Opened 4 years ago

Closed 4 years ago

#8450 closed defect (can't reproduce)

MatchMaker: 'NoneType' object has no attribute 'setChecked'

Reported by: chimerax-bug-report@… Owned by: Eric Pettersen
Priority: normal Milestone:
Component: Structure Comparison Version:
Keywords: Cc:
Blocked By: Blocking:
Notify when closed: Platform: all
Project: ChimeraX

Description

The following bug report has been submitted:
Platform:        macOS-10.14.6-x86_64-i386-64bit
ChimeraX Version: 1.5 (2022-11-24 00:03:27 UTC)
Description
(Describe the actions that caused this problem to occur here)

Log:
UCSF ChimeraX version: 1.5 (2022-11-24)  
© 2016-2022 Regents of the University of California. All rights reserved.  

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/H2AH2B MRGRKK.cxs" format session

Log from Fri Jan 6 13:28:28 2023UCSF ChimeraX version: 1.5 (2022-11-24)  
© 2016-2022 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> color sel hot pink

> select /B:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> color sel cornflower blue

> select /C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> color sel orange

> select /A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> style sel sphere

Changed 2063 atom styles  

> style sel sphere

Changed 2063 atom styles  

> show target m

> style sel ball

Changed 2063 atom styles  

> select clear

> style sphere

Changed 4347 atom styles  

> select /A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> surface sel

> select /B:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> show sel surfaces

> select clear

> coulombic

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -15.50, mean
3.92, maximum 18.48  
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -8.85, mean
4.00, maximum 21.45  
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -9.90, mean
4.01, maximum 12.56  
To also show corresponding color key, enter the above coulombic command and
add key true  

> undo

> select /C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> hide sel surfaces

> select /B:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> coulombic sel

Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -8.85, mean
4.00, maximum 21.45  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select /A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> coulombic sel

Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -15.50, mean
3.92, maximum 18.48  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select /C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> show sel atoms

> hide sel atoms

> hide sel cartoons

> show sel cartoons

> nucleotides sel atoms

> style nucleic & sel stick

Changed 0 atom styles  

> nucleotides sel atoms

> style nucleic & sel stick

Changed 0 atom styles  

> style sel ball

Changed 260 atom styles  

> show sel cartoons

> nucleotides sel atoms

> style nucleic & sel stick

Changed 0 atom styles  

> show sel atoms

> toolshed show

> select clear

[Repeated 1 time(s)]

> select /C:10@CA

1 atom, 1 residue, 1 model selected  

> select clear

[Repeated 2 time(s)]

> select /C:10@NH2

1 atom, 1 residue, 1 model selected  

> label (#!1 & sel) text "{0.name} {0.number}{0.insertion_code}"

> label (#!1 & sel) attribute name

> select clear

> select /C:5@CA

1 atom, 1 residue, 1 model selected  

> label (#!1 & sel) text "ARG 134"

> ui tool show "Color Actions"

> color sel black target l

> label height 3

> undo

> redo

> label height 1

> label height 1.5

> select clear

> select /C:6@CA

1 atom, 1 residue, 1 model selected  

> label (#!1 & sel) text "LYS 135"

> select /C:7@CA

1 atom, 1 residue, 1 model selected  

> label (#!1 & sel) text "LYS 136"

> select /C:8@CA

1 atom, 1 residue, 1 model selected  

> label (#!1 & sel) text "ARG 137"

> select /C:10

24 atoms, 23 bonds, 1 residue, 1 model selected  

> select /C:11

16 atoms, 15 bonds, 1 residue, 1 model selected  

> select /C:10

24 atoms, 23 bonds, 1 residue, 1 model selected  

> label (#!1 & sel) text ARG139

> select clear

> label height 1.5

> ui tool show "Color Actions"

> color black target l

> sequence chain #1/A

Alignment identifier is 1/A  

> ui tool show "Change Chain IDs"

> changechains A H2A

Chain IDs of 130 residues changed  

> changechains C MRG15

Proposed chain ID change would produce multiple residues with the samechain-
ID/number/insertion-code combo (MRG15/1/)  

> changechains C MRG

Proposed chain ID change would produce multiple residues with the samechain-
ID/number/insertion-code combo (MRG/1/)  

> help help:user/tools/changechains.html

> changechains C MRG

Proposed chain ID change would produce multiple residues with the samechain-
ID/number/insertion-code combo (MRG/1/)  

> changechains B H2B

No residues specified  

> changechains B H2B

No residues specified  

> select /A:1-130

Nothing selected  

> ui tool show "Change Chain IDs"

> changechains B H2B

No residues specified  
Cannot change to an empty ID  
[Repeated 1 time(s)]

> select /A:1-130

Nothing selected  

> sequence chain #1/A

Chains must have same sequence  

> sequence chain #1/A

Chains must have same sequence  

> undo

[Repeated 2 time(s)]

> redo

> select /A:1-130

Nothing selected  

> sequence chain #1/A

Chains must have same sequence  

> ui tool show "Change Chain IDs"

Must select one or more chain IDs from the list on the left  

> changechains H2A A

Chain IDs of 130 residues changed  

> sequence chain #1/A

Alignment identifier is 1/A  

> ui mousemode right "move label"

[Repeated 1 time(s)]

> ui mousemode right select

> ui mousemode right rotate

> ui mousemode right translate

> ui mousemode right rotate

> ui mousemode right translate

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/Image1.tif" width 704 height 533 supersample 3

> ui tool show Contacts

> select /C:10@CA

1 atom, 1 residue, 1 model selected  

> select /C:8

24 atoms, 23 bonds, 1 residue, 1 model selected  

> select add /C:10

48 atoms, 46 bonds, 2 residues, 2 models selected  

> select add /C:7

70 atoms, 67 bonds, 3 residues, 2 models selected  

> select add /A:61@CB

71 atoms, 67 bonds, 4 residues, 2 models selected  

> select subtract /A:61@CB

70 atoms, 67 bonds, 3 residues, 3 models selected  

> select add /C:6

92 atoms, 88 bonds, 4 residues, 2 models selected  

> select add /C:5@CA

93 atoms, 88 bonds, 5 residues, 2 models selected  

> select subtract /C:5

92 atoms, 88 bonds, 4 residues, 2 models selected  

> select add /C:5

116 atoms, 111 bonds, 5 residues, 2 models selected  

> style sel stick

Changed 116 atom styles  

> show sel cartoons

> hbonds sel reveal true

3 hydrogen bonds found  

> hbonds sel reveal true

3 hydrogen bonds found  

> undo

> ~hbonds

[Repeated 2 time(s)]

> undo

> hbonds sel reveal true

3 hydrogen bonds found  

> ~hbonds

> ui tool show H-Bonds

> hbonds sel interModel false intraModel false saltOnly true intraMol false
> intraRes false reveal true

0 hydrogen bonds found  

> select clear

> ~hbonds

[Repeated 5 time(s)]

> select /A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> hide sel surfaces

> select /B:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> hide sel surfaces

> ~hbonds

[Repeated 2 time(s)]

> select /A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> ~hbonds

> select /C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> ~hbonds

[Repeated 1 time(s)]

> select clear

> style stick

Changed 4347 atom styles  

> hide cartoons

> show cartoons

> nucleotides atoms

> style nucleic stick

Changed 0 atom styles  

> hide atoms

> select /A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> show sel surfaces

> select /B:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> show sel surfaces

> select clear

> select /C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> show sel atoms

> style sel stick

Changed 260 atom styles  

> style sel sphere

Changed 260 atom styles  

> style sel ball

Changed 260 atom styles  

> nucleotides sel atoms

> style nucleic & sel stick

Changed 0 atom styles  

> style sel stick

Changed 260 atom styles  

> color sel byhetero

> select clear

> select /C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> coulombic sel

Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -9.90, mean
4.01, maximum 12.56  
To also show corresponding color key, enter the above coulombic command and
add key true  

> color sel byhetero

> coulombic sel

Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -9.90, mean
4.01, maximum 12.56  
To also show corresponding color key, enter the above coulombic command and
add key true  

> hide sel surfaces

> color (#!1 & sel) byelement

> undo

> select clear

> select /C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> select clear

> ui tool show Contacts

> contacts intraModel false intraMol false ignoreHiddenModels true

No contacts  

> ui tool show H-Bonds

> hbonds interModel false intraModel false saltOnly true intraMol false
> intraRes false reveal true

0 hydrogen bonds found  

> ui tool show H-Bonds

> hbonds sel saltOnly true reveal true

Atom specifier selects no atoms  

> ui tool show H-Bonds

> hbonds saltOnly true reveal true

14 hydrogen bonds found  

> ~hbonds

> select clear

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/Image2.tif" width 704 height 533 supersample 3

> save /Users/Gareth/Desktop/image1.png supersample 3

> ui tool show Matchmaker

> save /Users/Gareth/Desktop/image2.png supersample 3

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/H2AH2B MRGRKK.cxs"

——— End of log from Fri Jan 6 13:28:28 2023 ———

opened ChimeraX session  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> close

> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRFAP1/MRFAP1-MRGBP/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel cornflower blue

> select /B:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> color sel hot pink

> select clear

> select /A:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -25.57, mean
-2.342, maximum 23.27  
To also show corresponding color key, enter the above mlp command and add key
true  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> color sel cornflower blue

> select /B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel hot pink

> select /C:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> color sel light sea green

> select clear

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -27.56, mean
-2.658, maximum 22.41  
To also show corresponding color key, enter the above mlp command and add key
true  

> select clear

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_1.pdb"

Chain information for ranked_1.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> color sel hot pink

> select /B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel medium blue

> select /C:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> color sel forest green

> select clear

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> mlp sel

Map values for surface "ranked_1.pdb_A SES surface": minimum -27.86, mean
-2.711, maximum 24.32  
To also show corresponding color key, enter the above mlp command and add key
true  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_2.pdb"

Chain information for ranked_2.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_2.pdb_A SES surface": minimum -26.55, mean
-2.543, maximum 23.83  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel orange

> select clear

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_3.pdb"

Chain information for ranked_3.pdb #2  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> close #1

> select #2/A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_3.pdb_A SES surface": minimum -27.31, mean
-2.509, maximum 23.55  
To also show corresponding color key, enter the above mlp command and add key
true  

> select #2/B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel orange

> close

> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRFAP1/MRFAP1-MRGBP/ranked_1.pdb"

Chain information for ranked_1.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> select /B:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> show sel surfaces

> close

> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRFAP1/MRFAP1-MRGBP/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> select /B:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> show sel surfaces

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> show cartoons

> hide atoms

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> color sel hot pink

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -15.29, mean
4.32, maximum 18.71  
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -17.23, mean
3.98, maximum 19.16  
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -9.58, mean
5.06, maximum 15.99  
Coulombic values for ranked_0.pdb_D SES surface #1.4: minimum, -10.13, mean
4.57, maximum 16.13  
Coulombic values for ranked_0.pdb_E SES surface #1.5: minimum, -16.33, mean
2.45, maximum 16.99  
Coulombic values for ranked_0.pdb_F SES surface #1.6: minimum, -14.44, mean
2.30, maximum 14.81  
Coulombic values for ranked_0.pdb_G SES surface #1.7: minimum, -9.16, mean
5.77, maximum 16.03  
Coulombic values for ranked_0.pdb_H SES surface #1.8: minimum, -8.89, mean
5.66, maximum 16.30  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select clear

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> show sel atoms

> style sel stick

Changed 329 atom styles  

> color sel byhetero

> select clear

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/ranked_0.pdb"

Chain information for ranked_0.pdb #2  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> ui tool show Matchmaker

> matchmaker #2 to #1

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain B (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 608.6  
RMSD between 89 pruned atom pairs is 0.844 angstroms; (across all 130 pairs:
22.712)  
  

> ui tool show Matchmaker

> select /A:1-130

4126 atoms, 4150 bonds, 260 residues, 2 models selected  

> ui tool show Matchmaker

> matchmaker #2 to #1/A pairing bs

Parameters  
---  
Chain pairing | bs  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 591.8  
RMSD between 87 pruned atom pairs is 1.118 angstroms; (across all 130 pairs:
21.387)  
  

> select clear

> select #2/C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> color sel orange

> select clear

> select #2/C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> show sel atoms

> color sel byhetero

> close #2

> open 3x1s

3x1s title:  
Crystal structure of the nucleosome core particle [more info...]  
  
Chain information for 3x1s #2  
---  
Chain | Description | UniProt  
A E | Histone H3.1 | H31_HUMAN  
B F | Histone H4 | H4_HUMAN  
C G | Histone H2A type 1-B/E | H2A1B_HUMAN  
D H | Histone H2B type 1-B | H2B1B_HUMAN  
I J | DNA (146-MER) |  
  
Non-standard residues in 3x1s #2  
---  
CL — chloride ion  
MN — manganese (II) ion  
  

> hide surfaces

> show cartoons

> hide atoms

> ui tool show Matchmaker

> matchmaker #!2 to #1

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain B (#1) with 3x1s, chain G (#2), sequence
alignment score = 568.5  
RMSD between 94 pruned atom pairs is 0.976 angstroms; (across all 104 pairs:
1.568)  
  

> select #1/A

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> show sel surfaces

> select #1/B

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> show sel surfaces

> select #1/C

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> show sel surfaces

> select clear

> select #2/C:14-118

810 atoms, 820 bonds, 105 residues, 1 model selected  

> show sel surfaces

> hide sel surfaces

> close #2

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_1.pdb"

Chain information for ranked_1.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> show cartoons

> hide atoms

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> color sel yellow

> select clear

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_1.pdb_A SES surface #1.1: minimum, -21.67, mean
4.74, maximum 18.97  
Coulombic values for ranked_1.pdb_B SES surface #1.2: minimum, -12.65, mean
4.63, maximum 17.40  
Coulombic values for ranked_1.pdb_C SES surface #1.3: minimum, -9.89, mean
5.22, maximum 18.92  
Coulombic values for ranked_1.pdb_D SES surface #1.4: minimum, -9.69, mean
5.37, maximum 22.95  
Coulombic values for ranked_1.pdb_E SES surface #1.5: minimum, -14.14, mean
2.22, maximum 14.80  
Coulombic values for ranked_1.pdb_F SES surface #1.6: minimum, -15.51, mean
2.19, maximum 16.93  
Coulombic values for ranked_1.pdb_G SES surface #1.7: minimum, -8.06, mean
7.15, maximum 21.55  
Coulombic values for ranked_1.pdb_H SES surface #1.8: minimum, -8.79, mean
6.38, maximum 21.21  
To also show corresponding color key, enter the above coulombic command and
add key true  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_2.pdb"

Chain information for ranked_2.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> select clear

> show cartoons

> hide atoms

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_3.pdb"

Chain information for ranked_3.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide atoms

> show cartoons

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_4.pdb"

Chain information for ranked_4.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide atoms

> show cartoons

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_0.pdb" format pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> show cartoons

> hide atoms

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> color sel cornflower blue

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> color sel hot pink

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -15.29, mean
4.32, maximum 18.71  
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -17.23, mean
3.98, maximum 19.16  
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -9.58, mean
5.06, maximum 15.99  
Coulombic values for ranked_0.pdb_D SES surface #1.4: minimum, -10.13, mean
4.57, maximum 16.13  
Coulombic values for ranked_0.pdb_E SES surface #1.5: minimum, -16.33, mean
2.45, maximum 16.99  
Coulombic values for ranked_0.pdb_F SES surface #1.6: minimum, -14.44, mean
2.30, maximum 14.81  
Coulombic values for ranked_0.pdb_G SES surface #1.7: minimum, -9.16, mean
5.77, maximum 16.03  
Coulombic values for ranked_0.pdb_H SES surface #1.8: minimum, -8.89, mean
5.66, maximum 16.30  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select /D:28@CG

1 atom, 1 residue, 1 model selected  

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> show sel atoms

> style sel stick

Changed 329 atom styles  

> color sel byhetero

> select clear

> select /B:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> select /A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> select /C:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> select /E:1-103

1703 atoms, 1714 bonds, 103 residues, 1 model selected  

> select clear

> hide surfaces

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/ranked_0.pdb"

Chain information for ranked_0.pdb #2  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select #2/A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> color sel orange

> select #2/B:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> color sel orange

> select #2/C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> color sel light sea green

> show sel atoms

> color sel byhetero

> select clear

> ui tool show Matchmaker

> matchmaker #2 to #1/A pairing bs

Parameters  
---  
Chain pairing | bs  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 591.8  
RMSD between 87 pruned atom pairs is 1.118 angstroms; (across all 130 pairs:
21.387)  
  

> select clear

> show surfaces

> select #2/A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> hide sel surfaces

> select #2/A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> select #2/B:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> hide sel surfaces

> show sel cartoons

> select clear

> select #2/C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> hide sel surfaces

> select clear

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_I SES surface #1.9: minimum, -12.27, mean
2.58, maximum 12.25  
To also show corresponding color key, enter the above coulombic command and
add key true  

> hide sel surfaces

> select clear

> open 3x1s

3x1s title:  
Crystal structure of the nucleosome core particle [more info...]  
  
Chain information for 3x1s #3  
---  
Chain | Description | UniProt  
A E | Histone H3.1 | H31_HUMAN  
B F | Histone H4 | H4_HUMAN  
C G | Histone H2A type 1-B/E | H2A1B_HUMAN  
D H | Histone H2B type 1-B | H2B1B_HUMAN  
I J | DNA (146-MER) |  
  
Non-standard residues in 3x1s #3  
---  
CL — chloride ion  
MN — manganese (II) ion  
  

> show cartoons

> hide atoms

> ui tool show Matchmaker

Traceback (most recent call last):  
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/core/triggerset.py", line 134, in invoke  
return self._func(self._name, data)  
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 50, in <lambda>  
data[0] == pself.attr_name and (setattr(pself, "value", pself.get_attribute())  
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 342, in set_value  
self.__button_group.button(self.values.index(value)).setChecked(True)  
AttributeError: 'NoneType' object has no attribute 'setChecked'  
  
Error processing trigger "setting changed":  
AttributeError: 'NoneType' object has no attribute 'setChecked'  
  
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 342, in set_value  
self.__button_group.button(self.values.index(value)).setChecked(True)  
  
See log for complete Python traceback.  
  

> matchmaker #!3 to #1

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain B (#1) with 3x1s, chain G (#3), sequence
alignment score = 568.5  
RMSD between 94 pruned atom pairs is 0.976 angstroms; (across all 104 pairs:
1.568)  
  

> close #3

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer H2AH2B RKK comparison 1.tif" width
> 704 height 533 supersample 3

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer H2AH2B RKK comparison 2.tif" width
> 704 height 533 supersample 3

> select #2/C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> show sel atoms

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> show sel atoms

> select clear

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer H2AH2B RKK comparison 3.tif" width
> 704 height 533 supersample 3

> select #2/C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> hide sel cartoons

> hide sel atoms

> select #1/I:8

24 atoms, 23 bonds, 1 residue, 1 model selected  

> select add #1/I:9

46 atoms, 44 bonds, 2 residues, 2 models selected  

> select add #1/I:10

68 atoms, 65 bonds, 3 residues, 2 models selected  

> select add #1/I:11

92 atoms, 88 bonds, 4 residues, 2 models selected  

> select add #1/I:12

102 atoms, 97 bonds, 5 residues, 2 models selected  

> select add #1/I:13

126 atoms, 120 bonds, 6 residues, 2 models selected  

> label (#!1 & sel) attribute name

> label height 1

> ui tool show "Color Actions"

> color sel black target l

> color sel light gray target l

> color sel dark gray target l

> color sel lime target l

> color sel orange red target l

> color sel yellow target l

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer RKK 1.tif" width 704 height 533
> supersample 3

> select clear

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer RKK 2.tif" width 704 height 533
> supersample 3

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer RKK 3.tif" width 704 height 533
> supersample 3

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone Octamer RKK 4.tif" width 704 height 533
> supersample 3

> close

> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRFAP1/MRFAP1-MRGBP/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -25.57, mean
-2.342, maximum 23.27  
To also show corresponding color key, enter the above mlp command and add key
true  

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -18.85, mean
-3.64, maximum 9.54  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select /B:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  
Alignment identifier is 1/B  

> select /B:4

10 atoms, 9 bonds, 1 residue, 1 model selected  

> select /B:4-6

41 atoms, 40 bonds, 3 residues, 1 model selected  

> select /B:33

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select /B:33-42

153 atoms, 155 bonds, 10 residues, 1 model selected  

> select /B:74

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select /B:74-84

182 atoms, 184 bonds, 11 residues, 1 model selected  

> select /B:87-88

34 atoms, 33 bonds, 2 residues, 1 model selected  

> select /B:87-95

140 atoms, 140 bonds, 9 residues, 1 model selected  

> select /B:109

15 atoms, 14 bonds, 1 residue, 1 model selected  

> select /B:109-116

140 atoms, 139 bonds, 8 residues, 1 model selected  

> select /B:53

24 atoms, 23 bonds, 1 residue, 1 model selected  

> select /B:53-68

283 atoms, 286 bonds, 16 residues, 1 model selected  

> show sel atoms

> nucleotides sel atoms

> style nucleic & sel stick

Changed 0 atom styles  

> select /B:105

20 atoms, 20 bonds, 1 residue, 1 model selected  

> select /B:105-108

69 atoms, 70 bonds, 4 residues, 1 model selected  

> show sel atoms

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-BRD8/ranked_2.pdb"

Chain information for ranked_2.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_2.pdb_A SES surface": minimum -26.17, mean
-2.868, maximum 26.88  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel cornflower blue

Alignment identifier is 1/B  

> select /B:28

19 atoms, 18 bonds, 1 residue, 1 model selected  

> select /B:28-29

38 atoms, 37 bonds, 2 residues, 1 model selected  

> select /B:27

20 atoms, 20 bonds, 1 residue, 1 model selected  

> select /B:27-30

72 atoms, 73 bonds, 4 residues, 1 model selected  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-BRD8/ranked_1.pdb"

Chain information for ranked_1.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /C:1-169

2723 atoms, 2753 bonds, 169 residues, 1 model selected  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_1.pdb_A SES surface": minimum -26.28, mean
-2.805, maximum 23.27  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel cornflower blue

Alignment identifier is 1/B  

> select /B:27

20 atoms, 20 bonds, 1 residue, 1 model selected  

> select /B:27-31

88 atoms, 89 bonds, 5 residues, 1 model selected  

> select /B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_1.pdb_B SES surface #1.2: minimum, -19.57, mean
-3.44, maximum 10.58  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select /C:1-169

2723 atoms, 2753 bonds, 169 residues, 1 model selected  

> show sel surfaces

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-BRD8/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -25.69, mean
-2.822, maximum 22.88  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel cornflower blue

> select clear

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-Dimer + 2 AI
> Chromo/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -26.23, mean
-2.904, maximum 24.13  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_B SES surface": minimum -25.68, mean
-3.058, maximum 24.88  
To also show corresponding color key, enter the above mlp command and add key
true  

> select clear

> select /D:74

20 atoms, 20 bonds, 1 residue, 1 model selected  

> select /D:75

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select /D:76

16 atoms, 15 bonds, 1 residue, 1 model selected  

> select /D:77

14 atoms, 14 bonds, 1 residue, 1 model selected  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-Dimer-
> AIChromo/MRGDimer-Chromo.pdb"

Chain information for MRGDimer-Chromo.pdb #1  
---  
Chain | Description  
A B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "MRGDimer-Chromo.pdb_A SES surface": minimum -26.93,
mean -2.801, maximum 25.03  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> mlp sel

Map values for surface "MRGDimer-Chromo.pdb_B SES surface": minimum -25.16,
mean -2.832, maximum 22.62  
To also show corresponding color key, enter the above mlp command and add key
true  

> close

> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRFAP1/MRFAP1-MRGBP/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_4.pdb"

Chain information for ranked_4.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_3.pdb"

Chain information for ranked_3.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_2.pdb"

Chain information for ranked_2.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> mlp sel

Map values for surface "ranked_2.pdb_A SES surface": minimum -26.55, mean
-2.543, maximum 23.83  
To also show corresponding color key, enter the above mlp command and add key
true  

> select clear

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_1.pdb"

Chain information for ranked_1.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> mlp sel

Map values for surface "ranked_1.pdb_A SES surface": minimum -27.86, mean
-2.711, maximum 24.32  
To also show corresponding color key, enter the above mlp command and add key
true  

> select clear

> select /B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel cornflower blue

> select clear

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_0.pdb"

Chain information for ranked_0.pdb #2  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> ui tool show Matchmaker

> matchmaker #2 to #1

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_1.pdb, chain C (#1) with ranked_0.pdb, chain C (#2),
sequence alignment score = 1009.7  
RMSD between 115 pruned atom pairs is 0.680 angstroms; (across all 204 pairs:
18.787)  
  

> select #2/B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel hot pink

> select clear

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-BRD8/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -25.69, mean
-2.822, maximum 22.88  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel cornflower blue

Alignment identifier is 1/B  

> select /B:27

20 atoms, 20 bonds, 1 residue, 1 model selected  

> select /B:27-30

72 atoms, 73 bonds, 4 residues, 1 model selected  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-BRD8/ranked_1.pdb"

Chain information for ranked_1.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> mlp sel

Map values for surface "ranked_1.pdb_A SES surface": minimum -26.28, mean
-2.805, maximum 23.27  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  
Alignment identifier is 1/B  

> color sel cornflower blue

> select clear

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1/ranked_0.pdb"

Chain information for ranked_0.pdb #2  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select #2/A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> color sel orange

> select #2/B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel hot pink

> ui tool show Matchmaker

> matchmaker #!1 to #2/A pairing bs

Parameters  
---  
Chain pairing | bs  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain A (#2) with ranked_1.pdb, chain A (#1),
sequence alignment score = 846.6  
RMSD between 152 pruned atom pairs is 0.674 angstroms; (across all 168 pairs:
1.074)  
  

> select clear

> select #2/B:27

20 atoms, 20 bonds, 1 residue, 1 model selected  

> select add #1/B:27

40 atoms, 40 bonds, 2 residues, 2 models selected  

> select add #2/B:28

59 atoms, 58 bonds, 3 residues, 2 models selected  

> select add #1/B:28

78 atoms, 76 bonds, 4 residues, 2 models selected  

> select add #2/B:29

97 atoms, 94 bonds, 5 residues, 2 models selected  

> select add #2/B:30

111 atoms, 108 bonds, 6 residues, 2 models selected  

> select add #1/B:29

130 atoms, 126 bonds, 7 residues, 2 models selected  

> select add #1/B:30

144 atoms, 140 bonds, 8 residues, 2 models selected  

> show sel atoms

> color sel byhetero

> select #1/A:2@CE

1 atom, 1 residue, 1 model selected  

> select clear

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide atoms

> show cartoons

> color cornflower blue

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> color sel orange

> select clear

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #2  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide cartoons

> hide atoms

> show cartoons

> ui tool show Matchmaker

> matchmaker #2 to #1

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain C (#1) with ranked_0.pdb, chain D (#2),
sequence alignment score = 627.4  
RMSD between 105 pruned atom pairs is 0.661 angstroms; (across all 126 pairs:
1.964)  
  

> select #2/A

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> color sel hot pink

> select #2/B

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> color sel hot pink

> select #2/C

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> color sel hot pink

> select #2/D

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> color sel hot pink

> select #2/E

1703 atoms, 1714 bonds, 103 residues, 1 model selected  

> color sel hot pink

> select #2/F

1703 atoms, 1714 bonds, 103 residues, 1 model selected  

> color sel hot pink

[Repeated 1 time(s)]

> select #2/H

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> color sel hot pink

> select #2/H

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> select clear

> select #2/G

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> color sel hot pink

> select clear

> select #2/I

329 atoms, 332 bonds, 20 residues, 1 model selected  

> color sel yellow

> select clear

> ui tool show Matchmaker

Traceback (most recent call last):  
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/core/triggerset.py", line 134, in invoke  
return self._func(self._name, data)  
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 50, in <lambda>  
data[0] == pself.attr_name and (setattr(pself, "value", pself.get_attribute())  
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 342, in set_value  
self.__button_group.button(self.values.index(value)).setChecked(True)  
AttributeError: 'NoneType' object has no attribute 'setChecked'  
  
Error processing trigger "setting changed":  
AttributeError: 'NoneType' object has no attribute 'setChecked'  
  
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 342, in set_value  
self.__button_group.button(self.values.index(value)).setChecked(True)  
  
See log for complete Python traceback.  
  

> matchmaker #2 to #1/I pairing bs

Parameters  
---  
Chain pairing | bs  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain I (#1) with ranked_0.pdb, chain I (#2),
sequence alignment score = 86.8  
RMSD between 15 pruned atom pairs is 1.213 angstroms; (across all 20 pairs:
1.970)  
  

> ui tool show H-Bonds

> ui tool show Matchmaker

> matchmaker #2/A to #1/A pairing ss

Parameters  
---  
Chain pairing | ss  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 626  
RMSD between 111 pruned atom pairs is 0.786 angstroms; (across all 130 pairs:
1.652)  
  

> show surfaces

> coulombic

Using Amber 20 recommended default charges and atom types for standard
residues  
[Repeated 1 time(s)]Coulombic values for ranked_0.pdb_A SES surface #1.1:
minimum, -15.29, mean 4.32, maximum 18.71  
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -17.23, mean
3.98, maximum 19.16  
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -9.58, mean
5.06, maximum 15.99  
Coulombic values for ranked_0.pdb_D SES surface #1.4: minimum, -10.13, mean
4.57, maximum 16.13  
Coulombic values for ranked_0.pdb_E SES surface #1.5: minimum, -16.33, mean
2.45, maximum 16.99  
Coulombic values for ranked_0.pdb_F SES surface #1.6: minimum, -14.44, mean
2.30, maximum 14.81  
Coulombic values for ranked_0.pdb_G SES surface #1.7: minimum, -9.16, mean
5.77, maximum 16.03  
Coulombic values for ranked_0.pdb_H SES surface #1.8: minimum, -8.89, mean
5.66, maximum 16.30  
Coulombic values for ranked_0.pdb_I SES surface #1.9: minimum, -12.27, mean
2.58, maximum 12.25  
Coulombic values for ranked_0.pdb_A SES surface #2.1: minimum, -17.25, mean
4.62, maximum 19.62  
Coulombic values for ranked_0.pdb_B SES surface #2.2: minimum, -16.67, mean
4.25, maximum 21.71  
Coulombic values for ranked_0.pdb_C SES surface #2.3: minimum, -10.17, mean
5.19, maximum 16.79  
Coulombic values for ranked_0.pdb_D SES surface #2.4: minimum, -10.16, mean
5.01, maximum 16.53  
Coulombic values for ranked_0.pdb_E SES surface #2.5: minimum, -16.57, mean
2.42, maximum 12.88  
Coulombic values for ranked_0.pdb_F SES surface #2.6: minimum, -16.19, mean
2.43, maximum 13.05  
Coulombic values for ranked_0.pdb_G SES surface #2.7: minimum, -7.63, mean
6.00, maximum 17.63  
Coulombic values for ranked_0.pdb_H SES surface #2.8: minimum, -8.32, mean
5.87, maximum 24.96  
Coulombic values for ranked_0.pdb_I SES surface #2.9: minimum, -11.73, mean
2.88, maximum 15.96  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select #2/I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> hide sel surfaces

> show sel atoms

> color sel byhetero

> style sel stick

Changed 329 atom styles  

> select /I:1-20

658 atoms, 664 bonds, 40 residues, 2 models selected  

> hide sel surfaces

> show sel atoms

> style sel stick

Changed 658 atom styles  

> color sel byhetero

> select clear

> close #1

> hide surfaces

> open 3x1s

3x1s title:  
Crystal structure of the nucleosome core particle [more info...]  
  
Chain information for 3x1s #1  
---  
Chain | Description | UniProt  
A E | Histone H3.1 | H31_HUMAN  
B F | Histone H4 | H4_HUMAN  
C G | Histone H2A type 1-B/E | H2A1B_HUMAN  
D H | Histone H2B type 1-B | H2B1B_HUMAN  
I J | DNA (146-MER) |  
  
Non-standard residues in 3x1s #1  
---  
CL — chloride ion  
MN — manganese (II) ion  
  

> hide cartoons

> hide atoms

> show cartoons

> ui tool show Matchmaker

> matchmaker #!1 to #2

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain C (#2) with 3x1s, chain D (#1), sequence
alignment score = 565.1  
RMSD between 83 pruned atom pairs is 1.259 angstroms; (across all 94 pairs:
2.166)  
  

> show surfaces

> hide surfaces

> close #1

> open 1kx5

Summary of feedback from opening 1kx5 fetched from pdb  
---  
note | Fetching compressed mmCIF 1kx5 from
http://files.rcsb.org/download/1kx5.cif  
  
1kx5 title:  
X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution
[more info...]  
  
Chain information for 1kx5 #1  
---  
Chain | Description | UniProt  
A E | histone H3 | H32_BOVIN  
B F | histone H4 | H4_HUMANX  
C G | histone H2A.1 | H2A1_XENLA  
D H | histone H2B.2 | H2B1_XENLA  
I | DNA
(5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')
|  
J | DNA
(5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')
|  
  
Non-standard residues in 1kx5 #1  
---  
CL — chloride ion  
MN — manganese (II) ion  
  

> select :CL

4 atoms, 4 residues, 1 model selected  

> select :CL

4 atoms, 4 residues, 1 model selected  

> select :MN

14 atoms, 14 residues, 1 model selected  

> select :CL

4 atoms, 4 residues, 1 model selected  

> select clear

Drag select of 3 residues, 16753 atoms, 410 pseudobonds  

> color (#!1-2 & sel) cornflower blue

> hide sel atoms

> show sel cartoons

> select clear

> ui tool show Matchmaker

> matchmaker #!2 to #1

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker 1kx5, chain G (#1) with ranked_0.pdb, chain A (#2), sequence
alignment score = 535.6  
RMSD between 77 pruned atom pairs is 1.313 angstroms; (across all 128 pairs:
7.017)  
  

> close

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -25.35, mean
-2.756, maximum 24.2  
To also show corresponding color key, enter the above mlp command and add key
true  

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-BRD8/ranked_0.pdb"

Chain information for ranked_0.pdb #2  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> ui tool show Matchmaker

> matchmaker #2 to #1/A pairing bs

Parameters  
---  
Chain pairing | bs  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 875.4  
RMSD between 168 pruned atom pairs is 0.344 angstroms; (across all 168 pairs:
0.344)  
  

> select /B:1-127

4084 atoms, 4106 bonds, 254 residues, 2 models selected  

> color sel cornflower blue

> select clear

> select #2/B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel orange

> select clear

> close #2

> select #2/A:1-168

Nothing selected  

> select /B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -17.71, mean
-3.38, maximum 17.10  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select #2/C:1-169

Nothing selected  

> select #2/C:1-169

Nothing selected  

> select /C:1-169

2723 atoms, 2753 bonds, 169 residues, 1 model selected  
Alignment identifier is 1/C  

> select /C:7-8

34 atoms, 34 bonds, 2 residues, 1 model selected  

> select /C:7-11

90 atoms, 90 bonds, 5 residues, 1 model selected  

> select /C:84

19 atoms, 18 bonds, 1 residue, 1 model selected  

> select /C:84-92

153 atoms, 152 bonds, 9 residues, 1 model selected  

> select /C:74

21 atoms, 21 bonds, 1 residue, 1 model selected  

> select /C:74-77

71 atoms, 71 bonds, 4 residues, 1 model selected  

> select /C:101

17 atoms, 16 bonds, 1 residue, 1 model selected  

> select /C:101-116

279 atoms, 281 bonds, 16 residues, 1 model selected  

> select /C:99

17 atoms, 16 bonds, 1 residue, 1 model selected  

> select /C:99-116

306 atoms, 308 bonds, 18 residues, 1 model selected  

> show sel atoms

> select clear

> select /B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> hide sel surfaces

> select clear

> select /B:27

20 atoms, 20 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /B:28

19 atoms, 18 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /B:29

19 atoms, 18 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /B:24

20 atoms, 20 bonds, 1 residue, 1 model selected  

> show sel atoms

> close

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel cornflower blue

> select /B:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> color sel hot pink

> select clear

> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRFAP1/MRFAP1-MRGBP/ranked_0.pdb"

Chain information for ranked_0.pdb #2  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> ui tool show Matchmaker

> matchmaker #2 to #1

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain B (#1) with ranked_0.pdb, chain B (#2),
sequence alignment score = 970.1  
RMSD between 102 pruned atom pairs is 0.694 angstroms; (across all 204 pairs:
12.546)  
  

> close

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -27.67, mean
-2.586, maximum 24.72  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> select clear

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> MRFAP1-MRGBP/ranked_0.pdb"

Chain information for ranked_0.pdb #2  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> ui tool show Matchmaker

> matchmaker #2 to #1/A pairing bs

Parameters  
---  
Chain pairing | bs  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 873.6  
RMSD between 166 pruned atom pairs is 0.254 angstroms; (across all 168 pairs:
0.367)  
  

> select #2/C:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> color sel hot pink

> select clear

> close

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide atoms

> show cartoons

> select /I:1-323

5271 atoms, 5335 bonds, 323 residues, 1 model selected  

> color sel cornflower blue

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -16.17, mean
4.46, maximum 19.51  
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -13.65, mean
4.36, maximum 19.24  
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -10.36, mean
4.80, maximum 16.39  
Coulombic values for ranked_0.pdb_D SES surface #1.4: minimum, -10.42, mean
4.86, maximum 17.37  
Coulombic values for ranked_0.pdb_E SES surface #1.5: minimum, -14.07, mean
2.28, maximum 12.93  
Coulombic values for ranked_0.pdb_F SES surface #1.6: minimum, -13.53, mean
2.26, maximum 12.79  
Coulombic values for ranked_0.pdb_G SES surface #1.7: minimum, -8.63, mean
5.55, maximum 16.43  
Coulombic values for ranked_0.pdb_H SES surface #1.8: minimum, -8.19, mean
5.67, maximum 15.08  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select clear

> select /I:1-323

5271 atoms, 5335 bonds, 323 residues, 1 model selected  
Alignment identifier is 1/I  

> select /I:113

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select /I:113-116

75 atoms, 74 bonds, 4 residues, 1 model selected  

> select /I:132

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select /I:132-139

154 atoms, 155 bonds, 8 residues, 1 model selected  

> select /I:111

22 atoms, 21 bonds, 1 residue, 1 model selected  

> select /I:111-115

97 atoms, 96 bonds, 5 residues, 1 model selected  

> select /I:93-94

24 atoms, 24 bonds, 2 residues, 1 model selected  

> select /I:93-99

100 atoms, 100 bonds, 7 residues, 1 model selected  

> select /I:106-107

31 atoms, 30 bonds, 2 residues, 1 model selected  

> select /I:106-118

230 atoms, 230 bonds, 13 residues, 1 model selected  

> open 1kx5

1kx5 title:  
X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution
[more info...]  
  
Chain information for 1kx5 #2  
---  
Chain | Description | UniProt  
A E | histone H3 | H32_BOVIN  
B F | histone H4 | H4_HUMANX  
C G | histone H2A.1 | H2A1_XENLA  
D H | histone H2B.2 | H2B1_XENLA  
I | DNA
(5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')
|  
J | DNA
(5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')
|  
  
Non-standard residues in 1kx5 #2  
---  
CL — chloride ion  
MN — manganese (II) ion  
  

> hide sel atoms

[Repeated 1 time(s)]

> show sel cartoons

[Repeated 1 time(s)]

> sequence chain #2/A#2/E

Alignment identifier is 1  

> select #2/A:1-135

1074 atoms, 1088 bonds, 135 residues, 1 model selected  

> hide sel atoms

> show sel cartoons

> select #2/E:1-135

1074 atoms, 1088 bonds, 135 residues, 1 model selected  

> hide sel atoms

> show sel cartoons

> select #2/B:1-102

792 atoms, 800 bonds, 102 residues, 1 model selected  

> hide sel atoms

> show sel cartoons

> select #2/F:1-102

792 atoms, 800 bonds, 102 residues, 1 model selected  

> hide sel atoms

> show sel cartoons

> select #2/C:1-128

978 atoms, 988 bonds, 128 residues, 1 model selected  

> hide sel atoms

> show sel cartoons

> select #2/G:1-128

978 atoms, 988 bonds, 128 residues, 1 model selected  

> hide sel atoms

> show sel cartoons

> select #2/D:1-122

949 atoms, 962 bonds, 122 residues, 1 model selected  

> hide sel atoms

> show sel cartoons

> select :MN

14 atoms, 14 residues, 1 model selected  

> hide sel atoms

> hide sel cartoons

> select :CL

4 atoms, 4 residues, 1 model selected  

> hide sel atoms

> hide sel cartoons

> select #2/D:1-122

949 atoms, 962 bonds, 122 residues, 1 model selected  

> select #2/H:1-122

949 atoms, 962 bonds, 122 residues, 1 model selected  

> hide sel atoms

> show sel cartoons

> select #2/D:1-122

949 atoms, 962 bonds, 122 residues, 1 model selected  

> hide sel atoms

> show sel cartoons

> select #2/I:-73-73

3011 atoms, 3378 bonds, 147 residues, 1 model selected  

> hide sel atoms

> show sel cartoons

> select #2/J:-73-73

3010 atoms, 3376 bonds, 147 residues, 1 model selected  

> hide sel atoms

> show sel cartoons

> select clear

> select ::name="CL"::name="HOH"::name="MN"

3148 atoms, 55 pseudobonds, 3148 residues, 2 models selected  

> hide sel atoms

> ui tool show Matchmaker

> matchmaker #!2 to #1/A pairing bs

Parameters  
---  
Chain pairing | bs  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain A (#1) with 1kx5, chain G (#2), sequence
alignment score = 532.6  
RMSD between 95 pruned atom pairs is 0.824 angstroms; (across all 128 pairs:
6.767)  
  

> hide sel surfaces

[Repeated 1 time(s)]Drag select of ranked_0.pdb_A SES surface, ranked_0.pdb_B
SES surface, ranked_0.pdb_C SES surface, ranked_0.pdb_D SES surface,
ranked_0.pdb_E SES surface, ranked_0.pdb_F SES surface, ranked_0.pdb_G SES
surface, ranked_0.pdb_H SES surface, 2515 residues  

> hide sel surfaces

> select clear

> show cartoons

> close #2

> select /I:1-323

5271 atoms, 5335 bonds, 323 residues, 1 model selected  

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> color (#!1 & sel) hot pink

> show sel surfaces

> coulombic sel

Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -16.17, mean
4.46, maximum 19.51  
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -13.65, mean
4.36, maximum 19.24  
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -10.36, mean
4.80, maximum 16.39  
Coulombic values for ranked_0.pdb_D SES surface #1.4: minimum, -10.42, mean
4.86, maximum 17.37  
Coulombic values for ranked_0.pdb_E SES surface #1.5: minimum, -14.07, mean
2.28, maximum 12.93  
Coulombic values for ranked_0.pdb_F SES surface #1.6: minimum, -13.53, mean
2.26, maximum 12.79  
Coulombic values for ranked_0.pdb_G SES surface #1.7: minimum, -8.63, mean
5.55, maximum 16.43  
Coulombic values for ranked_0.pdb_H SES surface #1.8: minimum, -8.19, mean
5.67, maximum 15.08  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select clear

> close

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel cornflower blue

> select /B:1-198

3031 atoms, 3066 bonds, 198 residues, 1 model selected  

> color sel hot pink

> select clear

> select /A:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -27.67, mean
-2.552, maximum 24.45  
To also show corresponding color key, enter the above mlp command and add key
true  

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -29.80, mean
-3.95, maximum 10.63  
To also show corresponding color key, enter the above coulombic command and
add key true  

> close

> open /Users/Gareth/Documents/ranked_1.pdb

Chain information for ranked_1.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_1.pdb_A SES surface #1.1: minimum, -19.24, mean
-4.27, maximum 9.24  
To also show corresponding color key, enter the above coulombic command and
add key true  

> close

> open /Users/Gareth/Documents/ranked_2.pdb

Chain information for ranked_2.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> show sel surfaces

> hide sel surfaces

> close

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /B:1-198

3031 atoms, 3066 bonds, 198 residues, 1 model selected  
Alignment identifier is 1/B  

> select /B:5

24 atoms, 23 bonds, 1 residue, 1 model selected  

> select /B:5-13

127 atoms, 127 bonds, 9 residues, 1 model selected  

> select /B:51

12 atoms, 11 bonds, 1 residue, 1 model selected  

> select /B:51-59

143 atoms, 142 bonds, 9 residues, 1 model selected  

> select /B:61-62

34 atoms, 34 bonds, 2 residues, 1 model selected  

> select /B:61-65

83 atoms, 84 bonds, 5 residues, 1 model selected  

> select /B:45

19 atoms, 18 bonds, 1 residue, 1 model selected  

> select /B:45-59

251 atoms, 251 bonds, 15 residues, 1 model selected  

> select /B:41

19 atoms, 18 bonds, 1 residue, 1 model selected  

> select /B:41-68

480 atoms, 485 bonds, 28 residues, 1 model selected  

> select /B:30

24 atoms, 23 bonds, 1 residue, 1 model selected  

> select /B:30-88

982 atoms, 997 bonds, 59 residues, 1 model selected  

> select /B:1

19 atoms, 18 bonds, 1 residue, 1 model selected  

> select /B:1-29

430 atoms, 433 bonds, 29 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select /B:89

21 atoms, 21 bonds, 1 residue, 1 model selected  

> select /B:89-198

1619 atoms, 1634 bonds, 110 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select /B:1-198

982 atoms, 997 bonds, 59 residues, 1 model selected  

> color sel hot pink

> select /A:1-127

2042 atoms, 2053 bonds, 127 residues, 1 model selected  

> color sel cornflower blue

> show sel surfaces

> close

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> close

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> color sel hot pink

> select clear

> select /A:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  
Alignment identifier is 1/A  

> select /A:168

19 atoms, 18 bonds, 1 residue, 1 model selected  

> select /A:168-170

37 atoms, 36 bonds, 3 residues, 1 model selected  

> select /A:104

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select /A:104-110

113 atoms, 114 bonds, 7 residues, 1 model selected  

> select /A:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> show sel surfaces

> select clear

> select /B:1-169

2723 atoms, 2753 bonds, 169 residues, 1 model selected  
Alignment identifier is 1/B  

> select clear

> select /B:99

17 atoms, 16 bonds, 1 residue, 1 model selected  

> select /B:99-116

306 atoms, 308 bonds, 18 residues, 1 model selected  

> show sel atoms

> select /A:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -27.01, mean
-4.49, maximum 23.98  
To also show corresponding color key, enter the above mlp command and add key
true  

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -20.86, mean
-1.03, maximum 10.53  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select clear

> close

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -25.45, mean
-2.812, maximum 24.26  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-364

5612 atoms, 5673 bonds, 364 residues, 1 model selected  
Alignment identifier is 1/B  

> select /B:321

20 atoms, 20 bonds, 1 residue, 1 model selected  

> select /B:321-324

69 atoms, 70 bonds, 4 residues, 1 model selected  

> show sel atoms

> select /B:269-270

31 atoms, 32 bonds, 2 residues, 1 model selected  

> select /B:269-284

233 atoms, 239 bonds, 16 residues, 1 model selected  

> show sel atoms

> close

> open /Users/Gareth/Documents/ranked_1.pdb

Chain information for ranked_1.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> mlp sel

Map values for surface "ranked_1.pdb_A SES surface": minimum -25.58, mean
-2.936, maximum 24.61  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-364

5612 atoms, 5673 bonds, 364 residues, 1 model selected  
Alignment identifier is 1/B  

> select /B:259

17 atoms, 16 bonds, 1 residue, 1 model selected  

> select /B:259-315

830 atoms, 844 bonds, 57 residues, 1 model selected  

> select /B:321

20 atoms, 20 bonds, 1 residue, 1 model selected  

> select /B:321-325

84 atoms, 85 bonds, 5 residues, 1 model selected  

> close

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -25.45, mean
-2.812, maximum 24.26  
To also show corresponding color key, enter the above mlp command and add key
true  

> select clear

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGBP/MRGBP-
> BRD8/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> close

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -25.45, mean
-2.812, maximum 24.26  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-364

5612 atoms, 5673 bonds, 364 residues, 1 model selected  
Alignment identifier is 1/B  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> HNRPU/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -27.18, mean
-1.674, maximum 25.48  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-825

12459 atoms, 12583 bonds, 825 residues, 1 model selected  
Alignment identifier is 1/B  

> select /B:640

20 atoms, 20 bonds, 1 residue, 1 model selected  

> select /B:640-643

67 atoms, 68 bonds, 4 residues, 1 model selected  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-
> HNRPU/ranked_1.pdb"

Chain information for ranked_1.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_1.pdb_A SES surface": minimum -29.07, mean
-2.496, maximum 27.08  
To also show corresponding color key, enter the above mlp command and add key
true  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide atoms

> show cartoons

> select /I:1-20

343 atoms, 343 bonds, 20 residues, 1 model selected  

> color sel yellow

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> color sel cornflower blue

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -15.47, mean
3.94, maximum 17.14  
Coulombic values for ranked_0.pdb_B SES surface #1.2: minimum, -14.98, mean
3.84, maximum 18.15  
Coulombic values for ranked_0.pdb_C SES surface #1.3: minimum, -10.27, mean
4.76, maximum 16.75  
Coulombic values for ranked_0.pdb_D SES surface #1.4: minimum, -10.23, mean
4.46, maximum 15.94  
Coulombic values for ranked_0.pdb_E SES surface #1.5: minimum, -12.99, mean
2.30, maximum 14.71  
Coulombic values for ranked_0.pdb_F SES surface #1.6: minimum, -19.28, mean
2.25, maximum 13.65  
Coulombic values for ranked_0.pdb_G SES surface #1.7: minimum, -8.87, mean
5.22, maximum 15.87  
Coulombic values for ranked_0.pdb_H SES surface #1.8: minimum, -8.85, mean
5.14, maximum 27.95  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select clear

> select /I:1-20

343 atoms, 343 bonds, 20 residues, 1 model selected  

> show sel atoms

> style sel stick

Changed 343 atom styles  

> color sel byhetero

> select /E:21@NE

1 atom, 1 residue, 1 model selected  

> select clear

> hide surfaces

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_0.pdb"

Chain information for ranked_0.pdb #2  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide atoms

> show cartoons

> select #2/A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> color sel hot pink

> select #2/B:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> color sel hot pink

> select #2/C:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> color sel hot pink

> select #2/D:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> color sel hot pink

> select #2/E:1-103

1703 atoms, 1714 bonds, 103 residues, 1 model selected  

> color sel hot pink

> select #2/F:1-103

1703 atoms, 1714 bonds, 103 residues, 1 model selected  

> color sel hot pink

> select #2/F:1-103

1703 atoms, 1714 bonds, 103 residues, 1 model selected  

> select #2/G:1-103

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> color sel hot pink

> select #2/H:1-103

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> color sel hot pink

> select #2/I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> color sel light sea green

> ui tool show "Color Actions"

> color sel orange red target l

[Repeated 2 time(s)]

> color sel orange red

> select clear

> select #2/I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> color sel cyan

> select clear

> select #2/I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> color sel forest green

> select clear

> ui tool show Matchmaker

> matchmaker #2/A to #1/A pairing ss

Parameters  
---  
Chain pairing | ss  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 603.2  
RMSD between 94 pruned atom pairs is 0.866 angstroms; (across all 130 pairs:
3.895)  
  

> select #1/A

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> show sel surfaces

> hide sel surfaces

> select #2/A

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_A SES surface #2.1: minimum, -15.29, mean
4.32, maximum 18.71  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select #2/B

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_B SES surface #2.2: minimum, -17.23, mean
3.98, maximum 19.16  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select #2/C

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_C SES surface #2.3: minimum, -9.58, mean
5.06, maximum 15.99  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select #2/D

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_D SES surface #2.4: minimum, -10.13, mean
4.57, maximum 16.13  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select #2/E

1703 atoms, 1714 bonds, 103 residues, 1 model selected  

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_E SES surface #2.5: minimum, -16.33, mean
2.45, maximum 16.99  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select #2/F

1703 atoms, 1714 bonds, 103 residues, 1 model selected  

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_F SES surface #2.6: minimum, -14.44, mean
2.30, maximum 14.81  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select #2/H

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_H SES surface #2.7: minimum, -8.89, mean
5.66, maximum 16.30  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select clear

> select #2/H

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> select #2/G

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_G SES surface #2.8: minimum, -9.16, mean
5.77, maximum 16.03  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select clear

> select #1/I

343 atoms, 343 bonds, 20 residues, 1 model selected  

> show sel atoms

> select #2/I

329 atoms, 332 bonds, 20 residues, 1 model selected  

> show sel atoms

> color sel byhetero

> style sel stick

Changed 329 atom styles  

> color sel cyan

> color sel byhetero

> select clear

> select #2/C

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> select #2/G

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> select clear

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/comparison with RKK 1.tif" width 704 height 533
> supersample 3

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/comparison with RKK 2.tif" width 704 height 533
> supersample 3

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/comparison with RKK 3.tif" width 704 height 533
> supersample 3

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/Histone-Octamer-RKK-KTKK.cxs"

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/ranked_1.pdb"

Chain information for ranked_1.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide atoms

> show cartoons

> select /I:1-20

343 atoms, 343 bonds, 20 residues, 1 model selected  

> show sel atoms

> style sel stick

Changed 343 atom styles  

> color sel byhetero

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_1.pdb_A SES surface #1.1: minimum, -20.91, mean
3.63, maximum 16.26  
Coulombic values for ranked_1.pdb_B SES surface #1.2: minimum, -13.26, mean
3.65, maximum 18.85  
Coulombic values for ranked_1.pdb_C SES surface #1.3: minimum, -10.67, mean
4.28, maximum 15.64  
Coulombic values for ranked_1.pdb_D SES surface #1.4: minimum, -11.50, mean
3.84, maximum 13.94  
Coulombic values for ranked_1.pdb_E SES surface #1.5: minimum, -12.92, mean
2.00, maximum 12.92  
Coulombic values for ranked_1.pdb_F SES surface #1.6: minimum, -15.93, mean
2.06, maximum 15.18  
Coulombic values for ranked_1.pdb_G SES surface #1.7: minimum, -9.30, mean
4.54, maximum 14.73  
Coulombic values for ranked_1.pdb_H SES surface #1.8: minimum, -9.19, mean
4.60, maximum 16.14  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select clear

> select /C

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> select /G

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/ranked_1.pdb"

Chain information for ranked_1.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide atoms

> show cartoons

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> show sel atoms

> color sel byhetero

> style sel stick

Changed 329 atom styles  

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_1.pdb_A SES surface #1.1: minimum, -21.67, mean
4.74, maximum 18.97  
Coulombic values for ranked_1.pdb_B SES surface #1.2: minimum, -12.65, mean
4.63, maximum 17.40  
Coulombic values for ranked_1.pdb_C SES surface #1.3: minimum, -9.89, mean
5.22, maximum 18.92  
Coulombic values for ranked_1.pdb_D SES surface #1.4: minimum, -9.69, mean
5.37, maximum 22.95  
Coulombic values for ranked_1.pdb_E SES surface #1.5: minimum, -14.14, mean
2.22, maximum 14.80  
Coulombic values for ranked_1.pdb_F SES surface #1.6: minimum, -15.51, mean
2.19, maximum 16.93  
Coulombic values for ranked_1.pdb_G SES surface #1.7: minimum, -8.06, mean
7.15, maximum 21.55  
Coulombic values for ranked_1.pdb_H SES surface #1.8: minimum, -8.79, mean
6.38, maximum 21.21  
To also show corresponding color key, enter the above coulombic command and
add key true  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/ranked_2.pdb"

Chain information for ranked_2.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide atoms

> show cartoons

> select /I:1-20

343 atoms, 343 bonds, 20 residues, 1 model selected  

> show sel atoms

> style sel stick

Changed 343 atom styles  

> color sel byhetero

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_2.pdb_A SES surface #1.1: minimum, -18.56, mean
4.77, maximum 19.89  
Coulombic values for ranked_2.pdb_B SES surface #1.2: minimum, -13.98, mean
4.51, maximum 17.22  
Coulombic values for ranked_2.pdb_C SES surface #1.3: minimum, -10.01, mean
5.64, maximum 22.21  
Coulombic values for ranked_2.pdb_D SES surface #1.4: minimum, -10.50, mean
5.23, maximum 19.20  
Coulombic values for ranked_2.pdb_E SES surface #1.5: minimum, -15.11, mean
2.14, maximum 15.16  
Coulombic values for ranked_2.pdb_F SES surface #1.6: minimum, -13.75, mean
2.05, maximum 13.10  
Coulombic values for ranked_2.pdb_G SES surface #1.7: minimum, -7.80, mean
6.98, maximum 22.67  
Coulombic values for ranked_2.pdb_H SES surface #1.8: minimum, -8.45, mean
6.51, maximum 20.32  
To also show corresponding color key, enter the above coulombic command and
add key true  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone-Octamer-RKK.pdb"

Chain information for Histone-Octamer-RKK.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> style sel stick

Changed 329 atom styles  

> color sel byhetero

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> show sel cartoons

> hide sel atoms

> select clear

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> color sel cornflower blue

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> color sel yellow

> color sel byhetero

> select clear

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone - MRG/H2AH2B
> + MRG-RKK/ranked_0.pdb"

Chain information for ranked_0.pdb #2  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select #2/A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> color sel purple

> color sel hot pink

> select #2/B:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> color sel hot pink

> select #2/C:1-15

260 atoms, 263 bonds, 15 residues, 1 model selected  

> color sel orange

> show sel atoms

> color sel byhetero

> select clear

> select #2/A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> ui tool show Matchmaker

> matchmaker #2/A to #1/A pairing ss

Parameters  
---  
Chain pairing | ss  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker Histone-Octamer-RKK.pdb, chain A (#1) with ranked_0.pdb, chain A
(#2), sequence alignment score = 591.8  
RMSD between 87 pruned atom pairs is 1.118 angstroms; (across all 130 pairs:
21.387)  
  

> select clear

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> show sel cartoons

> select clear

> select #2/A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> show sel surfaces

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_A SES surface #2.1: minimum, -15.50, mean
3.92, maximum 18.48  
To also show corresponding color key, enter the above coulombic command and
add key true  

> close #2

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGBP/MRGBP-
> BRD8/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> show sel surfaces

Alignment identifier is 1/A  

> select /A:105

20 atoms, 20 bonds, 1 residue, 1 model selected  

> select /A:105-112

137 atoms, 138 bonds, 8 residues, 1 model selected  

> select /B:1-169

2723 atoms, 2753 bonds, 169 residues, 1 model selected  

> show sel atoms

> select clear

> select /A:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -20.86, mean
-1.03, maximum 10.53  
To also show corresponding color key, enter the above coulombic command and
add key true  

> hide sel surfaces

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG15/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
  

> select /A:1-323

5271 atoms, 5335 bonds, 323 residues, 1 model selected  
Alignment identifier is 1/A  

> select /A:149

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select /A:149

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select /A:92

10 atoms, 9 bonds, 1 residue, 1 model selected  

> select /A:92-94

34 atoms, 34 bonds, 3 residues, 1 model selected  

> close

> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRG15/MRG15-AI_Isoform/AF-Q9UBU8-F1-model_v4.pdb"

AF-Q9UBU8-F1-model_v4.pdb title:  
Alphafold monomer V2.0 prediction for mortality factor 4-like protein 1
(Q9UBU8) [more info...]  
  
Chain information for AF-Q9UBU8-F1-model_v4.pdb #1  
---  
Chain | Description | UniProt  
A | mortality factor 4-like protein 1 | MO4L1_HUMAN  
  

> select /A:1-362

2929 atoms, 3002 bonds, 362 residues, 1 model selected  
Alignment identifier is 1/A  

> select /A:268

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select /A:268-272

36 atoms, 35 bonds, 5 residues, 1 model selected  

> select /A:148

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select /A:148

9 atoms, 8 bonds, 1 residue, 1 model selected  

> ui tool show "AlphaFold Error Plot"

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone-Octamer-RKK.pdb"

Chain information for Histone-Octamer-RKK.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> ui tool show "AlphaFold Error Plot"

> alphafold pae #1 file /Users/Gareth/Documents/result_model_1_multimer.pkl

> alphafold pae #1 colorDomains true

> help help:user/tools/alphafold.html#pae

> hide atoms

> show cartoons

> color #1/A:119-119 lime

> color #1/C:96-96 magenta

> color #1/C:69-69 lime

> color #1/C:72-72 magenta

> color #1/I:9-9 lime

> color #1/H:69-69 magenta

> color #1/A:88-88 lime

> color #1/I:15-15 magenta

> color #1/A:93-93 lime

> color #1/I:14-14 magenta

> color #1/D:61-61 lime

> color #1/D:66-66 magenta

> color #1/F:61-61 lime

> color #1/H:67-67 magenta

> close

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -26.17, mean
-2.324, maximum 24.92  
To also show corresponding color key, enter the above mlp command and add key
true  

> select clear

> select /B:1-111

1653 atoms, 1666 bonds, 111 residues, 1 model selected  
Alignment identifier is 1/B  

> select /B:95

20 atoms, 20 bonds, 1 residue, 1 model selected  

> select /B:95-98

67 atoms, 68 bonds, 4 residues, 1 model selected  

> select /B:59

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select /B:59-69

170 atoms, 171 bonds, 11 residues, 1 model selected  

> select /B:77-78

26 atoms, 25 bonds, 2 residues, 1 model selected  

> select /B:77-80

61 atoms, 60 bonds, 4 residues, 1 model selected  

> close

> open /Users/Gareth/Documents/ranked_1.pdb

Chain information for ranked_1.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_1.pdb_A SES surface": minimum -26.3, mean
-2.42, maximum 27.86  
To also show corresponding color key, enter the above mlp command and add key
true  

> close

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -25.88, mean
-2.21, maximum 26.06  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-56

872 atoms, 881 bonds, 56 residues, 1 model selected  
Alignment identifier is 1/B  

> select /B:18

20 atoms, 20 bonds, 1 residue, 1 model selected  

> select /B:18-21

67 atoms, 68 bonds, 4 residues, 1 model selected  

> close

> open /Users/Gareth/Documents/ranked_1.pdb

Chain information for ranked_1.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_1.pdb_A SES surface": minimum -26.18, mean
-2.31, maximum 24.21  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-56

872 atoms, 881 bonds, 56 residues, 1 model selected  

> show sel atoms

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG15/ranked_0.pdb"

Chain information for ranked_0.pdb #2  
---  
Chain | Description  
A | No description available  
  

> ui tool show Matchmaker

> matchmaker #2 to #1

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_1.pdb, chain A (#1) with ranked_0.pdb, chain A (#2),
sequence alignment score = 854.4  
RMSD between 151 pruned atom pairs is 0.826 angstroms; (across all 168 pairs:
1.693)  
  

> hide sel surfaces

> select clear

> hide surfaces

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone-Octamer-RKK.pdb"

Chain information for Histone-Octamer-RKK.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide atoms

> show cartoons

> select /I:1-20

329 atoms, 332 bonds, 20 residues, 1 model selected  

> select ~sel

14908 atoms, 15000 bonds, 924 residues, 1 model selected  

> color sel hot pink

> select clear

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/Histone-Octamer-KTKK.pdb"

Chain information for Histone-Octamer-KTKK.pdb #2  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide atoms

> show cartoons

> ui tool show Matchmaker

> matchmaker #2/A to #1/A pairing ss

Parameters  
---  
Chain pairing | ss  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker Histone-Octamer-RKK.pdb, chain A (#1) with Histone-Octamer-
KTKK.pdb, chain A (#2), sequence alignment score = 603.2  
RMSD between 94 pruned atom pairs is 0.866 angstroms; (across all 130 pairs:
3.895)  
  

> select #2/A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/B:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/C:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/D:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/E:1-103

1703 atoms, 1714 bonds, 103 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/E:1-103

Nothing selected  

> select #2/E:1-103

Nothing selected  

> select #2/F:1-103

1703 atoms, 1714 bonds, 103 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/G:1-103

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/H:1-103

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> ui tool show "Add Hydrogens"

> addh inIsolation false

Summary of feedback from adding hydrogens to multiple structures  
---  
notes | No usable SEQRES records for Histone-Octamer-RKK.pdb (#1) chain A;
guessing termini instead  
No usable SEQRES records for Histone-Octamer-RKK.pdb (#1) chain B; guessing
termini instead  
No usable SEQRES records for Histone-Octamer-RKK.pdb (#1) chain C; guessing
termini instead  
No usable SEQRES records for Histone-Octamer-RKK.pdb (#1) chain D; guessing
termini instead  
No usable SEQRES records for Histone-Octamer-RKK.pdb (#1) chain E; guessing
termini instead  
5 messages similar to the above omitted  
Chain-initial residues that are actual N termini: Histone-Octamer-RKK.pdb #1/A
MET 1, Histone-Octamer-RKK.pdb #1/B MET 1, Histone-Octamer-RKK.pdb #1/C MET 1,
Histone-Octamer-RKK.pdb #1/D MET 1, Histone-Octamer-RKK.pdb #1/E THR 1,
Histone-Octamer-RKK.pdb #1/F THR 1, Histone-Octamer-RKK.pdb #1/G MET 1,
Histone-Octamer-RKK.pdb #1/H MET 1, Histone-Octamer-RKK.pdb #1/I SER 1,
Histone-Octamer-KTKK.pdb #2/I LEU 1  
Chain-initial residues that are not actual N termini:  
Chain-final residues that are actual C termini: Histone-Octamer-RKK.pdb #1/A
LYS 130, Histone-Octamer-RKK.pdb #1/B LYS 130, Histone-Octamer-RKK.pdb #1/C
LYS 126, Histone-Octamer-RKK.pdb #1/D LYS 126, Histone-Octamer-RKK.pdb #1/E
ALA 103, Histone-Octamer-RKK.pdb #1/F ALA 103, Histone-Octamer-RKK.pdb #1/G
GLY 103, Histone-Octamer-RKK.pdb #1/H GLY 103, Histone-Octamer-RKK.pdb #1/I
ASN 20, Histone-Octamer-KTKK.pdb #2/I ASN 20  
Chain-final residues that are not actual C termini:  
985 hydrogen bonds  
1 hydrogens added  
  

> ui tool show "Build Structure"

> save /Users/Gareth/Desktop/RKK.pdb

> close

> open /Users/Gareth/Desktop/RKK.pdb

Summary of feedback from opening /Users/Gareth/Desktop/RKK.pdb  
---  
warnings | Start residue of secondary structure not found: HELIX 1 1 ALA A 13
THR A 17 1 5  
Start residue of secondary structure not found: HELIX 2 2 SER A 20 ALA A 22 1
3  
Start residue of secondary structure not found: HELIX 3 3 VAL A 28 LYS A 37 1
10  
Start residue of secondary structure not found: HELIX 4 4 GLY A 47 ALA A 71 1
25  
Start residue of secondary structure not found: HELIX 5 5 ARG A 72 ASN A 74 1
3  
58 messages similar to the above omitted  
End residue of secondary structure not found: HELIX 64 64 LYS I 9 ARG I 11 1 3  
Start residue of secondary structure not found: SHEET 1 1 1 VAL A 101 ILE A
103 0  
Start residue of secondary structure not found: SHEET 2 2 1 VAL B 101 ILE B
103 0  
Start residue of secondary structure not found: SHEET 3 3 1 THR G 97 TYR G 99
0  
Start residue of secondary structure not found: SHEET 4 4 1 THR H 97 TYR H 99
0  
  
Chain information for RKK.pdb  
---  
Chain | Description  
1.1/A 1.1/B | No description available  
1.1/C 1.1/D | No description available  
1.1/E 1.1/F | No description available  
1.1/G 1.1/H | No description available  
1.1/I | No description available  
1.2/I | No description available  
  

> hide atoms

> show cartoons

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-RKK/Histone-Octamer-RKK.pdb"

Chain information for Histone-Octamer-RKK.pdb #1  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide atoms

> show cartoons

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/Histone -
> MRG/Histone-Octamer-KTKK/Histone-Octamer-KTKK.pdb"

Chain information for Histone-Octamer-KTKK.pdb #2  
---  
Chain | Description  
A B | No description available  
C D | No description available  
E F | No description available  
G H | No description available  
I | No description available  
  

> hide atoms

> show cartoons

> ui tool show Matchmaker

> matchmaker #2/A to #1/A pairing ss

Parameters  
---  
Chain pairing | ss  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker Histone-Octamer-RKK.pdb, chain A (#1) with Histone-Octamer-
KTKK.pdb, chain A (#2), sequence alignment score = 603.2  
RMSD between 94 pruned atom pairs is 0.866 angstroms; (across all 130 pairs:
3.895)  
  

> select #2/A:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/B:1-130

2063 atoms, 2075 bonds, 130 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/C:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/D:1-126

2024 atoms, 2039 bonds, 126 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/E:1-103

1703 atoms, 1714 bonds, 103 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/F:1-103

1703 atoms, 1714 bonds, 103 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/G:1-103

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/H:1-103

1664 atoms, 1672 bonds, 103 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/F:1-103

Nothing selected  

> select add #1

15237 atoms, 15332 bonds, 944 residues, 1 model selected  

> select add #2

15580 atoms, 15675 bonds, 964 residues, 2 models selected  

> select subtract #2

15237 atoms, 15332 bonds, 944 residues, 1 model selected  

> select add #2

15580 atoms, 15675 bonds, 964 residues, 2 models selected  

> select subtract #2

15237 atoms, 15332 bonds, 944 residues, 1 model selected  

> select subtract #1

Nothing selected  

> ui tool show "Change Chain IDs"

> view clip false

> select add #1

15237 atoms, 15332 bonds, 944 residues, 1 model selected  

> select add #2

15580 atoms, 15675 bonds, 964 residues, 2 models selected  

>

Incomplete command: modeller  

> join models

Unknown command: join models  

> combine

Remapping chain ID 'I' in Histone-Octamer-KTKK.pdb #2 to 'J'  

> close #1

> close #2

> save /Users/Gareth/Desktop/RKK.pdb relModel #3

> close

> open /Users/Gareth/Downloads/step1_pdbreader.pdb

Summary of feedback from opening /Users/Gareth/Downloads/step1_pdbreader.pdb  
---  
warnings | Ignored bad PDB record found on line 1  
REMARK GENERATED BY CHARMM-GUI (HTTP://WWW.CHARMM-GUI.ORG) V3.7 ON FEB, 02.
2023. JOB  
  
Ignored bad PDB record found on line 2  
REMARK READ PDB, MANIPULATE STRUCTURE IF NEEDED, AND GENERATE TOPOLOGY FILE  
  
Ignored bad PDB record found on line 3  
REMARK DATE: 2/ 2/23 11:37:31 CREATED BY USER: apache  
  
Chain information for step1_pdbreader.pdb #1  
---  
Chain | Description  
P | No description available  
  

> close

> open /Users/Gareth/Desktop/MD/RKK.pdb

Summary of feedback from opening /Users/Gareth/Desktop/MD/RKK.pdb  
---  
warnings | Ignored bad PDB record found on line 1  
REMARK GENERATED BY CHARMM-GUI (HTTP://WWW.CHARMM-GUI.ORG) V3.7 ON FEB, 03.
2023. JOB  
  
Ignored bad PDB record found on line 2  
REMARK READ PDB, MANIPULATE STRUCTURE IF NEEDED, AND GENERATE TOPOLOGY FILE  
  
Ignored bad PDB record found on line 3  
REMARK DATE: 2/ 3/23 7:23: 2 CREATED BY USER: apache  
  
Chain information for RKK.pdb #1  
---  
Chain | Description  
P | No description available  
  
Alignment identifier is 1/P  

> select clear

> select /P:130

46 atoms, 44 bonds, 2 residues, 1 model selected  

> select /P:130

46 atoms, 44 bonds, 2 residues, 1 model selected  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGBP/MRGBP-
> BRD8/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> show sel surfaces

> select /A:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> close

> close #

Expected a models specifier or a keyword  

> open /Users/Gareth/Documents/ranked_0.pdb

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -25.88, mean
-2.21, maximum 26.06  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-56

872 atoms, 881 bonds, 56 residues, 1 model selected  
Alignment identifier is 1/B  

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG-MRGBP-
> BRD8/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
  

> select /A:1-168

2756 atoms, 2792 bonds, 168 residues, 1 model selected  

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -26.9, mean
-2.559, maximum 25.42  
To also show corresponding color key, enter the above mlp command and add key
true  

> select /B:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> color sel cornflower blue

> select clear

> select /C:1-169

2723 atoms, 2753 bonds, 169 residues, 1 model selected  

> color sel hot pink

> select /B:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  
Alignment identifier is 1/B  

> select /B:105

20 atoms, 20 bonds, 1 residue, 1 model selected  

> select /B:105-108

69 atoms, 70 bonds, 4 residues, 1 model selected  

> select /C:1-169

2723 atoms, 2753 bonds, 169 residues, 1 model selected  

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for ranked_0.pdb_C SES surface #1.2: minimum, -14.15, mean
0.59, maximum 16.76  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select clear

> select /B:33

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select /B:33-42

153 atoms, 155 bonds, 10 residues, 1 model selected  

> show sel atoms

> style sel stick

Changed 153 atom styles  

> color sel byhetero

> select /B:74

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select /B:74-83

165 atoms, 167 bonds, 10 residues, 1 model selected  

> show sel atoms

> color sel byhetero

> select /B:84

17 atoms, 16 bonds, 1 residue, 1 model selected  

> select /B:84-89

94 atoms, 94 bonds, 6 residues, 1 model selected  

> color sel byhetero

> show sel atoms

> select /C:111@C

1 atom, 1 residue, 1 model selected  

> select /B:43-44

36 atoms, 35 bonds, 2 residues, 1 model selected  

> select /B:43-49

112 atoms, 113 bonds, 7 residues, 1 model selected  

> show sel atoms

> color sel byhetero

> select /B:33-42,50-68,74-83,87-93,109-133,176-186,198-200

1409 atoms, 1413 bonds, 85 residues, 1 model selected  

> select /B:96-97

33 atoms, 33 bonds, 2 residues, 1 model selected  

> select /B:96-99

67 atoms, 69 bonds, 4 residues, 1 model selected  

> select /B:54

17 atoms, 17 bonds, 1 residue, 1 model selected  

> select /B:54-67

240 atoms, 243 bonds, 14 residues, 1 model selected  

> show sel atoms

> color sel byhetero

> select /B:1-204

3097 atoms, 3126 bonds, 204 residues, 1 model selected  

> hide sel cartoons

> hide sel atoms

> select /C:1-169

2723 atoms, 2753 bonds, 169 residues, 1 model selected  

> hide sel surfaces

> hide sel cartoons

> close

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG15/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
  

> mlp

Map values for surface "ranked_0.pdb_A SES surface": minimum -25.17, mean
-3.564, maximum 24.96  
To also show corresponding color key, enter the above mlp command and add key
true  

> hide surfaces

> show surfaces

> hide surfaces

> show surfaces

> select /A:265@O

1 atom, 1 residue, 1 model selected  

> select /A:233@CA

1 atom, 1 residue, 1 model selected  

> select add /A:265@CA

2 atoms, 2 residues, 2 models selected  

> select add /A:233@CD2

3 atoms, 2 residues, 2 models selected  

> select add /A:265@HB2

4 atoms, 2 residues, 2 models selected  

> select add /A:268@HG23

5 atoms, 3 residues, 2 models selected  

> select add /A:268@HG11

6 atoms, 3 residues, 2 models selected  

> select add /A:160@HG12

7 atoms, 4 residues, 2 models selected  

> select add /A:168@HB3

8 atoms, 5 residues, 2 models selected  

> select add /A:168@CD2

9 atoms, 5 residues, 2 models selected  

> select add /A:168@HD11

10 atoms, 5 residues, 2 models selected  

> select add /A:168@HD12

11 atoms, 5 residues, 2 models selected  

> select add /A:160@HG13

12 atoms, 5 residues, 2 models selected  

> select add /A:160@CB

13 atoms, 5 residues, 2 models selected  

> select add /A:165@HG3

14 atoms, 6 residues, 2 models selected  

> select add /A:168@CD1

15 atoms, 6 residues, 2 models selected  

> select add /A:268@CG2

16 atoms, 6 residues, 2 models selected  

> select add /A:268@CG1

17 atoms, 6 residues, 2 models selected  

> select add /A:265@CG

18 atoms, 6 residues, 2 models selected  

> select add /A:265@O

19 atoms, 6 residues, 2 models selected  

> select add /A:265@HD2

20 atoms, 6 residues, 2 models selected  

> select add /A:265@CB

21 atoms, 6 residues, 2 models selected  

> select add /A:233@O

22 atoms, 6 residues, 2 models selected  

> select add /A:233@C

23 atoms, 6 residues, 2 models selected  

> select add /A:233@HA

24 atoms, 6 residues, 2 models selected  

> select add /A:265@CD

25 atoms, 6 residues, 2 models selected  

> select add /A:265@HG2

26 atoms, 6 residues, 2 models selected  

> select add /A:168@HD23

27 atoms, 6 residues, 2 models selected  

> select add /A:265@HA

28 atoms, 6 residues, 2 models selected  

> select add /A:268@HB

29 atoms, 6 residues, 2 models selected  

> select add /A:268@CB

30 atoms, 6 residues, 2 models selected  

> select add /A:268@HG13

31 atoms, 6 residues, 2 models selected  

> select add /A:268@HG12

32 atoms, 6 residues, 2 models selected  

> select add /A:160@CG1

33 atoms, 6 residues, 2 models selected  

> select add /A:268@HG21

34 atoms, 6 residues, 2 models selected  

> select subtract /A:165@HG3

33 atoms, 5 residues, 2 models selected  

> select add /A:165@CA

34 atoms, 6 residues, 2 models selected  

> select add /A:165@CG

35 atoms, 6 residues, 2 models selected  

> select add /A:165@HG3

36 atoms, 6 residues, 2 models selected  

> select add /A:165@HA

37 atoms, 6 residues, 2 models selected  

> select add /A:160@CG2

38 atoms, 6 residues, 2 models selected  

> select add /A:160@HB

39 atoms, 6 residues, 2 models selected  

> select add /A:168@CB

40 atoms, 6 residues, 2 models selected  

> select add /A:168@HB2

41 atoms, 6 residues, 2 models selected  

> select add /A:172@HB2

42 atoms, 7 residues, 2 models selected  

> select add /A:235@CE1

43 atoms, 8 residues, 2 models selected  

> select add /A:235@HH

44 atoms, 8 residues, 2 models selected  

> select subtract /A:235@HH

43 atoms, 8 residues, 2 models selected  

> select add /A:235@OH

44 atoms, 8 residues, 2 models selected  

> select add /A:235@HH

45 atoms, 8 residues, 2 models selected  

> select add /A:235@HE1

46 atoms, 8 residues, 2 models selected  

> select add /A:168@O

47 atoms, 8 residues, 2 models selected  

> select add /A:169@N

48 atoms, 9 residues, 2 models selected  

> select add /A:172@CE3

49 atoms, 9 residues, 2 models selected  

> select add /A:172@CE2

50 atoms, 9 residues, 2 models selected  

> select add /A:172@CD2

51 atoms, 9 residues, 2 models selected  

> select add /A:172@CB

52 atoms, 9 residues, 2 models selected  

> select subtract /A:172@CE3

51 atoms, 9 residues, 2 models selected  

> select add /A:172@CZ3

52 atoms, 9 residues, 2 models selected  

> select add /A:172@CH2

53 atoms, 9 residues, 2 models selected  

> select add /A:172@CZ2

54 atoms, 9 residues, 2 models selected  

> select add /A:172@NE1

55 atoms, 9 residues, 2 models selected  

> select add /A:172@CD1

56 atoms, 9 residues, 2 models selected  

> select add /A:172@CG

57 atoms, 9 residues, 2 models selected  

> select add /A:169@CG2

58 atoms, 9 residues, 2 models selected  

> select add /A:169@HG11

59 atoms, 9 residues, 2 models selected  

> select add /A:172@CE3

60 atoms, 9 residues, 2 models selected  

> select add /A:169@HA

61 atoms, 9 residues, 2 models selected  

> select add /A:169@HG21

62 atoms, 9 residues, 2 models selected  

> select subtract /A:169@HG11

61 atoms, 9 residues, 2 models selected  

> select add /A:169@CG1

62 atoms, 9 residues, 2 models selected  

> select add /A:169@HG11

63 atoms, 9 residues, 2 models selected  

> select subtract /A:169@HA

62 atoms, 9 residues, 2 models selected  

> select subtract /A:169@N

61 atoms, 9 residues, 2 models selected  

> select add /A:169@N

62 atoms, 9 residues, 2 models selected  

> select add /A:169@HA

63 atoms, 9 residues, 2 models selected  

> select add /A:168@C

64 atoms, 9 residues, 2 models selected  

> select add /A:169@CA

65 atoms, 9 residues, 2 models selected  

> show sel atoms

> hide sel surfaces

Alignment identifier is 1/A  

> select /A:250@HB2

1 atom, 1 residue, 1 model selected  

> hide sel surfaces

[Repeated 5 time(s)]

> select /A:1-323

5271 atoms, 5335 bonds, 323 residues, 1 model selected  

> hide sel surfaces

> select clear

> show cartoons

[Repeated 1 time(s)]

> select /A

5271 atoms, 5335 bonds, 323 residues, 1 model selected  

> show sel cartoons

> select clear

> select /A:172

24 atoms, 25 bonds, 1 residue, 1 model selected  

> style sel stick

Changed 24 atom styles  

> show sel atoms

> select /A:265

24 atoms, 23 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:268

16 atoms, 15 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:160

19 atoms, 18 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:165

22 atoms, 21 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:168

19 atoms, 18 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:169

16 atoms, 15 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:235

21 atoms, 21 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:233

19 atoms, 18 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:235

21 atoms, 21 bonds, 1 residue, 1 model selected  

> select add /A:233

40 atoms, 39 bonds, 2 residues, 2 models selected  

> select add /A:265

64 atoms, 62 bonds, 3 residues, 2 models selected  

> select add /A:268

80 atoms, 77 bonds, 4 residues, 2 models selected  

> select add /A:160

99 atoms, 95 bonds, 5 residues, 2 models selected  

> select add /A:168

118 atoms, 113 bonds, 6 residues, 2 models selected  

> select add /A:169

134 atoms, 128 bonds, 7 residues, 2 models selected  

> select add /A:172

158 atoms, 153 bonds, 8 residues, 2 models selected  

> select add /A:165

180 atoms, 174 bonds, 9 residues, 2 models selected  

> select clear

> show surfaces

> select /A:286@CD2

1 atom, 1 residue, 1 model selected  

> select /A:286@CD1

1 atom, 1 residue, 1 model selected  

> select add /A:286@CD2

2 atoms, 1 residue, 2 models selected  

> select add /A:290@HH

3 atoms, 2 residues, 2 models selected  

> select add /A:212@CD1

4 atoms, 3 residues, 2 models selected  

> select add /A:217@CG2

5 atoms, 4 residues, 2 models selected  

> select add /A:270@HD13

6 atoms, 5 residues, 2 models selected  

> select add /A:287@HD23

7 atoms, 6 residues, 2 models selected  

> select add /A:279@CD2

8 atoms, 7 residues, 2 models selected  

> select add /A:277@CG2

9 atoms, 8 residues, 2 models selected  

> select add /A:224@CE2

10 atoms, 9 residues, 2 models selected  

> select add /A:224@CG

11 atoms, 9 residues, 2 models selected  

> select add /A:270@CD1

12 atoms, 9 residues, 2 models selected  

> select add /A:287@HD11

13 atoms, 9 residues, 2 models selected  

> select add /A:287@CB

14 atoms, 9 residues, 2 models selected  

> select add /A:290@CE2

15 atoms, 9 residues, 2 models selected  

> select add /A:290@CD2

16 atoms, 9 residues, 2 models selected  

> select add /A:213@HB3

17 atoms, 10 residues, 2 models selected  

> select add /A:212@HE1

18 atoms, 10 residues, 2 models selected  

> select add /A:216@OE1

19 atoms, 11 residues, 2 models selected  

> select add /A:216@OE2

20 atoms, 11 residues, 2 models selected  

> select add /A:213@O

21 atoms, 11 residues, 2 models selected  

> select add /A:216@CB

22 atoms, 11 residues, 2 models selected  

> select add /A:217@CA

23 atoms, 11 residues, 2 models selected  

> select add /A:221@N

24 atoms, 12 residues, 2 models selected  

> select add /A:220@CA

25 atoms, 13 residues, 2 models selected  

> select add /A:224@CD2

26 atoms, 13 residues, 2 models selected  

> select add /A:283@HA

27 atoms, 14 residues, 2 models selected  

> select add /A:283@OG

28 atoms, 14 residues, 2 models selected  

> select add /A:283@HB2

29 atoms, 14 residues, 2 models selected  

> select add /A:279@HD21

30 atoms, 14 residues, 2 models selected  

> select add /A:224@OH

31 atoms, 14 residues, 2 models selected  

> select add /A:287@HA

32 atoms, 14 residues, 2 models selected  

> select add /A:283@O

33 atoms, 14 residues, 2 models selected  

> select add /A:279@CD1

34 atoms, 14 residues, 2 models selected  

> select add /A:287@CD1

35 atoms, 14 residues, 2 models selected  

> select add /A:274@CD2

36 atoms, 15 residues, 2 models selected  

> select add /A:291@HD11

37 atoms, 16 residues, 2 models selected  

> select add /A:291@CD2

38 atoms, 16 residues, 2 models selected  

> select subtract /A:274@CD2

37 atoms, 15 residues, 2 models selected  

> select subtract /A:270@CD1

36 atoms, 15 residues, 2 models selected  

> select add /A:270@CD1

37 atoms, 15 residues, 2 models selected  

> select add /A:291@CD1

38 atoms, 15 residues, 2 models selected  

> select add /A:291@HD22

39 atoms, 15 residues, 2 models selected  

> select add /A:287@HD13

40 atoms, 15 residues, 2 models selected  

> select add /A:224@HE2

41 atoms, 15 residues, 2 models selected  

> select add /A:274@CD2

42 atoms, 16 residues, 2 models selected  

> select add /A:274@HD22

43 atoms, 16 residues, 2 models selected  

> select add /A:287@CD2

44 atoms, 16 residues, 2 models selected  

> select add /A:287@HD21

45 atoms, 16 residues, 2 models selected  

> select add /A:279@HD11

46 atoms, 16 residues, 2 models selected  

> select add /A:277@HG22

47 atoms, 16 residues, 2 models selected  

> select add /A:277@HG23

48 atoms, 16 residues, 2 models selected  

> select add /A:279@HD23

49 atoms, 16 residues, 2 models selected  

> select subtract /A:283@OG

48 atoms, 16 residues, 2 models selected  

> select add /A:283@OG

49 atoms, 16 residues, 2 models selected  

> select add /A:283@CB

50 atoms, 16 residues, 2 models selected  

> select add /A:283@CA

51 atoms, 16 residues, 2 models selected  

> select add /A:286@CB

52 atoms, 16 residues, 2 models selected  

> select add /A:286@HD23

53 atoms, 16 residues, 2 models selected  

> select add /A:286@HD11

54 atoms, 16 residues, 2 models selected  

> select add /A:286@HD12

55 atoms, 16 residues, 2 models selected  

> select add /A:286@HD22

56 atoms, 16 residues, 2 models selected  

> select subtract /A:213@HB3

55 atoms, 16 residues, 2 models selected  

> select add /A:209@O

56 atoms, 17 residues, 2 models selected  

> select add /A:213@CB

57 atoms, 17 residues, 2 models selected  

> select add /A:213@HB3

58 atoms, 17 residues, 2 models selected  

> select add /A:213@CA

59 atoms, 17 residues, 2 models selected  

> select add /A:212@HD1

60 atoms, 17 residues, 2 models selected  

> select add /A:212@OH

61 atoms, 17 residues, 2 models selected  

> select add /A:212@CZ

62 atoms, 17 residues, 2 models selected  

> select add /A:212@CE1

63 atoms, 17 residues, 2 models selected  

> select add /A:212@CD2

64 atoms, 17 residues, 2 models selected  

> select add /A:212@CE2

65 atoms, 17 residues, 2 models selected  

> select add /A:287@HB3

66 atoms, 17 residues, 2 models selected  

> select add /A:287@N

67 atoms, 17 residues, 2 models selected  

> select add /A:287@CA

68 atoms, 17 residues, 2 models selected  

> select add /A:286@C

69 atoms, 17 residues, 2 models selected  

> select add /A:290@HD2

70 atoms, 17 residues, 2 models selected  

> select add /A:290@HE2

71 atoms, 17 residues, 2 models selected  

> select add /A:286@HD21

72 atoms, 17 residues, 2 models selected  

> select add /A:286@CG

73 atoms, 17 residues, 2 models selected  

> select add /A:286@HB2

74 atoms, 17 residues, 2 models selected  

> select add /A:286@HG

75 atoms, 17 residues, 2 models selected  

> select add /A:279@HD12

76 atoms, 17 residues, 2 models selected  

> select add /A:283@C

77 atoms, 17 residues, 2 models selected  

> select add /A:217@HG22

78 atoms, 17 residues, 2 models selected  

> select add /A:217@N

79 atoms, 17 residues, 2 models selected  

> select add /A:216@O

80 atoms, 17 residues, 2 models selected  

> select add /A:216@C

81 atoms, 17 residues, 2 models selected  

> select add /A:216@HB3

82 atoms, 17 residues, 2 models selected  

> select add /A:216@CD

83 atoms, 17 residues, 2 models selected  

> select add /A:213@HA

84 atoms, 17 residues, 2 models selected  

> select add /A:213@HB1

85 atoms, 17 residues, 2 models selected  

> select add /A:213@N

86 atoms, 17 residues, 2 models selected  

> select add /A:220@HA3

87 atoms, 17 residues, 2 models selected  

> select subtract /A:221@N

86 atoms, 16 residues, 2 models selected  

> select add /A:221@N

87 atoms, 17 residues, 2 models selected  

> select subtract /A:291@CD2

86 atoms, 17 residues, 2 models selected  

> select add /A:221@HG12

87 atoms, 17 residues, 2 models selected  

> select add /A:217@CG1

88 atoms, 17 residues, 2 models selected  

> select add /A:217@O

89 atoms, 17 residues, 2 models selected  

> select add /A:217@HA

90 atoms, 17 residues, 2 models selected  

> select add /A:217@HG13

91 atoms, 17 residues, 2 models selected  

> select add /A:217@HG23

92 atoms, 17 residues, 2 models selected  

> select add /A:221@CG1

93 atoms, 17 residues, 2 models selected  

> select add /A:291@CD2

94 atoms, 17 residues, 2 models selected  

> select add /A:221@CA

95 atoms, 17 residues, 2 models selected  

> select subtract /A:224@CD2

94 atoms, 17 residues, 2 models selected  

> select add /A:224@CD2

95 atoms, 17 residues, 2 models selected  

> select add /A:220@C

96 atoms, 17 residues, 2 models selected  

> select add /A:221@HA

97 atoms, 17 residues, 2 models selected  

> select add /A:224@HD2

98 atoms, 17 residues, 2 models selected  

> show sel atoms

> select clear

> hide surfaces

> select /A:213

10 atoms, 9 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:212

21 atoms, 21 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:216

15 atoms, 14 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:286

19 atoms, 18 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:283@CB

1 atom, 1 residue, 1 model selected  

> show sel atoms

> select /A:290

21 atoms, 21 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:287

19 atoms, 18 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:279

19 atoms, 18 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:277

14 atoms, 13 bonds, 1 residue, 1 model selected  

> show sel atoms

> select clear

> select /A:224@OH

1 atom, 1 residue, 1 model selected  

> show sel atoms

[Repeated 1 time(s)]

> select subtract /A:224

1 model selected  

> select add /A:224

21 atoms, 21 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:217

16 atoms, 15 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:221

19 atoms, 18 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:291

19 atoms, 18 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:158

16 atoms, 15 bonds, 1 residue, 1 model selected  

> select /A:157

22 atoms, 21 bonds, 1 residue, 1 model selected  

> select /A:274

19 atoms, 18 bonds, 1 residue, 1 model selected  

> show sel atoms

> select /A:270@CD1

1 atom, 1 residue, 1 model selected  

> select /A:269

24 atoms, 23 bonds, 1 residue, 1 model selected  

> select /A:270

19 atoms, 18 bonds, 1 residue, 1 model selected  

> show sel atoms

> select clear

> select /A:212

21 atoms, 21 bonds, 1 residue, 1 model selected  

> select add /A:213

31 atoms, 30 bonds, 2 residues, 2 models selected  

> select add /A:216

46 atoms, 44 bonds, 3 residues, 2 models selected  

> select add /A:286

65 atoms, 62 bonds, 4 residues, 2 models selected  

> select add /A:290

86 atoms, 83 bonds, 5 residues, 2 models selected  

> select add /A:217

102 atoms, 98 bonds, 6 residues, 2 models selected  

> select add /A:220

109 atoms, 104 bonds, 7 residues, 2 models selected  

> select subtract /A:220

102 atoms, 98 bonds, 6 residues, 2 models selected  

> select add /A:221

121 atoms, 116 bonds, 7 residues, 2 models selected  

> select add /A:224

142 atoms, 137 bonds, 8 residues, 2 models selected  

> select add /A:279@CA

143 atoms, 137 bonds, 9 residues, 2 models selected  

> select add /A:278

157 atoms, 152 bonds, 10 residues, 2 models selected  

> select subtract /A:278

143 atoms, 138 bonds, 9 residues, 2 models selected  

> select add /A:280

155 atoms, 149 bonds, 10 residues, 2 models selected  

> select subtract /A:279

154 atoms, 148 bonds, 9 residues, 2 models selected  

> select subtract /A:280

142 atoms, 137 bonds, 8 residues, 2 models selected  

> select add /A:279

161 atoms, 155 bonds, 9 residues, 2 models selected  

> select add /A:283

172 atoms, 165 bonds, 10 residues, 2 models selected  

> select add /A:277

186 atoms, 178 bonds, 11 residues, 2 models selected  

> select add /A:287

205 atoms, 196 bonds, 12 residues, 2 models selected  

> select add /A:291

224 atoms, 214 bonds, 13 residues, 2 models selected  

> select add /A:274

243 atoms, 232 bonds, 14 residues, 2 models selected  

> select add /A:270

262 atoms, 250 bonds, 15 residues, 2 models selected  

> select add /A:233

281 atoms, 268 bonds, 16 residues, 2 models selected  

> select subtract /A:233

262 atoms, 250 bonds, 15 residues, 2 models selected  

> select /A

5271 atoms, 5335 bonds, 323 residues, 1 model selected  

> color (#!1 & sel) blue

> color (#!1 & sel) cornflower blue

> color sel byhetero

> select clear

> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MRGX/AF-Q15014-F1-model_v4.pdb"

AF-Q15014-F1-model_v4.pdb title:  
Alphafold monomer V2.0 prediction for mortality factor 4-like protein 2
(Q15014) [more info...]  
  
Chain information for AF-Q15014-F1-model_v4.pdb #2  
---  
Chain | Description | UniProt  
A | mortality factor 4-like protein 2 | MO4L2_HUMAN  
  

> sequence chain #2/A

Alignment identifier is 2/A  

> select #2/A:1-288

2275 atoms, 2323 bonds, 288 residues, 1 model selected  

> color sel hot pink

> ui tool show Matchmaker

> matchmaker #2 to #1

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain A (#1) with AF-Q15014-F1-model_v4.pdb, chain A
(#2), sequence alignment score = 1033.9  
RMSD between 165 pruned atom pairs is 0.252 angstroms; (across all 267 pairs:
31.035)  
  

> select clear

> select #2/A:1-288

2275 atoms, 2323 bonds, 288 residues, 1 model selected  

> mlp sel

Map values for surface "AF-Q15014-F1-model_v4.pdb_A SES surface": minimum
-26.64, mean -5.47, maximum 23.64  
To also show corresponding color key, enter the above mlp command and add key
true  

> select #1/A

5271 atoms, 5335 bonds, 323 residues, 1 model selected  

> show sel surfaces

> color (#!1 & sel) cornflower blue

> hide sel surfaces

> select clear

> hide surfaces

> select #2/A:1-288

2275 atoms, 2323 bonds, 288 residues, 1 model selected  
Alignment identifier is 2/A  

> select clear

> hide atoms

> select #2/A:76

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select #2/A:76

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select #1/A:170

12 atoms, 11 bonds, 1 residue, 1 model selected  

> select #1/A:170

12 atoms, 11 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:135

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:135

9 atoms, 8 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:140

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select #2/A:140

7 atoms, 6 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #1/A:175

19 atoms, 18 bonds, 1 residue, 1 model selected  

> select #1/A:175

19 atoms, 18 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:140

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select #2/A:140

7 atoms, 6 bonds, 1 residue, 1 model selected  

> color sel byhetero

> show sel atoms

> hide sel atoms

> show sel atoms

> color sel byhetero

> nucleotides sel atoms

> style nucleic & sel stick

Changed 0 atom styles  

> style sel stick

Changed 7 atom styles  

> color sel byhetero

> select #1/A:183

21 atoms, 21 bonds, 1 residue, 1 model selected  

> select #1/A:183

21 atoms, 21 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:148

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:148-149

17 atoms, 16 bonds, 2 residues, 1 model selected  

> select #2/A:147-148

20 atoms, 20 bonds, 2 residues, 1 model selected  

> select #2/A:147-148

20 atoms, 20 bonds, 2 residues, 1 model selected  

> select #2/A:149-150

15 atoms, 15 bonds, 2 residues, 1 model selected  

> select #2/A:149-151

20 atoms, 20 bonds, 3 residues, 1 model selected  

> select #2/A:148

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:148

9 atoms, 8 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:157

5 atoms, 4 bonds, 1 residue, 1 model selected  

> select #2/A:157

5 atoms, 4 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

[Repeated 1 time(s)]

> nucleotides sel atoms

> style nucleic & sel stick

Changed 0 atom styles  

> select #1/A:192

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select #1/A:192

11 atoms, 10 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:161

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:161

9 atoms, 8 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #1/A:196

12 atoms, 11 bonds, 1 residue, 1 model selected  

> select #1/A:196

12 atoms, 11 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #1/A:200

21 atoms, 21 bonds, 1 residue, 1 model selected  

> select #1/A:200

21 atoms, 21 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:165

6 atoms, 5 bonds, 1 residue, 1 model selected  

> select #2/A:165

6 atoms, 5 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:169

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:169

9 atoms, 8 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #1/A:204

24 atoms, 23 bonds, 1 residue, 1 model selected  

> select #1/A:204

24 atoms, 23 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #1/A:207

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select #1/A:207

14 atoms, 13 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:172

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select #2/A:172

7 atoms, 6 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:213

5 atoms, 4 bonds, 1 residue, 1 model selected  

> select #2/A:213

5 atoms, 4 bonds, 1 residue, 1 model selected  

> select
> #2/A:112-116,127-129,131-141,155-169,173-198,201-203,205-213,219-221,225-241,246-265,267-270,273-275,281-287

1019 atoms, 1029 bonds, 126 residues, 1 model selected  

> select #2/A:212

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:212-213

13 atoms, 12 bonds, 2 residues, 1 model selected  

> show sel atoms

> color sel byhetero

> addH

Unknown command: addH  

> addcharge H

Using Amber 20 recommended default charges and atom types for standard
residues  

> show sel atoms

> color sel byhetero

> show H

> undo

> ui tool show H-Bonds

> select #1/A:247

10 atoms, 9 bonds, 1 residue, 1 model selected  

> select #1/A:247-248

22 atoms, 21 bonds, 2 residues, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:254

4 atoms, 3 bonds, 1 residue, 1 model selected  

> select #2/A:254

4 atoms, 3 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> show sel atoms

[Repeated 1 time(s)]

> select #1/A:289

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select #1/A:289

14 atoms, 13 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:269

6 atoms, 5 bonds, 1 residue, 1 model selected  

> select #2/A:269

6 atoms, 5 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #1/A:304

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select #1/A:304

14 atoms, 13 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #1/A:307

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select #1/A:307

11 atoms, 10 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:272

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select #2/A:272

7 atoms, 6 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:277

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:277

9 atoms, 8 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #1/A:312

15 atoms, 14 bonds, 1 residue, 1 model selected  

> select #1/A:312

15 atoms, 14 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #1/A:315

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select #1/A:315-316

28 atoms, 29 bonds, 2 residues, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:280

6 atoms, 5 bonds, 1 residue, 1 model selected  

> select #2/A:280-281

11 atoms, 10 bonds, 2 residues, 1 model selected  

> show sel atoms

> color sel byhetero

> select #1/A:323

17 atoms, 16 bonds, 1 residue, 1 model selected  

> select #1/A:323

17 atoms, 16 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:288

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:288

9 atoms, 8 bonds, 1 residue, 1 model selected  

> show sel atoms

> color sel byhetero

> select #2/A:1

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A

2275 atoms, 2323 bonds, 288 residues, 1 model selected  

> select #2/A:126

7 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:126-288

1318 atoms, 1350 bonds, 163 residues, 1 model selected  

> select #2/A:112

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:112-288

1437 atoms, 1470 bonds, 177 residues, 1 model selected  

> coulombic sel

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for AF-Q15014-F1-model_v4.pdb_A SES surface #2.1: minimum,
-17.15, mean 0.84, maximum 16.70  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select clear

> select #1/A:212

21 atoms, 21 bonds, 1 residue, 1 model selected  

> select #1/A:212

21 atoms, 21 bonds, 1 residue, 1 model selected  

> select #1/A:200

21 atoms, 21 bonds, 1 residue, 1 model selected  

> select #1/A:200

21 atoms, 21 bonds, 1 residue, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -25.17, mean
-3.564, maximum 24.96  
To also show corresponding color key, enter the above mlp command and add key
true  

> coulombic sel

Coulombic values for ranked_0.pdb_A SES surface #1.1: minimum, -15.58, mean
1.22, maximum 17.31  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select #1/A:202

22 atoms, 21 bonds, 1 residue, 1 model selected  

> select #1/A:202

22 atoms, 21 bonds, 1 residue, 1 model selected  

> select #1/A:204

24 atoms, 23 bonds, 1 residue, 1 model selected  

> select #1/A:204

24 atoms, 23 bonds, 1 residue, 1 model selected  

> show sel atoms

> show sel surfaces

> select #1/A:200

21 atoms, 21 bonds, 1 residue, 1 model selected  

> select #1/A:200

21 atoms, 21 bonds, 1 residue, 1 model selected  

> select #1/A:200,204

45 atoms, 44 bonds, 2 residues, 1 model selected  

> hide sel surfaces

> select #1/A:289

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select #1/A:289

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select #1/A:200,289

35 atoms, 34 bonds, 2 residues, 1 model selected  

> select #1/A:200,204,289

59 atoms, 57 bonds, 3 residues, 1 model selected  

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> select #2/A:112

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:112-288

1437 atoms, 1470 bonds, 177 residues, 1 model selected  

> hide sel surfaces

> select clear

> select #2/A:60

4 atoms, 3 bonds, 1 residue, 1 model selected  

> select #2/A:60-62

19 atoms, 18 bonds, 3 residues, 1 model selected  

> select #2/A:273-274

11 atoms, 10 bonds, 2 residues, 1 model selected  

> select #2/A:273-288

128 atoms, 130 bonds, 16 residues, 1 model selected  

> select #2/A:267

6 atoms, 5 bonds, 1 residue, 1 model selected  

> select #2/A:267-288

171 atoms, 174 bonds, 22 residues, 1 model selected  

> show sel surfaces

> select
> #2/A:112-116,127-129,131-141,155-169,173-198,201-203,205-213,219-221,225-241,246-265,267-270,273-275,281-287

1019 atoms, 1029 bonds, 126 residues, 1 model selected  

> select #2/A:155

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select #2/A:155-160

45 atoms, 44 bonds, 6 residues, 1 model selected  

> select #2/A:145

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:145-149

45 atoms, 45 bonds, 5 residues, 1 model selected  

> select #2/A:142

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select #2/A:142-155

119 atoms, 120 bonds, 14 residues, 1 model selected  

> select #2/A:137-138

22 atoms, 23 bonds, 2 residues, 1 model selected  

> select #2/A:137-154

156 atoms, 159 bonds, 18 residues, 1 model selected  

> show sel surfaces

> select clear

> select #2/A:156

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:156

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:131-132

21 atoms, 23 bonds, 2 residues, 1 model selected  

> select #2/A:131-141

97 atoms, 101 bonds, 11 residues, 1 model selected  

> show sel surfaces

> select clear

> select #1/A:170

12 atoms, 11 bonds, 1 residue, 1 model selected  

> select #1/A:170-177

136 atoms, 137 bonds, 8 residues, 1 model selected  

> show sel surfaces

> select #1/A:302

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select #1/A:302-323

334 atoms, 339 bonds, 22 residues, 1 model selected  

> show sel surfaces

> select #1/A:290-291

40 atoms, 40 bonds, 2 residues, 1 model selected  

> select #1/A:290-323

550 atoms, 559 bonds, 34 residues, 1 model selected  

> show sel surfaces

> select #1/A:271

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select #1/A:271-323

841 atoms, 852 bonds, 53 residues, 1 model selected  

> show sel surfaces

> select #2/A:112

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:112-288

1437 atoms, 1470 bonds, 177 residues, 1 model selected  

> hide sel surfaces

> select #1/A:166-167

38 atoms, 40 bonds, 2 residues, 1 model selected  

> select #1/A:166-192

465 atoms, 472 bonds, 27 residues, 1 model selected  

> show sel surfaces

> select #1/A:248

12 atoms, 11 bonds, 1 residue, 1 model selected  

> select add #2/A:212

20 atoms, 18 bonds, 2 residues, 3 models selected  

> select subtract #2/A:212

12 atoms, 11 bonds, 1 residue, 3 models selected  

> select add #2/A:212

20 atoms, 18 bonds, 2 residues, 3 models selected  

> select add #1/A:247

30 atoms, 27 bonds, 3 residues, 4 models selected  

> select #2/A:112-288

1437 atoms, 1470 bonds, 177 residues, 1 model selected  

> select #1/A:247

10 atoms, 9 bonds, 1 residue, 1 model selected  

> select #1/A:247-248

22 atoms, 21 bonds, 2 residues, 1 model selected  

> show sel surfaces

> hide sel surfaces

> select #1/A:236-237

42 atoms, 42 bonds, 2 residues, 1 model selected  

> select #1/A:236-248

218 atoms, 220 bonds, 13 residues, 1 model selected  

> show sel surfaces

> select #1/A:207

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select #1/A:207-323

1878 atoms, 1903 bonds, 117 residues, 1 model selected  

> hide sel surfaces

> select #1/A:162-163

30 atoms, 29 bonds, 2 residues, 1 model selected  

> select #1/A:162-323

2645 atoms, 2680 bonds, 162 residues, 1 model selected  

> hide sel surfaces

> select clear

Drag select of 21 atoms, 18 residues, 17 bonds  
Drag select of 11 atoms, 26 residues, 6 bonds  
Drag select of 31 atoms, 18 residues, 30 bonds  
Drag select of 6 residues, 1 atoms  

> select add #1/A:321

516 atoms, 57 bonds, 41 residues, 4 models selected  

> select add #1/A:183

537 atoms, 78 bonds, 42 residues, 4 models selected  

> select add #2/A:149

545 atoms, 85 bonds, 43 residues, 4 models selected  

> show sel surfaces

> select clear

[Repeated 2 time(s)]

> select #1/A:50

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select clear

> select #2/A:280

6 atoms, 5 bonds, 1 residue, 1 model selected  

> show sel surfaces

> select clear

> hide surfaces

> select #1/A:154

16 atoms, 15 bonds, 1 residue, 1 model selected  

> select #1/A:154

16 atoms, 15 bonds, 1 residue, 1 model selected  

> select #1/A:302

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select #1/A:302-323

334 atoms, 339 bonds, 22 residues, 1 model selected  

> show sel surfaces

> select #1/A:170

12 atoms, 11 bonds, 1 residue, 1 model selected  

> select #1/A:170-189

353 atoms, 357 bonds, 20 residues, 1 model selected  

> show sel surfaces

> select clear

> select #2/A:78

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:78-81

35 atoms, 34 bonds, 4 residues, 1 model selected  

> select #2/A:135

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:135-154

173 atoms, 176 bonds, 20 residues, 1 model selected  

> select #2/A:262

12 atoms, 12 bonds, 1 residue, 1 model selected  

> select #2/A:262-288

213 atoms, 217 bonds, 27 residues, 1 model selected  

> select #2/A:266

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:266-288

179 atoms, 182 bonds, 23 residues, 1 model selected  

> select #2/A:267

6 atoms, 5 bonds, 1 residue, 1 model selected  

> select #2/A:267-288

171 atoms, 174 bonds, 22 residues, 1 model selected  

> select #2/A:131,267-288

178 atoms, 181 bonds, 23 residues, 1 model selected  

> select #2/A:131,267-288

178 atoms, 181 bonds, 23 residues, 1 model selected  

> select #2/A:131,267-288

178 atoms, 181 bonds, 23 residues, 1 model selected  

> select #2/A:131,135-154,267-288

351 atoms, 357 bonds, 43 residues, 1 model selected  

> select #2/A:131,135-154,267-288

351 atoms, 357 bonds, 43 residues, 1 model selected  

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

[Repeated 1 time(s)]

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

No map chosen to save  
[Repeated 1 time(s)]

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRG15 Surface 1.tif" width 749 height 533 supersample 3

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> select #1/A:170-171

24 atoms, 23 bonds, 2 residues, 1 model selected  

> select #1/A:170-196

457 atoms, 461 bonds, 27 residues, 1 model selected  

> hide sel surfaces

> select #1/A:295

19 atoms, 18 bonds, 1 residue, 1 model selected  

> select #1/A:295-323

461 atoms, 467 bonds, 29 residues, 1 model selected  

> hide sel surfaces

> select clear

> select #2/A:131-154,267-288

380 atoms, 389 bonds, 46 residues, 1 model selected  

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> select #1/A:166

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select #1/A:166-189

426 atoms, 433 bonds, 24 residues, 1 model selected  

> select #1/A:166-189,307-323

686 atoms, 697 bonds, 41 residues, 1 model selected  

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> select clear

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRGX Surface 1.tif" width 749 height 533 supersample 3

> select #1/A:166

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select #1/A:166-323

2574 atoms, 2609 bonds, 158 residues, 1 model selected  

> show sel surfaces

> select #2/A:127

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:127-288

1311 atoms, 1342 bonds, 162 residues, 1 model selected  

> hide sel surfaces

> select clear

> select #1/A:161

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select #1/A:161-323

2659 atoms, 2695 bonds, 163 residues, 1 model selected  

> show sel surfaces

> select clear

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRG15 Surface 2.tif" width 749 height 533 supersample 3

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRG15 Surface 3.tif" width 749 height 533 supersample 3

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRG15 Surface 4.tif" width 749 height 533 supersample 3

> select #1/A:161

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select #1/A:161-323

2659 atoms, 2695 bonds, 163 residues, 1 model selected  

> hide sel surfaces

> select #2/A:126-127

16 atoms, 16 bonds, 2 residues, 1 model selected  

> select #2/A:126-288

1318 atoms, 1350 bonds, 163 residues, 1 model selected  

> show sel surfaces

> select clear

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRGX Surface 2.tif" width 749 height 533 supersample 3

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRGX Surface 3.tif" width 749 height 533 supersample 3

> save "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRGX/MRG15 MRGX Comparison
> MRGX Surface 4.tif" width 749 height 533 supersample 3

> select #1/A:161

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select #1/A:161-323

2659 atoms, 2695 bonds, 163 residues, 1 model selected  

> select #2/A:126

7 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:126-288

1318 atoms, 1350 bonds, 163 residues, 1 model selected  

> hide sel surfaces

> select clear

> select #1/A:161

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select #1/A:161-323

2659 atoms, 2695 bonds, 163 residues, 1 model selected  

> mlp sel

Map values for surface "ranked_0.pdb_A SES surface": minimum -25.17, mean
-3.564, maximum 24.96  
To also show corresponding color key, enter the above mlp command and add key
true  

> select clear

> select #1/A:161

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select #1/A:161-323

2659 atoms, 2695 bonds, 163 residues, 1 model selected  

> hide sel surfaces

> select #2/A:126

7 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:126-288

1318 atoms, 1350 bonds, 163 residues, 1 model selected  

> show sel surfaces

> mlp sel

Map values for surface "AF-Q15014-F1-model_v4.pdb_A SES surface": minimum
-26.64, mean -5.47, maximum 23.64  
To also show corresponding color key, enter the above mlp command and add key
true  

> select clear

> select #1/A:161

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select #1/A:161-323

2659 atoms, 2695 bonds, 163 residues, 1 model selected  

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> hide sel surfaces

> select clear

> select #1/A:161

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select #1/A:161-323

2659 atoms, 2695 bonds, 163 residues, 1 model selected  

> hide sel surfaces

> select #2/A:126

7 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:126-288

1318 atoms, 1350 bonds, 163 residues, 1 model selected  

> hide sel surfaces

> select clear

> select #1/A:140-141

28 atoms, 27 bonds, 2 residues, 1 model selected  

> select #1/A:140-141

28 atoms, 27 bonds, 2 residues, 1 model selected  

> select #2/A:112

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select #2/A:112-116

43 atoms, 43 bonds, 5 residues, 1 model selected  

> select #1/A:89

17 atoms, 16 bonds, 1 residue, 1 model selected  

> select #1/A:89-93

68 atoms, 67 bonds, 5 residues, 1 model selected  

> select #2/A:1

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:1-33

265 atoms, 267 bonds, 33 residues, 1 model selected  

> select #2/A:56-57

11 atoms, 11 bonds, 2 residues, 1 model selected  

> select #2/A:56-62

55 atoms, 57 bonds, 7 residues, 1 model selected  

> select #2/A:34

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:34-111

573 atoms, 584 bonds, 78 residues, 1 model selected  

> mlp sel

Map values for surface "AF-Q15014-F1-model_v4.pdb_A SES surface": minimum
-26.64, mean -5.47, maximum 23.64  
To also show corresponding color key, enter the above mlp command and add key
true  

> coulombic sel

Coulombic values for AF-Q15014-F1-model_v4.pdb_A SES surface #2.1: minimum,
-17.15, mean 0.84, maximum 16.70  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select #2/A:53

7 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:53-71

133 atoms, 138 bonds, 19 residues, 1 model selected  

> mlp sel

Map values for surface "AF-Q15014-F1-model_v4.pdb_A SES surface": minimum
-26.64, mean -5.47, maximum 23.64  
To also show corresponding color key, enter the above mlp command and add key
true  

> coulombic sel

Coulombic values for AF-Q15014-F1-model_v4.pdb_A SES surface #2.1: minimum,
-17.15, mean 0.84, maximum 16.70  
To also show corresponding color key, enter the above coulombic command and
add key true  

> select #1/A:88

22 atoms, 21 bonds, 1 residue, 1 model selected  

> select #1/A:88-161

1170 atoms, 1177 bonds, 74 residues, 1 model selected  

> hide sel surfaces

> select #2/A:53

7 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:53-115

470 atoms, 481 bonds, 63 residues, 1 model selected  

> hide sel surfaces

> select clear

> select #2/A:1

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select #2/A:1-33

265 atoms, 267 bonds, 33 residues, 1 model selected  

> show sel surfaces

> hide sel surfaces

> select clear

> close session

> open "/Users/Gareth/Documents/DDR 2022/AlphaFold/MRG15/MRG15/ranked_0.pdb"

Chain information for ranked_0.pdb #1  
---  
Chain | Description  
A | No description available  
  

> select /A:1-323

5271 atoms, 5335 bonds, 323 residues, 1 model selected  

> color sel cornflower blue

> open "/Users/Gareth/Documents/DDR
> 2022/AlphaFold/MSLH3/AF-Q8N5Y2-F1-model_v4.pdb"

AF-Q8N5Y2-F1-model_v4.pdb title:  
Alphafold monomer V2.0 prediction for male-specific lethal 3 homolog (Q8N5Y2)
[more info...]  
  
Chain information for AF-Q8N5Y2-F1-model_v4.pdb #2  
---  
Chain | Description | UniProt  
A | male-specific lethal 3 homolog | MS3L1_HUMAN  
  

> select #2/A:1-521

4212 atoms, 4311 bonds, 521 residues, 1 model selected  

> color sel hot pink

> ui tool show Matchmaker

> matchmaker #2 to #1

Parameters  
---  
Chain pairing | bb  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker ranked_0.pdb, chain A (#1) with AF-Q8N5Y2-F1-model_v4.pdb, chain A
(#2), sequence alignment score = 494.6  
RMSD between 136 pruned atom pairs is 0.606 angstroms; (across all 320 pairs:
37.193)  
  

> select clear

> ui tool show Matchmaker

Traceback (most recent call last):  
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/core/triggerset.py", line 134, in invoke  
return self._func(self._name, data)  
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 50, in <lambda>  
data[0] == pself.attr_name and (setattr(pself, "value", pself.get_attribute())  
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 342, in set_value  
self.__button_group.button(self.values.index(value)).setChecked(True)  
AttributeError: 'NoneType' object has no attribute 'setChecked'  
  
Error processing trigger "setting changed":  
AttributeError: 'NoneType' object has no attribute 'setChecked'  
  
File
"/Applications/ChimeraX-1.5.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-
packages/chimerax/ui/options/options.py", line 342, in set_value  
self.__button_group.button(self.values.index(value)).setChecked(True)  
  
See log for complete Python traceback.  
  




OpenGL version: 4.1 INTEL-12.10.12
OpenGL renderer: Intel Iris OpenGL Engine
OpenGL vendor: Intel Inc.

Python: 3.9.11
Locale: UTF-8
Qt version: PyQt6 6.3.1, Qt 6.3.1
Qt runtime version: 6.3.2
Qt platform: cocoa
Hardware:

    Hardware Overview:

      Model Name: MacBook Pro
      Model Identifier: MacBookPro11,1
      Processor Name: Intel Core i5
      Processor Speed: 2.6 GHz
      Number of Processors: 1
      Total Number of Cores: 2
      L2 Cache (per Core): 256 KB
      L3 Cache: 3 MB
      Hyper-Threading Technology: Enabled
      Memory: 8 GB
      Boot ROM Version: 156.0.0.0.0
      SMC Version (system): 2.16f68

Software:

    System Software Overview:

      System Version: macOS 10.14.6 (18G103)
      Kernel Version: Darwin 18.7.0
      Time since boot: 96 days 3:37

Graphics/Displays:

    Intel Iris:

      Chipset Model: Intel Iris
      Type: GPU
      Bus: Built-In
      VRAM (Dynamic, Max): 1536 MB
      Vendor: Intel
      Device ID: 0x0a2e
      Revision ID: 0x0009
      Metal: Supported, feature set macOS GPUFamily1 v4
      Displays:
        Color LCD:
          Display Type: Built-In Retina LCD
          Resolution: 2560 x 1600 Retina
          Framebuffer Depth: 24-Bit Color (ARGB8888)
          Main Display: Yes
          Mirror: Off
          Online: Yes
          Rotation: Supported
          Automatically Adjust Brightness: No


Installed Packages:
    alabaster: 0.7.12
    appdirs: 1.4.4
    appnope: 0.1.3
    asttokens: 2.1.0
    Babel: 2.11.0
    backcall: 0.2.0
    blockdiag: 3.0.0
    build: 0.8.0
    certifi: 2021.10.8
    cftime: 1.6.2
    charset-normalizer: 2.1.1
    ChimeraX-AddCharge: 1.4
    ChimeraX-AddH: 2.2.1
    ChimeraX-AlignmentAlgorithms: 2.0
    ChimeraX-AlignmentHdrs: 3.2.1
    ChimeraX-AlignmentMatrices: 2.0
    ChimeraX-Alignments: 2.6
    ChimeraX-AlphaFold: 1.0
    ChimeraX-AltlocExplorer: 1.0.3
    ChimeraX-AmberInfo: 1.0
    ChimeraX-Arrays: 1.0
    ChimeraX-Atomic: 1.41.5
    ChimeraX-AtomicLibrary: 8.0.3
    ChimeraX-AtomSearch: 2.0.1
    ChimeraX-AxesPlanes: 2.3
    ChimeraX-BasicActions: 1.1.2
    ChimeraX-BILD: 1.0
    ChimeraX-BlastProtein: 2.1.2
    ChimeraX-BondRot: 2.0.1
    ChimeraX-BugReporter: 1.0.1
    ChimeraX-BuildStructure: 2.7.1
    ChimeraX-Bumps: 1.0
    ChimeraX-BundleBuilder: 1.2
    ChimeraX-ButtonPanel: 1.0.1
    ChimeraX-CageBuilder: 1.0.1
    ChimeraX-CellPack: 1.0
    ChimeraX-Centroids: 1.3.1
    ChimeraX-ChangeChains: 1.0.2
    ChimeraX-CheckWaters: 1.3
    ChimeraX-ChemGroup: 2.0
    ChimeraX-Clashes: 2.2.4
    ChimeraX-ColorActions: 1.0.3
    ChimeraX-ColorGlobe: 1.0
    ChimeraX-ColorKey: 1.5.2
    ChimeraX-CommandLine: 1.2.4
    ChimeraX-ConnectStructure: 2.0.1
    ChimeraX-Contacts: 1.0.1
    ChimeraX-Core: 1.5
    ChimeraX-CoreFormats: 1.1
    ChimeraX-coulombic: 1.3.2
    ChimeraX-Crosslinks: 1.0
    ChimeraX-Crystal: 1.0
    ChimeraX-CrystalContacts: 1.0.1
    ChimeraX-DataFormats: 1.2.2
    ChimeraX-Dicom: 1.1
    ChimeraX-DistMonitor: 1.3
    ChimeraX-DockPrep: 1.0
    ChimeraX-Dssp: 2.0
    ChimeraX-EMDB-SFF: 1.0
    ChimeraX-ExperimentalCommands: 1.0
    ChimeraX-FileHistory: 1.0.1
    ChimeraX-FunctionKey: 1.0.1
    ChimeraX-Geometry: 1.2
    ChimeraX-gltf: 1.0
    ChimeraX-Graphics: 1.1
    ChimeraX-Hbonds: 2.4
    ChimeraX-Help: 1.2.1
    ChimeraX-HKCage: 1.3
    ChimeraX-IHM: 1.1
    ChimeraX-ImageFormats: 1.2
    ChimeraX-IMOD: 1.0
    ChimeraX-IO: 1.0.1
    ChimeraX-ItemsInspection: 1.0.1
    ChimeraX-Label: 1.1.7
    ChimeraX-ListInfo: 1.1.1
    ChimeraX-Log: 1.1.5
    ChimeraX-LookingGlass: 1.1
    ChimeraX-Maestro: 1.8.2
    ChimeraX-Map: 1.1.2
    ChimeraX-MapData: 2.0
    ChimeraX-MapEraser: 1.0.1
    ChimeraX-MapFilter: 2.0
    ChimeraX-MapFit: 2.0
    ChimeraX-MapSeries: 2.1.1
    ChimeraX-Markers: 1.0.1
    ChimeraX-Mask: 1.0.1
    ChimeraX-MatchMaker: 2.0.9
    ChimeraX-MDcrds: 2.6
    ChimeraX-MedicalToolbar: 1.0.2
    ChimeraX-Meeting: 1.0.1
    ChimeraX-MLP: 1.1
    ChimeraX-mmCIF: 2.8
    ChimeraX-MMTF: 2.2
    ChimeraX-Modeller: 1.5.6
    ChimeraX-ModelPanel: 1.3.6
    ChimeraX-ModelSeries: 1.0.1
    ChimeraX-Mol2: 2.0
    ChimeraX-Mole: 1.0
    ChimeraX-Morph: 1.0.1
    ChimeraX-MouseModes: 1.1.1
    ChimeraX-Movie: 1.0
    ChimeraX-Neuron: 1.0
    ChimeraX-Nucleotides: 2.0.3
    ChimeraX-OpenCommand: 1.9.1
    ChimeraX-PDB: 2.6.8
    ChimeraX-PDBBio: 1.0
    ChimeraX-PDBLibrary: 1.0.2
    ChimeraX-PDBMatrices: 1.0
    ChimeraX-PickBlobs: 1.0.1
    ChimeraX-Positions: 1.0
    ChimeraX-PresetMgr: 1.1
    ChimeraX-PubChem: 2.1
    ChimeraX-ReadPbonds: 1.0.1
    ChimeraX-Registration: 1.1.1
    ChimeraX-RemoteControl: 1.0
    ChimeraX-RenumberResidues: 1.1
    ChimeraX-ResidueFit: 1.0.1
    ChimeraX-RestServer: 1.1
    ChimeraX-RNALayout: 1.0
    ChimeraX-RotamerLibMgr: 2.0.1
    ChimeraX-RotamerLibsDunbrack: 2.0
    ChimeraX-RotamerLibsDynameomics: 2.0
    ChimeraX-RotamerLibsRichardson: 2.0
    ChimeraX-SaveCommand: 1.5.1
    ChimeraX-SchemeMgr: 1.0
    ChimeraX-SDF: 2.0
    ChimeraX-Segger: 1.0
    ChimeraX-Segment: 1.0
    ChimeraX-SelInspector: 1.0
    ChimeraX-SeqView: 2.7.2
    ChimeraX-Shape: 1.0.1
    ChimeraX-Shell: 1.0.1
    ChimeraX-Shortcuts: 1.1.1
    ChimeraX-ShowSequences: 1.0.1
    ChimeraX-SideView: 1.0.1
    ChimeraX-Smiles: 2.1
    ChimeraX-SmoothLines: 1.0
    ChimeraX-SpaceNavigator: 1.0
    ChimeraX-StdCommands: 1.10
    ChimeraX-STL: 1.0
    ChimeraX-Storm: 1.0
    ChimeraX-StructMeasure: 1.1
    ChimeraX-Struts: 1.0.1
    ChimeraX-Surface: 1.0
    ChimeraX-SwapAA: 2.0.1
    ChimeraX-SwapRes: 2.1.3
    ChimeraX-TapeMeasure: 1.0
    ChimeraX-Test: 1.0
    ChimeraX-Toolbar: 1.1.2
    ChimeraX-ToolshedUtils: 1.2.1
    ChimeraX-Tug: 1.0.1
    ChimeraX-UI: 1.24.3
    ChimeraX-uniprot: 2.2.1
    ChimeraX-UnitCell: 1.0.1
    ChimeraX-ViewDockX: 1.1.4
    ChimeraX-VIPERdb: 1.0
    ChimeraX-Vive: 1.1
    ChimeraX-VolumeMenu: 1.0.1
    ChimeraX-VTK: 1.0
    ChimeraX-WavefrontOBJ: 1.0
    ChimeraX-WebCam: 1.0.1
    ChimeraX-WebServices: 1.1.0
    ChimeraX-Zone: 1.0.1
    colorama: 0.4.5
    cxservices: 1.2
    cycler: 0.11.0
    Cython: 0.29.32
    debugpy: 1.6.4
    decorator: 5.1.1
    docutils: 0.19
    entrypoints: 0.4
    executing: 1.2.0
    filelock: 3.7.1
    fonttools: 4.38.0
    funcparserlib: 1.0.1
    grako: 3.16.5
    h5py: 3.7.0
    html2text: 2020.1.16
    idna: 3.4
    ihm: 0.33
    imagecodecs: 2022.7.31
    imagesize: 1.4.1
    importlib-metadata: 5.1.0
    ipykernel: 6.15.3
    ipython: 8.4.0
    ipython-genutils: 0.2.0
    jedi: 0.18.1
    Jinja2: 3.1.2
    jupyter-client: 7.3.4
    jupyter-core: 5.1.0
    kiwisolver: 1.4.4
    line-profiler: 3.5.1
    lxml: 4.9.1
    lz4: 4.0.2
    MarkupSafe: 2.1.1
    matplotlib: 3.5.2
    matplotlib-inline: 0.1.6
    msgpack: 1.0.4
    nest-asyncio: 1.5.6
    netCDF4: 1.6.0
    networkx: 2.8.5
    numexpr: 2.8.4
    numpy: 1.23.1
    openvr: 1.23.701
    packaging: 21.3
    ParmEd: 3.4.3
    parso: 0.8.3
    pep517: 0.13.0
    pexpect: 4.8.0
    pickleshare: 0.7.5
    Pillow: 9.2.0
    pip: 22.2.2
    pkginfo: 1.8.3
    platformdirs: 2.5.4
    prompt-toolkit: 3.0.33
    psutil: 5.9.1
    ptyprocess: 0.7.0
    pure-eval: 0.2.2
    pycollada: 0.7.2
    pydicom: 2.3.0
    Pygments: 2.12.0
    PyOpenGL: 3.1.5
    PyOpenGL-accelerate: 3.1.5
    pyparsing: 3.0.9
    PyQt6-commercial: 6.3.1
    PyQt6-Qt6: 6.3.2
    PyQt6-sip: 13.4.0
    PyQt6-WebEngine-commercial: 6.3.1
    PyQt6-WebEngine-Qt6: 6.3.2
    python-dateutil: 2.8.2
    pytz: 2022.6
    pyzmq: 24.0.1
    qtconsole: 5.3.1
    QtPy: 2.3.0
    RandomWords: 0.4.0
    requests: 2.28.1
    scipy: 1.9.0
    setuptools: 65.1.1
    setuptools-scm: 7.0.5
    sfftk-rw: 0.7.2
    six: 1.16.0
    snowballstemmer: 2.2.0
    sortedcontainers: 2.4.0
    Sphinx: 5.1.1
    sphinx-autodoc-typehints: 1.19.1
    sphinxcontrib-applehelp: 1.0.2
    sphinxcontrib-blockdiag: 3.0.0
    sphinxcontrib-devhelp: 1.0.2
    sphinxcontrib-htmlhelp: 2.0.0
    sphinxcontrib-jsmath: 1.0.1
    sphinxcontrib-qthelp: 1.0.3
    sphinxcontrib-serializinghtml: 1.1.5
    stack-data: 0.6.2
    tables: 3.7.0
    tifffile: 2022.7.31
    tinyarray: 1.2.4
    tomli: 2.0.1
    tornado: 6.2
    traitlets: 5.3.0
    typing-extensions: 4.4.0
    urllib3: 1.26.13
    wcwidth: 0.2.5
    webcolors: 1.12
    wheel: 0.37.1
    wheel-filename: 1.4.1
    zipp: 3.11.0

Change History (2)

comment:1 by Eric Pettersen, 4 years ago

Component: UnassignedStructure Comparison
Owner: set to Eric Pettersen
Platform: all
Project: ChimeraX
Status: newaccepted
Summary: ChimeraX bug report submissionMatchMaker: 'NoneType' object has no attribute 'setChecked'

comment:2 by Eric Pettersen, 4 years ago

Resolution: can't reproduce
Status: acceptedclosed
Note: See TracTickets for help on using tickets.