1.1
ChimeraX-mmCIF: 2.8
ChimeraX-MMTF: 2.2
ChimeraX-Modeller: 1.5.6
ChimeraX-ModelPanel: 1.3.6
ChimeraX-ModelSeries: 1.0.1
ChimeraX-Mol2: 2.0
ChimeraX-Mole: 1.0
ChimeraX-Morph: 1.0.1
ChimeraX-MouseModes: 1.1.1
ChimeraX-Movie: 1.0
ChimeraX-Neuron: 1.0
ChimeraX-Nucleotides: 2.0.3
ChimeraX-OpenCommand: 1.9.1
ChimeraX-PDB: 2.6.8
ChimeraX-PDBBio: 1.0
ChimeraX-PDBLibrary: 1.0.2
ChimeraX-PDBMatrices: 1.0
ChimeraX-PickBlobs: 1.0.1
ChimeraX-Positions: 1.0
ChimeraX-PresetMgr: 1.1
ChimeraX-PubChem: 2.1
ChimeraX-ReadPbonds: 1.0.1
ChimeraX-Registration: 1.1.1
ChimeraX-RemoteControl: 1.0
ChimeraX-RenumberResidues: 1.1
ChimeraX-ResidueFit: 1.0.1
ChimeraX-RestServer: 1.1
ChimeraX-RNALayout: 1.0
ChimeraX-RotamerLibMgr: 2.0.1
ChimeraX-RotamerLibsDunbrack: 2.0
ChimeraX-RotamerLibsDynameomics: 2.0
ChimeraX-RotamerLibsRichardson: 2.0
ChimeraX-SaveCommand: 1.5.1
ChimeraX-SchemeMgr: 1.0
ChimeraX-SDF: 2.0
ChimeraX-Segger: 1.0
ChimeraX-Segment: 1.0
ChimeraX-SelInspector: 1.0
ChimeraX-SeqView: 2.7.2
ChimeraX-Shape: 1.0.1
ChimeraX-Shell: 1.0.1
ChimeraX-Shortcuts: 1.1.1
ChimeraX-ShowSequences: 1.0.1
ChimeraX-SideView: 1.0.1
ChimeraX-Smiles: 2.1
ChimeraX-SmoothLines: 1.0
ChimeraX-SpaceNavigator: 1.0
ChimeraX-StdCommands: 1.10
ChimeraX-STL: 1.0
ChimeraX-Storm: 1.0
ChimeraX-StructMeasure: 1.1
ChimeraX-Struts: 1.0.1
ChimeraX-Surface: 1.0
ChimeraX-SwapAA: 2.0.1
ChimeraX-SwapRes: 2.1.3
ChimeraX-TapeMeasure: 1.0
ChimeraX-Test: 1.0
ChimeraX-Toolbar: 1.1.2
ChimeraX-ToolshedUtils: 1.2.1
ChimeraX-Tug: 1.0.1
ChimeraX-UI: 1.24.3
ChimeraX-uniprot: 2.2.1
ChimeraX-UnitCell: 1.0.1
ChimeraX-ViewDockX: 1.1.4
ChimeraX-VIPERdb: 1.0
ChimeraX-Vive: 1.1
ChimeraX-VolumeMenu: 1.0.1
ChimeraX-VTK: 1.0
ChimeraX-WavefrontOBJ: 1.0
ChimeraX-WebCam: 1.0.1
ChimeraX-WebServices: 1.1.0
ChimeraX-Zone: 1.0.1
colorama: 0.4.5
cxservices: 1.2
cycler: 0.11.0
Cython: 0.29.32
debugpy: 1.6.4
decorator: 5.1.1
docutils: 0.19
entrypoints: 0.4
executing: 1.2.0
filelock: 3.7.1
fonttools: 4.38.0
funcparserlib: 1.0.1
grako: 3.16.5
h5py: 3.7.0
html2text: 2020.1.16
idna: 3.4
ihm: 0.33
imagecodecs: 2022.7.31
imagesize: 1.4.1
importlib-metadata: 5.1.0
ipykernel: 6.15.3
ipython: 8.4.0
ipython-genutils: 0.2.0
jedi: 0.18.1
Jinja2: 3.1.2
jupyter-client: 7.3.4
jupyter-core: 5.1.0
kiwisolver: 1.4.4
line-profiler: 3.5.1
lxml: 4.9.1
lz4: 4.0.2
MarkupSafe: 2.1.1
matplotlib: 3.5.2
matplotlib-inline: 0.1.6
msgpack: 1.0.4
nest-asyncio: 1.5.6
netCDF4: 1.6.0
networkx: 2.8.5
numexpr: 2.8.4
numpy: 1.23.1
openvr: 1.23.701
packaging: 21.3
ParmEd: 3.4.3
parso: 0.8.3
pep517: 0.13.0
pexpect: 4.8.0
pickleshare: 0.7.5
Pillow: 9.2.0
pip: 22.2.2
pkginfo: 1.8.3
platformdirs: 2.5.4
prompt-toolkit: 3.0.33
psutil: 5.9.1
ptyprocess: 0.7.0
pure-eval: 0.2.2
pycollada: 0.7.2
pydicom: 2.3.0
Pygments: 2.12.0
PyOpenGL: 3.1.5
PyOpenGL-accelerate: 3.1.5
pyparsing: 3.0.9
PyQt6-commercial: 6.3.1
PyQt6-Qt6: 6.3.2
PyQt6-sip: 13.4.0
PyQt6-WebEngine-commercial: 6.3.1
PyQt6-WebEngine-Qt6: 6.3.2
python-dateutil: 2.8.2
pytz: 2022.6
pyzmq: 24.0.1
qtconsole: 5.3.1
QtPy: 2.3.0
RandomWords: 0.4.0
requests: 2.28.1
scipy: 1.9.0
setuptools: 65.1.1
setuptools-scm: 7.0.5
sfftk-rw: 0.7.2
six: 1.16.0
snowballstemmer: 2.2.0
sortedcontainers: 2.4.0
Sphinx: 5.1.1
sphinx-autodoc-typehints: 1.19.1
sphinxcontrib-applehelp: 1.0.2
sphinxcontrib-blockdiag: 3.0.0
sphinxcontrib-devhelp: 1.0.2
sphinxcontrib-htmlhelp: 2.0.0
sphinxcontrib-jsmath: 1.0.1
sphinxcontrib-qthelp: 1.0.3
sphinxcontrib-serializinghtml: 1.1.5
stack-data: 0.6.2
tables: 3.7.0
tifffile: 2022.7.31
tinyarray: 1.2.4
tomli: 2.0.1
tornado: 6.2
traitlets: 5.3.0
typing-extensions: 4.4.0
urllib3: 1.26.13
wcwidth: 0.2.5
webcolors: 1.12
wheel: 0.37.1
wheel-filename: 1.4.1
zipp: 3.11.0
Change History (2)
comment:1 by , 4 years ago
| Component: | Unassigned → Structure Comparison |
|---|---|
| Owner: | set to |
| Platform: | → all |
| Project: | → ChimeraX |
| Status: | new → accepted |
| Summary: | ChimeraX bug report submission → MatchMaker: 'NoneType' object has no attribute 'setChecked' |
comment:2 by , 4 years ago
| Resolution: | → can't reproduce |
|---|---|
| Status: | accepted → closed |
Note:
See TracTickets
for help on using tickets.