![[ChimeraX Issue Tracking System]](/trac/ChimeraX/chrome/site/ChimeraX-icon.svg){kind=icon}
Opened 3 years ago
Closed 3 years ago
#7207 closed defect (can't reproduce)
Crash in event loop
| Reported by: | Owned by: | Eric Pettersen | |
|---|---|---|---|
| Priority: | normal | Milestone: | |
| Component: | Core | Version: | |
| Keywords: | Cc: | Tom Goddard | |
| Blocked By: | Blocking: | ||
| Notify when closed: | Platform: | all | |
| Project: | ChimeraX |
Description
The following bug report has been submitted:
Platform: Windows-10-10.0.22000
ChimeraX Version: 1.2.1 (2021-05-05 02:17:36 UTC)
Description
Last time you used ChimeraX it crashed.
Please describe steps that led to the crash here.
Windows fatal exception: code 0x8001010d
Thread 0x00004394 (most recent call first):
File "C:\Program Files\ChimeraX 1.2.1\bin\lib\threading.py", line 306 in wait
File "C:\Program Files\ChimeraX 1.2.1\bin\lib\threading.py", line 558 in wait
File "C:\Program Files\ChimeraX 1.2.1\bin\lib\threading.py", line 1252 in run
File "C:\Program Files\ChimeraX 1.2.1\bin\lib\threading.py", line 932 in _bootstrap_inner
File "C:\Program Files\ChimeraX 1.2.1\bin\lib\threading.py", line 890 in _bootstrap
Current thread 0x000008a8 (most recent call first):
File "C:\Program Files\ChimeraX 1.2.1\bin\lib\site-packages\chimerax\ui\gui.py", line 293 in event_loop
File "C:\Program Files\ChimeraX 1.2.1\bin\lib\site-packages\ChimeraX_main.py", line 866 in init
File "C:\Program Files\ChimeraX 1.2.1\bin\lib\site-packages\ChimeraX_main.py", line 1015 in
File "C:\Program Files\ChimeraX 1.2.1\bin\lib\runpy.py", line 87 in _run_code
File "C:\Program Files\ChimeraX 1.2.1\bin\lib\runpy.py", line 194 in _run_module_as_main
Log:
UCSF ChimeraX version: 1.2.1 (2021-05-05)
© 2016-2021 Regents of the University of California. All rights reserved.
> open "C:\\\Users\\\Chema\\\Desktop\\\chimeraX\\\anillo\\\anillo_sin
> colas.cxs"
Log from Fri Jul 1 10:46:31 2022UCSF ChimeraX version: 1.2.1 (2021-05-05)
© 2016-2021 Regents of the University of California. All rights reserved.
> open C:\\\Users\\\Chema\\\Desktop\\\chimeraX\\\anillo\\\anillo_NPs_colas.cxs
Log from Mon Jun 27 18:16:57 2022UCSF ChimeraX version: 1.2.1 (2021-05-05)
© 2016-2021 Regents of the University of California. All rights reserved.
> open "C:\\\Users\\\Chema\\\Desktop\\\chimeraX\\\anillo\\\anillo y sus
> colasnanos.cxs"
Log from Thu Jun 9 14:38:24 2022UCSF ChimeraX version: 1.2.1 (2021-05-05)
© 2016-2021 Regents of the University of California. All rights reserved.
How to cite UCSF ChimeraX
> open C:\Users\Chema\Desktop\chimeraX\anillo\10nm.pdb format pdb
Summary of feedback from opening
C:\Users\Chema\Desktop\chimeraX\anillo\10nm.pdb
---
warning | Ignored bad PDB record found on line 31176
END
> ui tool show "Build Structure"
> build start nucleic "custom built" GTGTGTGTGTGTGTGTGGGTAGTAGTAG type dna
> form B
Chain information for custom built #2
---
Chain | Description
A | No description available
B | No description available
> select #2/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> ui mousemode right translate
> ui mousemode right "translate selected atoms"
> ui mousemode right "rotate selected models"
> ui mousemode right "move picked models"
> ui mousemode right "translate selected atoms"
> ui mousemode right rotate
> ui mousemode right "translate selected atoms"
> hide #1 models
> show #1 models
> ui mousemode right "rotate selected models"
> view matrix models
> #2,-0.0095606,0.30275,-0.95302,63.409,-0.99875,0.043848,0.023949,-1.6893,0.049039,0.95206,0.30196,46.518
> view matrix models
> #2,-0.17848,0.31531,-0.93206,61.81,-0.98327,-0.022137,0.1808,-12.257,0.036373,0.94873,0.31398,45.693
> ui mousemode right "translate selected atoms"
> select #2/B
554 atoms, 620 bonds, 28 residues, 1 model selected
> ui mousemode right select
> select ::name="A"::name="C"::name="DA"::name="DG"::name="DT"::name="T"
1142 atoms, 1280 bonds, 56 residues, 1 model selected
Drag select of 2682 atoms, 15720 bonds
> select #2/A
588 atoms, 660 bonds, 28 residues, 1 model selected
Drag select of 17 atoms, 107 bonds
> select #2/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> ui mousemode right "translate selected atoms"
> select clear
> select #2
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> show sel surfaces
> select #1
31173 atoms, 178956 bonds, 1 residue, 1 model selected
> select #2
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> show sel surfaces
> select #1
31173 atoms, 178956 bonds, 1 residue, 1 model selected
> show sel surfaces
> select clear
> open C:/Users/Chema/Desktop/chimeraX/anillo/output.dat.pdb
Summary of feedback from opening
C:/Users/Chema/Desktop/chimeraX/anillo/output.dat.pdb
---
warnings | Duplicate atom serial number found: 1
Duplicate atom serial number found: 2
Duplicate atom serial number found: 3
Duplicate atom serial number found: 4
Duplicate atom serial number found: 5
436283 messages similar to the above omitted
Chain information for output.dat.pdb #3
---
Chain | Description
A | No description available
B | No description available
C | No description available
D | No description available
E | No description available
F | No description available
G | No description available
H | No description available
I | No description available
J | No description available
K | No description available
L | No description available
M | No description available
N | No description available
O | No description available
P | No description available
Q | No description available
R | No description available
S | No description available
T | No description available
U | No description available
V | No description available
W | No description available
X | No description available
Y | No description available
Z | No description available
> select #1
31173 atoms, 178956 bonds, 1 residue, 1 model selected
> select #2
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #1
31173 atoms, 178956 bonds, 1 residue, 1 model selected
> select #2
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> undo
> ui mousemode right rotate
> ~select #2
2 models selected
> transparency 50
> save "C:/Users/Chema/Desktop/chimeraX/anillo/anillo y sus colas.cxs"
> includeMaps true
> select #2
1142 atoms, 1280 bonds, 56 residues, 1 model selected
Drag select of 10nm.pdb_ SES surface, 39715 of 775446 triangles, 1261 atoms,
7165 bonds
> select #1
31173 atoms, 178956 bonds, 1 residue, 1 model selected
> ~select #1
1 model selected
> select #2
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> ui mousemode right minimize
> ui mousemode right zone
> build start nucleic "custom built" GTGTGTGTGTGTGTGTGGGTAGTAGTAG type dna
> form B
Chain information for custom built #4
---
Chain | Description
A | No description available
B | No description available
> build start nucleic "custom built" GTGTGTGTGTGTGTGTGGGTAGTAGTAG type dna
> form B
Chain information for custom built #5
---
Chain | Description
A | No description available
B | No description available
> build start nucleic "custom built" GTGTGTGTGTGTGTGTGGGTAGTAGTAG type dna
> form B
Chain information for custom built #6
---
Chain | Description
A | No description available
B | No description available
> build start nucleic "custom built" GTGTGTGTGTGTGTGTGGGTAGTAGTAG type dna
> form B
Chain information for custom built #7
---
Chain | Description
A | No description available
B | No description available
> build start nucleic "custom built" GTGTGTGTGTGTGTGTGGGTAGTAGTAG type dna
> form B
Chain information for custom built #8
---
Chain | Description
A | No description available
B | No description available
> build start nucleic "custom built" GTGTGTGTGTGTGTGTGGGTAGTAGTAG type dna
> form B
Chain information for custom built #9
---
Chain | Description
A | No description available
B | No description available
> build start nucleic "custom built" GTGTGTGTGTGTGTGTGGGTAGTAGTAG type dna
> form B
Chain information for custom built #10
---
Chain | Description
A | No description available
B | No description available
> build start nucleic "custom built" GTGTGTGTGTGTGTGTGGGTAGTAGTAG type dna
> form B
Chain information for custom built #11
---
Chain | Description
A | No description available
B | No description available
> build start nucleic "custom built" GTGTGTGTGTGTGTGTGGGTAGTAGTAG type dna
> form B
Chain information for custom built #12
---
Chain | Description
A | No description available
B | No description available
> select #12
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> ui mousemode right translate
> ui mousemode right "translate selected atoms"
> ~select #12
Nothing selected
> select #11
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> ~select #11
Nothing selected
> select #10
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #9
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> ~select #9
Nothing selected
> select #8
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #7
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #6
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #5
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> ~select #5
Nothing selected
> select #4
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> ui mousemode right rotate
> ui mousemode right "rotate selected models"
> view matrix models
> #4,0.96733,-0.12183,0.22231,8.4166,0.14337,0.98615,-0.083377,2.2049,-0.20907,0.11253,0.9714,-9.8039
> select #3
536287 atoms, 578185 bonds, 16876 residues, 1 model selected
> ~select #3
Nothing selected
> select #5
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> view matrix models
> #5,0.61175,0.79098,0.010955,-57.767,-0.54529,0.41162,0.73023,54.834,0.57309,-0.45269,0.68311,28.071
> view matrix models
> #5,0.87211,0.48916,-0.012006,-40.062,-0.32716,0.56468,-0.7577,81.367,-0.36385,0.66472,0.6525,-34.738
> view matrix models
> #5,0.88481,0.46233,0.058038,-40.479,-0.30942,0.67611,-0.66868,67.039,-0.34839,0.57369,0.74128,-29.859
> ui mousemode right "translate selected models"
> view matrix models
> #5,0.88481,0.46233,0.058038,-37.121,-0.30942,0.67611,-0.66868,35.752,-0.34839,0.57369,0.74128,-8.9031
> view matrix models
> #5,0.88481,0.46233,0.058038,-29.642,-0.30942,0.67611,-0.66868,30.543,-0.34839,0.57369,0.74128,-14.913
> select #4
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #5
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #6
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #5
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #6
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> view matrix models #6,1,0,0,5.7766,0,1,0,-7.5297,0,0,1,-10.069
> ui mousemode right "rotate selected models"
> view matrix models
> #6,-0.2901,0.90948,-0.29782,-107.71,0.65787,-0.036487,-0.75225,111.47,-0.69502,-0.41415,-0.58773,25.288
> view matrix models
> #6,-0.55397,0.65026,-0.51988,-114.64,0.10485,-0.56499,-0.81841,73.694,-0.82591,-0.50788,0.2448,-33.053
> view matrix models
> #6,-0.45894,0.71392,-0.52885,-106.55,0.051697,-0.57278,-0.81808,69.002,-0.88696,-0.40279,0.22596,-39.125
> hide #3 models
> ui mousemode right "rotate selected models"
> view matrix models
> #6,0.5681,-0.30357,0.76492,-72.525,-0.7212,0.26405,0.64042,-97.961,-0.39639,-0.91549,-0.068925,30.184
> view matrix models
> #6,0.060198,0.75597,0.65183,-128.46,-0.84735,0.38386,-0.36693,-53.137,-0.5276,-0.53024,0.66368,-29.945
> view matrix models
> #6,-0.56835,0.6764,-0.46847,-119.31,0.23863,-0.40939,-0.8806,86.904,-0.78742,-0.61228,0.071266,-17.935
> ui mousemode right "move picked models"
> ui mousemode right "translate selected atoms"
> select #7
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> ui mousemode right "rotate selected models"
> view matrix models
> #7,0.096216,0.92705,-0.36237,-49.862,0.22508,0.33437,0.91517,71.713,0.96958,-0.16962,-0.17649,-59.017
> view matrix models
> #7,0.35511,0.63461,-0.68641,-47.322,0.54397,0.45687,0.70382,44.523,0.76026,-0.62332,-0.18297,-17.722
> view matrix models
> #7,0.35397,0.62564,-0.69518,-46.889,0.54867,0.46305,0.69609,43.645,0.75741,-0.62782,-0.17937,-17.168
> ui mousemode right "translate selected atoms"
> select #8
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> ui mousemode right "rotate selected models"
> view matrix models
> #8,0.22845,0.96204,0.14932,26.701,-0.91528,0.26451,-0.30382,84.651,-0.33178,-0.06726,0.94096,25.058
> view matrix models
> #8,0.10919,0.99396,0.011193,33.338,-0.92606,0.10581,-0.36224,89.785,-0.36124,0.029189,0.93202,24.213
> view matrix models
> #8,0.13179,0.99087,0.028357,31.939,-0.82093,0.12513,-0.55714,80.625,-0.55561,0.050147,0.82993,36.692
> ui mousemode right "translate selected atoms"
> select #9
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> ui mousemode right "rotate selected models"
> view matrix models
> #9,-0.548,-0.42594,-0.71991,113.77,0.48972,0.53436,-0.68894,-6.2034,0.67814,-0.73009,-0.084235,-4.3578
> view matrix models
> #9,-0.81472,-0.19485,-0.54613,131.04,0.38765,0.5174,-0.7629,4.0728,0.43122,-0.83327,-0.346,22.662
> view matrix models
> #9,-0.69016,-0.40798,-0.59768,113.64,0.28878,0.60204,-0.74442,13.923,0.66354,-0.68637,-0.29769,15.734
> ui mousemode right "translate selected atoms"
> select #10
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> ui mousemode right "rotate selected models"
> view matrix models
> #10,0.85426,-0.5171,-0.053334,-31.013,0.51356,0.85539,-0.067617,-32.43,0.080586,0.030373,0.99628,-1.2652
> view matrix models
> #10,0.69366,-0.71182,0.11021,-30.998,0.68368,0.60247,-0.41184,-70.125,0.22676,0.36103,0.90457,11.311
> view matrix models
> #10,0.7026,-0.70204,0.11613,-30.449,0.67482,0.60559,-0.42175,-69.981,0.22576,0.37469,0.89925,12.041
> ui mousemode right "translate selected atoms"
> ui mousemode right "rotate selected models"
> view matrix models
> #10,0.7456,-0.65189,0.13827,-28.284,0.63098,0.62386,-0.46115,-68.295,0.21436,0.43108,0.87648,15.378
> view matrix models
> #10,0.6471,-0.74527,0.16071,-28.076,0.7212,0.53002,-0.44603,-78.946,0.24724,0.40454,0.88047,11.942
> ui mousemode right "translate selected atoms"
> select #9/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> ui mousemode right "rotate selected models"
> view matrix models
> #9,-0.82256,-0.46206,-0.33149,101.61,-0.036061,0.62413,-0.78049,35.083,0.56753,-0.63005,-0.53005,38.294
> select #6/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> view matrix models
> #6,-0.58232,0.79407,0.17423,-121.84,-0.44598,-0.13284,-0.88513,11.165,-0.67971,-0.59313,0.4315,-6.5714
> undo
> ui mousemode right "translate selected atoms"
> ui mousemode right "rotate selected models"
> view matrix models
> #6,-0.52798,0.72614,-0.44041,-116.29,0.24025,-0.36969,-0.89756,86.266,-0.81457,-0.5797,0.020737,-21.298
> undo
> view matrix models
> #6,-0.61658,0.63647,-0.4634,-123.76,0.17842,-0.46032,-0.86964,81.34,-0.76681,-0.61888,0.17027,-16.386
> ui mousemode right "translate selected atoms"
> ui mousemode right "translate selected models"
> view matrix models
> #6,-0.61658,0.63647,-0.4634,-116.37,0.17842,-0.46032,-0.86964,83.498,-0.76681,-0.61888,0.17027,-13.487
> view matrix models
> #6,-0.61658,0.63647,-0.4634,-122.93,0.17842,-0.46032,-0.86964,75.639,-0.76681,-0.61888,0.17027,-22.954
> undo
> undo
> view matrix models
> #6,-0.61658,0.63647,-0.4634,-165.33,0.17842,-0.46032,-0.86964,84.302,-0.76681,-0.61888,0.17027,-38.889
> undo
> select #9
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #10
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> view matrix models
> #10,0.6471,-0.74527,0.16071,-129.29,0.7212,0.53002,-0.44603,-44.922,0.24724,0.40454,0.88047,-138.64
> select #11
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #12
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #8
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #9/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> select #7/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> view matrix models
> #7,0.35397,0.62564,-0.69518,-58.027,0.54867,0.46305,0.69609,29.639,0.75741,-0.62782,-0.17937,-11.83
> undo
> ui mousemode right "translate selected atoms"
> select #4/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> ui mousemode right "translate selected atoms"
> select #7/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> select #6/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> select #8/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> select #10/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> select #6/B
554 atoms, 620 bonds, 28 residues, 1 model selected
connected
> select connected
554 atoms, 620 bonds, 28 residues, 1 model selected
> undo
> select #6/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> select #12
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> close #12
> select #11
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> close #11
> select #10
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> close #10
> select #4/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> select #2/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> select #5/A
588 atoms, 660 bonds, 28 residues, 1 model selected
> select #7
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> show sel surfaces
> select #6
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> show sel surfaces
> select #5
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> show sel surfaces
> select #4
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> show sel surfaces
> select #3
536287 atoms, 578185 bonds, 16876 residues, 1 model selected
> show #3 models
> hide #3 models
> select #4
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #7
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #8
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> show sel surfaces
> select #9
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> show sel surfaces
> show #3 models
> select clear
> set bgColor white
> graphics silhouettes true
> lighting soft
> lighting full
> lighting soft
> select
> ::name="A"::name="C"::name="DA"::name="DC"::name="DG"::name="DT"::name="T"
544281 atoms, 587145 bonds, 17268 residues, 8 models selected
> select clear
> set bgColor gray
> set bgColor white
> movie record
> turn y 2 180
> wait 180
> movie encode C:\Users\Chema\Desktop\movie2.mp4
Movie saved to \C:Users\\...\Desktop\movie2.mp4
> set bgColor black
> lighting full
> movie record
> turn y 2 180
> wait 180
> movie encode C:\Users\Chema\Desktop\movie3.mp4
Movie saved to \C:Users\\...\Desktop\movie3.mp4
> movie record
> turn y 2 180
> wait 180
> movie encode C:\Users\Chema\Desktop\movie4.mp4
Movie saved to \C:Users\\...\Desktop\movie4.mp4
> select #4
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> ~select #4.1
554 atoms, 1280 bonds, 28 residues, 3 models selected
> select #4.1
588 atoms, 28 residues, 1 model selected
> select #4.2
554 atoms, 28 residues, 1 model selected
> select #4
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #5
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #4
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #5
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> view #2,5-9 clip false
> select down
1142 atoms, 1280 bonds, 56 residues, 3 models selected
> undo
> ui mousemode right select
Drag select of custom built_A SES surface, 49277 of 90910 triangles, custom
built_A SES surface, 50973 of 90910 triangles, 651 atoms, 735 bonds
> select #2/B:27@P
27 atoms, 27 residues, 1 model selected
> select clear
> select #5/A:24@C8
1 atom, 1 residue, 1 model selected
> select #2/B:27@N4
14 atoms, 14 residues, 1 model selected
> select #5/A:14@C2'
1 atom, 1 residue, 1 model selected
> select #5/A:13@P
1 atom, 1 residue, 1 model selected
> select #2/B:27@C5
28 atoms, 28 residues, 1 model selected
> select #9/B:27@C4'
28 atoms, 28 residues, 1 model selected
Drag select of 10nm.pdb_ SES surface, 19892 of 775446 triangles, custom
built_B SES surface, 43223 of 87576 triangles, custom built_A SES surface,
15381 of 90910 triangles, custom built_B SES surface, 47409 of 87574
triangles, 782 atoms, 1333 bonds
> select clear
> select clear
> select #8/A:8@C5'
1 atom, 1 residue, 1 model selected
> select clear
> select #3/O
9672 atoms, 10439 bonds, 304 residues, 1 model selected
> select sequence GTGTGTGTGTGTGTGTGGGTAGTAGTAG
18660 atoms, 20316 bonds, 644 residues, 8 models selected
Drag select of 10nm.pdb_ SES surface, custom built_A SES surface, custom
built_B SES surface, custom built_A SES surface, custom built_B SES surface,
custom built_A SES surface, custom built_B SES surface, custom built_A SES
surface, custom built_B SES surface, custom built_A SES surface, custom
built_B SES surface, custom built_A SES surface, custom built_B SES surface,
custom built_A SES surface, custom built_B SES surface, 39167 atoms, 187916
bonds
> ui mousemode right translate
> ui mousemode right "translate selected atoms"
> ui mousemode right rotate
> ui mousemode right "rotate selected models"
> view matrix models
> #1,0.99505,-0.073762,-0.066648,-12.968,0.070995,0.99655,-0.042986,-4.0387,0.069588,0.038041,0.99685,3.5004,#2,-0.10749,0.25215,-0.9617,46.394,-0.99411,-0.040458,0.1005,-13.829,-0.013567,0.96684,0.25501,52.884,#4,0.9659,-0.20147,0.16262,-4.1027,0.22053,0.96926,-0.10906,-0.82243,-0.13565,0.14121,0.98064,-5.6031,#5,0.92647,0.37193,0.057669,-43.723,-0.23056,0.68194,-0.69412,24.935,-0.29749,0.62978,0.71755,-12.266,#6,-0.57558,0.70852,-0.40831,-141.02,0.16699,-0.38695,-0.90686,68.939,-0.80052,-0.59015,0.1044,-18.352,#7,0.26126,0.63023,-0.73113,-61.7,0.53935,0.53285,0.65205,36.865,0.80053,-0.56469,-0.2007,-15.216,#8,0.22872,0.97339,0.014,10.42,-0.78486,0.19289,-0.58888,76.998,-0.57592,0.1237,0.8081,45.366,#9,-0.85365,-0.46382,-0.23695,82.995,-0.11873,0.61626,-0.77854,36.491,0.50713,-0.63647,-0.58114,50.079
> view matrix models
> #1,-0.54471,-0.019118,0.83841,69.829,0.82456,-0.19453,0.53128,14.374,0.15294,0.98071,0.12173,-49.178,#2,0.14651,0.6241,0.76749,74.705,0.063434,0.76833,-0.6369,91.999,-0.98717,0.142,0.072981,-46.183,#4,-0.70494,0.14185,0.69493,56.983,0.65866,-0.23251,0.71561,15.676,0.26309,0.96219,0.070476,-46.921,#5,-0.76814,0.21623,0.60267,72.889,0.60468,0.55449,0.57176,-23.932,-0.21054,0.80361,-0.55667,-25.572,#6,-0.31046,-0.85676,0.4118,121.95,-0.9505,0.28556,-0.12247,-112.2,-0.012662,-0.42944,-0.90301,9.6714,#7,0.43172,-0.87601,0.21498,80.142,0.58753,0.092259,-0.80393,-41.9,0.68442,0.47338,0.55451,-15.636,#8,-0.52192,-0.50008,0.69103,81.653,-0.026816,0.81934,0.57269,44.519,-0.85257,0.28037,-0.44104,39.243,#9,0.92457,-0.28848,-0.24891,45.919,-0.36973,-0.83714,-0.40311,111.67,-0.092084,0.46473,-0.88065,5.4295
> ui mousemode right "move picked models"
> view matrix models
> #1,-0.54471,-0.019118,0.83841,69.698,0.82456,-0.19453,0.53128,20.912,0.15294,0.98071,0.12173,-44.845
> undo
> ui mousemode right "translate selected atoms"
> ui mousemode right "move picked models"
> ui mousemode right "rotate selected models"
> view matrix models
> #1,-0.071309,-0.40799,0.9102,53.21,0.98036,0.13956,0.13936,-20.343,-0.18388,0.90226,0.39002,-14.843,#2,0.447,0.85008,0.27849,95.393,-0.30712,0.43824,-0.84476,44.91,-0.84016,0.29208,0.45697,-19.446,#4,-0.31777,-0.29123,0.90233,42.787,0.9392,0.033864,0.34168,-13.15,-0.13007,0.95605,0.26276,-18.225,#5,-0.25396,0.21336,0.94339,29.289,0.77569,0.62756,0.066885,-47.219,-0.57776,0.74877,-0.32488,12.349,#6,-0.72678,-0.42088,0.54282,13.935,-0.68643,0.47348,-0.55193,-132.6,-0.024717,-0.77374,-0.63302,74.912,#7,0.4403,-0.80497,-0.39769,23.121,0.52914,0.59048,-0.60938,-62.612,0.72536,0.057879,0.68593,26.462,#8,-0.18018,-0.076067,0.98069,51.435,-0.062794,0.99586,0.065707,27.334,-0.98163,-0.049743,-0.18421,66.339,#9,0.58993,-0.79516,-0.14038,66.506,-0.73235,-0.45369,-0.50777,89.5,0.34007,0.40236,-0.84998,13.063
> view matrix models
> #1,-0.070357,-0.43773,0.89635,49.653,0.96229,0.20691,0.17658,-11.385,-0.26276,0.87498,0.40666,-13.609,#2,0.47556,0.8379,0.26788,91.626,-0.36878,0.46636,-0.80406,53.626,-0.79865,0.2836,0.53078,-21.992,#4,-0.31822,-0.32223,0.89157,39.308,0.92361,0.10668,0.3682,-4.5611,-0.21376,0.94063,0.26367,-17.878,#5,-0.23909,0.18575,0.95306,25.002,0.7259,0.68609,0.048384,-36.223,-0.6449,0.7034,-0.29888,14.84,#6,-0.72205,-0.39802,0.56589,8.0683,-0.69181,0.40794,-0.5958,-116.54,0.0062895,-0.82168,-0.56991,83.416,#7,0.41383,-0.80945,-0.41657,18.459,0.58789,0.587,-0.55661,-50.507,0.69508,-0.014549,0.71879,29.918,#8,-0.14795,-0.079539,0.98579,45.003,-0.14115,0.98826,0.058554,42.51,-0.97887,-0.13048,-0.15744,63.465,#9,0.58236,-0.80543,-0.11015,61.473,-0.6988,-0.42675,-0.57408,100.41,0.41538,0.4113,-0.81136,5.9627
> undo
> select clear
> set bgColor white
> movie record
> turn y 2 180
> wait 180
> movie encode C:\Users\Chema\Desktop\movie5.mp4
Movie saved to \C:Users\\...\Desktop\movie5.mp4
> save "C:/Users/Chema/Desktop/chimeraX/anillo/anillo y sus colasnanos.cxs"
> includeMaps true
> save "C:/Users/Chema/Desktop/chimeraX/anillo/anillo y sus colasnanos.cxs"
——— End of log from Thu Jun 9 14:38:24 2022 ———
opened ChimeraX session
> select #2
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #3
536287 atoms, 578185 bonds, 16876 residues, 1 model selected
> select #2
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #1
31173 atoms, 178956 bonds, 1 residue, 1 model selected
> ~select #1
1 model selected
> select #4
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #5
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #6
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> hide #6.1 models
> show #6.1 models
> hide #3 models
> select #2/A:2@O2
1 atom, 1 residue, 1 model selected
> select #9/B:27@O2
17 atoms, 17 residues, 1 model selected
> select #8
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #9
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> open C:/Users/Chema/Desktop/chimeraX/anillo/AuNPs_10nm_muchas_colas_2.pdb
Summary of feedback from opening
C:/Users/Chema/Desktop/chimeraX/anillo/AuNPs_10nm_muchas_colas_2.pdb
---
warning | Ignored bad PDB record found on line 135198
END
Chain information for AuNPs_10nm_muchas_colas_2.pdb
---
Chain | Description
10.2/A 10.3/A 10.4/A 10.5/A 10.6/A 10.7/A 10.8/A 10.9/A 10.10/A 10.11/A
10.12/A 10.13/A 10.14/A 10.15/A 10.16/A 10.17/A 10.18/A 10.19/A 10.20/A
10.21/A | No description available
> select #10
43093 atoms, 192196 bonds, 601 residues, 22 models selected
> ui mousemode right translate
> ui mousemode right "translate selected atoms"
> ui mousemode right rotate
> ui mousemode right "rotate selected models"
> view matrix models
> #10,0.87187,-0.44336,0.20803,-2.6659,0.41022,0.89317,0.18428,38.491,-0.26751,-0.075325,0.96061,-22.238
> view matrix models
> #10,0.93388,-0.33661,0.12065,-4.7844,0.30426,0.92529,0.22643,39.548,-0.18786,-0.17475,0.96653,-22.133
> view matrix models
> #10,0.8973,-0.40525,0.17503,-3.467,0.37089,0.90713,0.19891,38.851,-0.23938,-0.11357,0.96426,-22.154
> view matrix models
> #10,0.90022,-0.24583,0.35941,26.231,0.1768,0.96065,0.21424,33.413,-0.39793,-0.12932,0.90825,-37.577
> hide #10.1 models
> ui mousemode right select
> select #10.3/A:2
21 atoms, 23 bonds, 1 residue, 1 model selected
> select #10.3
596 atoms, 662 bonds, 30 residues, 1 model selected
> ui mousemode right "translate selected atoms"
> ui mousemode right "rotate selected models"
> view matrix models
> #10.3,0.9413,-0.16137,0.29651,3.1909,0.033465,0.91863,0.39371,25.895,-0.33592,-0.36067,0.8701,-71.7
> ui mousemode right "translate selected atoms"
> ui mousemode right select
> select #10.8/A:7
19 atoms, 20 bonds, 1 residue, 1 model selected
> select #10
43093 atoms, 192196 bonds, 601 residues, 22 models selected
> ~select #10
Nothing selected
> select #10.8/A:6
21 atoms, 23 bonds, 1 residue, 1 model selected
> select #10.8
596 atoms, 662 bonds, 30 residues, 1 model selected
> select clear
> select #10.8/A:17
20 atoms, 21 bonds, 1 residue, 1 model selected
> select #10.8
596 atoms, 662 bonds, 30 residues, 1 model selected
> ui mousemode right "translate selected atoms"
> ui mousemode right "rotate selected models"
> view matrix models
> #10.8,0.82209,0.41376,0.39111,45.439,-0.56195,0.70008,0.44056,27.465,-0.091522,-0.58197,0.80804,-34.07
> view matrix models
> #10.8,0.89015,0.39971,0.2188,22.14,-0.45564,0.78669,0.41654,32.196,-0.0056375,-0.47048,0.88239,-14.518
> view matrix models
> #10.8,0.78775,0.48417,0.38083,39.423,-0.56639,0.81237,0.13876,-26.911,-0.24219,-0.32501,0.91417,-33.41
> ui mousemode right select
> select #10.17/A:11
19 atoms, 20 bonds, 1 residue, 1 model selected
> select #10.17
596 atoms, 662 bonds, 30 residues, 1 model selected
> ui mousemode right "translate selected atoms"
> ui mousemode right "rotate selected models"
> view matrix models
> #10.17,0.97763,0.065532,0.19984,24.196,-0.12952,0.93625,0.32659,19.488,-0.1657,-0.34517,0.9238,-46.81
> view matrix models
> #10.17,0.96617,0.16579,0.19756,25.663,-0.22048,0.92838,0.29918,1.9365,-0.13381,-0.33262,0.93352,-40.301
> view matrix models
> #10.17,0.98736,0.14982,0.05175,9.8573,-0.15848,0.93893,0.30543,12.499,-0.0028293,-0.30977,0.95081,-17.448
> view matrix models
> #10.17,0.98564,0.16614,0.030045,7.418,-0.16722,0.93604,0.30963,11.607,0.023318,-0.31021,0.95038,-13.551
> ui mousemode right "translate selected atoms"
> ui mousemode right select
> select #10.13/A:25
20 atoms, 21 bonds, 1 residue, 1 model selected
> select #10.13
596 atoms, 662 bonds, 30 residues, 1 model selected
> ui mousemode right "translate selected atoms"
> ui mousemode right "rotate selected models"
> view matrix models
> #10.13,0.95462,0.22082,0.19984,5.2635,-0.14177,0.92704,-0.34714,-40.735,-0.26192,0.30305,0.91628,-42.432
> ui mousemode right select
> select #10.7/A:20
20 atoms, 21 bonds, 1 residue, 1 model selected
> select #10.7
596 atoms, 662 bonds, 30 residues, 1 model selected
> ui mousemode right "translate selected atoms"
> ui mousemode right select
> select #10.12/A:14
21 atoms, 23 bonds, 1 residue, 1 model selected
> select #10.12
596 atoms, 662 bonds, 30 residues, 1 model selected
> ui mousemode right "translate selected atoms"
> ui mousemode right "rotate selected models"
> view matrix models
> #10.12,0.97851,0.039819,0.20232,18.559,-0.016296,0.99304,-0.11663,-8.6079,-0.20555,0.11083,0.97235,12.647
> ui mousemode right "translate selected atoms"
> ui mousemode right select
> select #1/?:0@@serial_number=22604
1 atom, 1 residue, 1 model selected
> select #10.9/A:5
19 atoms, 20 bonds, 1 residue, 1 model selected
> select #10.9
596 atoms, 662 bonds, 30 residues, 1 model selected
> ui mousemode right "rotate selected models"
> view matrix models
> #10.9,0.95094,-0.061298,0.30323,31.272,0.067775,0.99764,-0.010874,-4.0796,-0.30185,0.030892,0.95286,9.0054
> ui mousemode right "translate selected atoms"
> ui mousemode right select
> select #10.6/A:7
19 atoms, 20 bonds, 1 residue, 1 model selected
> select #10.6
596 atoms, 662 bonds, 30 residues, 1 model selected
> ui mousemode right "translate selected atoms"
> ui mousemode right "rotate selected models"
> view matrix models
> #10.6,0.99988,0.01497,0.0045495,1.533,-0.014039,0.98677,-0.16152,-35.12,-0.0069073,0.16144,0.98686,3.1961
> view matrix models
> #10.6,0.98701,0.14853,0.061295,18.106,-0.12924,0.96051,-0.24639,-58.938,-0.095471,0.23526,0.96723,-1.8668
> view matrix models
> #10.6,0.98933,0.13471,-0.055525,-6.9262,-0.14241,0.97455,-0.17312,-43.532,0.030791,0.17918,0.98333,4.7558
> ui mousemode right select
> select #1/?:0@@serial_number=23352
1 atom, 1 residue, 1 model selected
> select #10.6
596 atoms, 662 bonds, 30 residues, 1 model selected
> select #1/?:0@@serial_number=24959
1 atom, 1 residue, 1 model selected
> select clear
> select #10.4/A:11
19 atoms, 20 bonds, 1 residue, 1 model selected
> select clear
> select #10.4/A:10
21 atoms, 23 bonds, 1 residue, 1 model selected
> select #10.4
596 atoms, 662 bonds, 30 residues, 1 model selected
> ui mousemode right select
> select #10.18/A:27
20 atoms, 21 bonds, 1 residue, 1 model selected
> select #10.4
596 atoms, 662 bonds, 30 residues, 1 model selected
> select #10.18/A:18
20 atoms, 21 bonds, 1 residue, 1 model selected
> select #10.18
596 atoms, 662 bonds, 30 residues, 1 model selected
> ui mousemode right "translate selected atoms"
> ui mousemode right "rotate selected models"
> view matrix models
> #10.18,0.92965,0.36214,0.067906,43.029,-0.36549,0.8831,0.2942,-26.45,0.046572,-0.29832,0.95333,-35.831
> view matrix models
> #10.18,0.99559,0.09293,-0.012509,9.8432,-0.092344,0.99487,0.041247,-6.393,0.016278,-0.03991,0.99907,-3.2848
> ui mousemode right "translate selected atoms"
> undo
> ui mousemode right select
> select #10.2/A:9
19 atoms, 20 bonds, 1 residue, 1 model selected
> select #10.2
596 atoms, 662 bonds, 30 residues, 1 model selected
> ui mousemode right "translate selected atoms"
> ui mousemode right "rotate selected models"
> view matrix models
> #10.2,0.97617,0.19625,-0.092576,-16.235,-0.21318,0.94702,-0.24024,-19.766,0.040523,0.25425,0.96629,-13.182
> ui mousemode right "translate selected atoms"
> ui mousemode right "rotate selected models"
> view matrix models
> #10.2,0.78702,0.32705,-0.52311,-58.893,-0.37187,0.92805,0.020736,1.3229,0.49226,0.17821,0.85201,-15.748
> view matrix models
> #10.2,0.75824,0.4073,-0.5091,-60.851,-0.46833,0.8835,0.0093214,1.0269,0.45359,0.23136,0.86066,-17.286
> ui mousemode right "translate selected atoms"
> ui mousemode right select
> select #10.15/A:11
19 atoms, 20 bonds, 1 residue, 1 model selected
> select #10.15
596 atoms, 662 bonds, 30 residues, 1 model selected
> ui mousemode right "translate selected atoms"
> ui mousemode right "rotate selected models"
> view matrix models
> #10.15,0.37721,0.10342,-0.92033,-126.18,-0.33843,0.94041,-0.033031,-16.298,0.86208,0.32393,0.38973,-36.191
> view matrix models
> #10.15,0.35356,0.27008,-0.89557,-102.42,-0.27893,0.94429,0.17466,14.471,0.89286,0.18805,0.4092,-49.793
> show #10.1 models
> select #10
43093 atoms, 192196 bonds, 601 residues, 22 models selected
> show sel surfaces
> hide #10.1 models
> select clear
> show #3 models
No model chosen to save relative to
> select #1
31173 atoms, 178956 bonds, 1 residue, 1 model selected
> ~select #1
1 model selected
> select #1
31173 atoms, 178956 bonds, 1 residue, 1 model selected
> select #2
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #1
31173 atoms, 178956 bonds, 1 residue, 1 model selected
> select clear
> save C:/Users/Chema/Desktop/chimeraX/anillo/anillo_nps_colas.pdb
> transparency 0
> select #1
31173 atoms, 178956 bonds, 1 residue, 1 model selected
> transparency sel 50
> undo
> select #10
43093 atoms, 192196 bonds, 601 residues, 22 models selected
> transparency sel 50
> select #4
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> transparency sel 50
> undo
> volume style surface
No volumes specified
> volume style surface
No volumes specified
> volume style surface
No volumes specified
> volume style surface
No volumes specified
> transparency (#!10.2-21 & sel) 0
> select #2
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> select #3
536287 atoms, 578185 bonds, 16876 residues, 1 model selected
> select #4
1142 atoms, 1280 bonds, 56 residues, 1 model selected
> transparency (#!4 & sel) 0
> volume step 1
No volumes specified
> select clear
> movie record
> turn y 2 180
> wait 180
> movie encode C:\Users\Chema\Desktop\movie6.mp4
Movie saved to \C:Users\\...\Desktop\movie6.mp4
> set bgColor black
> lighting full
> lighting soft
> lighting simple
> lighting soft
> lighting full
> lighting simple
> lighting soft
> lighting full
> lighting soft
> graphics silhouettes false
> graphics silhouettes true
> lighting full
> movie record
> turn y 2 180
> wait 180
> movie encode C:\Users\Chema\Desktop\movie7.mp4
Movie saved to \C:Users\\...\Desktop\movie7.mp4
> movie record
> turn y 2 180
> wait 180
> movie encode C:\Users\Chema\Desktop\movie8.mp4
Movie saved to \C:Users\\...\Desktop\movie8.mp4
> movie record
> turn y 2 180
> wait 180
> movie encode C:\Users\Chema\Desktop\movie9.mp4
Movie saved to \C:Users\\...\Desktop\movie9.mp4
> movie record
> turn y 2 180
> wait 180
> movie encode C:\Users\Chema\Desktop\movie10.mp4
Movie saved to \C:Users\\...\Desktop\movie10.mp4
> movie record
> turn y 2 180
> wait 180
> movie encode C:\Users\Chema\Desktop\movie11.mp4
Movie saved to \C:Users\\...\Desktop\movie11.mp4
> set bgColor white
> lighting simple
> lighting simple
> lighting soft
> lighting full
> lighting shadows false
> lighting shadows true
> lighting flat
> lighting shadows true intensity 0.5
> lighting shadows false
> lighting flat
> lighting full
> graphics silhouettes false
> graphics silhouettes true
> lighting shadows false
> lighting shadows true
> select #10
43093 atoms, 192196 bonds, 601 residues, 22 models selected
> select clear
> movie record
> turn y 2 180
> wait 180
> movie encode C:\Users\Chema\Desktop\movie12.mp4
Movie saved to \C:Users\\...\Desktop\movie12.mp4
> save C:/Users/Chema/Desktop/chimeraX/anillo/anillo_NPs_colas.cxs
——— End of log from Mon Jun 27 18:16:57 2022 ———
opened ChimeraX session
> ui mousemode right select
> select #3/I:4@O2P
9 atoms, 9 residues, 1 model selected
> ui mousemode right "select fragment"
> hide sel target a
> hide sel target a
> hide sel target a
> hide sel target a
> hide sel target a
> hide sel target a
> cartoon hide sel
> hide sel target a
> select clear
> hide sel target a
> hide sel target a
> hide sel target a
> hide sel target a
> select clear
> select clear
> ui mousemode right select
Drag select of 312 atoms
> hide sel target a
> select clear
Drag select of 64 atoms
> hide sel target a
Drag select of 1 atoms
> hide sel target a
Drag select of 148 atoms
> hide sel target a
Drag select of 345 atoms
> hide sel target a
Drag select of 16 atoms
> hide sel target a
Drag select of 12 atoms
> hide sel target a
Drag select of 1 atoms
> hide sel target a
> select #3/R:27@2H7
3 atoms, 3 residues, 1 model selected
> select #3/R:26@1H7
2 atoms, 2 residues, 1 model selected
> select #3/R:26@2H7
2 atoms, 2 residues, 1 model selected
> select add #3/R:27@2H7
5 atoms, 5 residues, 1 model selected
> select add #3/R:26@1H7
7 atoms, 5 residues, 1 model selected
> hide sel target a
Drag select of 377 atoms
> hide sel target a
Drag select of 310 atoms
> hide sel target a
Drag select of 41 atoms
> hide sel target a
Drag select of 24 atoms
> cartoon hide sel
> select add #3/V:36@O3'
31 atoms, 10 residues, 1 model selected
> hide sel target a
Drag select of 324 atoms
> hide sel target a
Drag select of 371 atoms
> hide sel target a
> select clear
Drag select of 6 atoms
> hide sel target a
> select clear
Drag select of 336 atoms
> hide sel target a
Drag select of 22 atoms
> hide sel target a
Drag select of 14 atoms
> select add #3/B:27@O1P
24 atoms, 12 residues, 1 model selected
> select add #3/B:27@2H5'
34 atoms, 12 residues, 1 model selected
> select add #3/B:27@P
44 atoms, 12 residues, 1 model selected
> hide sel target a
> select #3/B:26@H4'
10 atoms, 10 residues, 1 model selected
> select add #3/B:26@O3'
20 atoms, 10 residues, 1 model selected
> hide sel target a
Drag select of 323 atoms
> hide sel target a
Drag select of 2 atoms
Drag select of 52 atoms
> hide sel target a
> select clear
Drag select of 377 atoms
> hide sel target a
Drag select of 33 atoms
> select add #3/D:37@O2P
42 atoms, 11 residues, 1 model selected
> select clear
Drag select of 42 atoms
> hide sel target a
Drag select of custom built_A SES surface, 357 of 90910 triangles, 14 atoms
Drag select of 4 atoms
> select clear
Drag select of custom built_A SES surface, 8 of 90910 triangles, 5 atoms
> hide (#3 & sel) target a
> undo
> select clear
Drag select of 4 atoms
> hide sel target a
> hide #!1 models
> hide #!2 models
> hide #!4 models
> hide #!5 models
> hide #!6 models
> hide #!7 models
> hide #!8 models
> hide #!10 models
> hide #!9 models
Drag select of 22 atoms
> hide sel target a
Drag select of 1204 atoms
> hide sel target a
Drag select of 46 atoms
Drag select of 13 atoms
Drag select of 71 atoms
Drag select of 21 atoms
Drag select of 12 atoms
Drag select of 49 atoms
> select add #3/F:28@C5'
60 atoms, 13 residues, 1 model selected
> select add #3/F:27@C2'
70 atoms, 22 residues, 1 model selected
> select add #3/F:26@O2P
80 atoms, 31 residues, 1 model selected
> select add #3/F:26@O1P
90 atoms, 31 residues, 1 model selected
Drag select of 32 atoms
Drag select of 69 atoms
> hide sel target a
Drag select of 5 atoms
> hide sel target a
Drag select of 7 atoms
> hide sel target a
Drag select of 1 atoms
> hide sel target a
Drag select of 309 atoms
> hide sel target a
> select clear
Drag select of 212 atoms
> hide sel target a
Drag select of 86 atoms
> hide sel target a
Drag select of 35 atoms
> hide sel target a
Drag select of 17 atoms
> hide sel target a
Drag select of 267 atoms
> hide sel target a
Drag select of 108 atoms
> hide sel target a
Drag select of 247 atoms
> hide sel target a
Drag select of 101 atoms
> hide sel target a
> select #3/J:27@2H7
1 atom, 1 residue, 1 model selected
Drag select of 2 atoms
> hide sel target a
Drag select of 245 atoms
> hide sel target a
Drag select of 132 atoms
> surface hidePatches sel
> hide sel target a
Drag select of 960 atoms
> hide sel target a
Drag select of 1099 atoms
> hide sel target a
Drag select of 1 atoms
> hide sel target a
Drag select of 105 atoms
> hide sel target a
Drag select of 1083 atoms
> hide sel target a
Drag select of 38 atoms
> hide sel target a
Drag select of 1 atoms
> hide sel target a
> lighting full
> lighting soft
> lighting full
> movie record
> turn y 2 180
> wait 180
> movie encode C:\Users\Chema\Desktop\movie13.mp4
Movie saved to \C:Users\\...\Desktop\movie13.mp4
> ui mousemode right "select fragment"
> save "C:/Users/Chema/Desktop/chimeraX/anillo/anillo_sin colas.cxs"
——— End of log from Fri Jul 1 10:46:31 2022 ———
opened ChimeraX session
OpenGL version: 3.3.0 NVIDIA 516.59
OpenGL renderer: NVIDIA GeForce RTX 3070 Laptop GPU/PCIe/SSE2
OpenGL vendor: NVIDIA Corporation
Manufacturer: ASUSTeK COMPUTER INC.
Model: ASUS TUF Gaming A15 FA506QR_FA506QR
OS: Microsoft Windows 11 Pro (Build 22000)
Memory: 16,541,024,256
MaxProcessMemory: 137,438,953,344
CPU: 16 AMD Ryzen 7 5800H with Radeon Graphics
OSLanguage: es-ES
Locale: ('es_ES', 'cp1252')
PyQt5 5.15.2, Qt 5.15.2
Installed Packages:
alabaster: 0.7.12
appdirs: 1.4.4
Babel: 2.9.1
backcall: 0.2.0
blockdiag: 2.0.1
certifi: 2020.12.5
cftime: 1.4.1
chardet: 3.0.4
ChimeraX-AddCharge: 1.0
ChimeraX-AddH: 2.1.6
ChimeraX-AlignmentAlgorithms: 2.0
ChimeraX-AlignmentHdrs: 3.2
ChimeraX-AlignmentMatrices: 2.0
ChimeraX-Alignments: 2.1
ChimeraX-AmberInfo: 1.0
ChimeraX-Arrays: 1.0
ChimeraX-Atomic: 1.13.3
ChimeraX-AtomicLibrary: 3.1.2
ChimeraX-AtomSearch: 2.0
ChimeraX-AtomSearchLibrary: 1.0
ChimeraX-AxesPlanes: 2.0
ChimeraX-BasicActions: 1.1
ChimeraX-BILD: 1.0
ChimeraX-BlastProtein: 1.1
ChimeraX-BondRot: 2.0
ChimeraX-BugReporter: 1.0
ChimeraX-BuildStructure: 2.5.2
ChimeraX-Bumps: 1.0
ChimeraX-BundleBuilder: 1.1
ChimeraX-ButtonPanel: 1.0
ChimeraX-CageBuilder: 1.0
ChimeraX-CellPack: 1.0
ChimeraX-Centroids: 1.1
ChimeraX-ChemGroup: 2.0
ChimeraX-Clashes: 2.1
ChimeraX-Clipper: 0.16.0
ChimeraX-ColorActions: 1.0
ChimeraX-ColorGlobe: 1.0
ChimeraX-ColorKey: 1.2.1
ChimeraX-CommandLine: 1.1.4
ChimeraX-ConnectStructure: 2.0
ChimeraX-Contacts: 1.0
ChimeraX-Core: 1.2.1
ChimeraX-CoreFormats: 1.0
ChimeraX-coulombic: 1.1.1
ChimeraX-Crosslinks: 1.0
ChimeraX-Crystal: 1.0
ChimeraX-CrystalContacts: 1.0
ChimeraX-DataFormats: 1.1
ChimeraX-Dicom: 1.0
ChimeraX-DistMonitor: 1.1.2
ChimeraX-DistUI: 1.0
ChimeraX-Dssp: 2.0
ChimeraX-EMDB-SFF: 1.0
ChimeraX-ExperimentalCommands: 1.0
ChimeraX-FileHistory: 1.0
ChimeraX-FunctionKey: 1.0
ChimeraX-Geometry: 1.1
ChimeraX-gltf: 1.0
ChimeraX-Graphics: 1.0
ChimeraX-Hbonds: 2.1
ChimeraX-Help: 1.1
ChimeraX-HKCage: 1.3
ChimeraX-IHM: 1.0
ChimeraX-ImageFormats: 1.1
ChimeraX-IMOD: 1.0
ChimeraX-IO: 1.0.1
ChimeraX-ISOLDE: 1.2.2
ChimeraX-Label: 1.0
ChimeraX-ListInfo: 1.1.1
ChimeraX-Log: 1.1.2
ChimeraX-LookingGlass: 1.1
ChimeraX-Maestro: 1.8.1
ChimeraX-Map: 1.0.2
ChimeraX-MapData: 2.0
ChimeraX-MapEraser: 1.0
ChimeraX-MapFilter: 2.0
ChimeraX-MapFit: 2.0
ChimeraX-MapSeries: 2.0
ChimeraX-Markers: 1.0
ChimeraX-Mask: 1.0
ChimeraX-MatchMaker: 1.2
ChimeraX-MDcrds: 2.2
ChimeraX-MedicalToolbar: 1.0.1
ChimeraX-Meeting: 1.0
ChimeraX-MLP: 1.1
ChimeraX-mmCIF: 2.3
ChimeraX-MMTF: 2.1
ChimeraX-Modeller: 1.0.1
ChimeraX-ModelPanel: 1.0.1
ChimeraX-ModelSeries: 1.0
ChimeraX-Mol2: 2.0
ChimeraX-Morph: 1.0
ChimeraX-MouseModes: 1.1
ChimeraX-Movie: 1.0
ChimeraX-Neuron: 1.0
ChimeraX-Nucleotides: 2.0.1
ChimeraX-OpenCommand: 1.5
ChimeraX-PDB: 2.4.1
ChimeraX-PDBBio: 1.0
ChimeraX-PDBLibrary: 1.0
ChimeraX-PDBMatrices: 1.0
ChimeraX-PickBlobs: 1.0
ChimeraX-Positions: 1.0
ChimeraX-PresetMgr: 1.0.1
ChimeraX-PubChem: 2.0.1
ChimeraX-ReadPbonds: 1.0
ChimeraX-Registration: 1.1
ChimeraX-RemoteControl: 1.0
ChimeraX-ResidueFit: 1.0
ChimeraX-RestServer: 1.1
ChimeraX-RMF: 0.10
ChimeraX-RNALayout: 1.0
ChimeraX-RotamerLibMgr: 2.0
ChimeraX-RotamerLibsDunbrack: 2.0
ChimeraX-RotamerLibsDynameomics: 2.0
ChimeraX-RotamerLibsRichardson: 2.0
ChimeraX-SaveCommand: 1.4
ChimeraX-SchemeMgr: 1.0
ChimeraX-SDF: 2.0
ChimeraX-Segger: 1.0
ChimeraX-Segment: 1.0
ChimeraX-SeqView: 2.3
ChimeraX-Shape: 1.0.1
ChimeraX-Shell: 1.0
ChimeraX-Shortcuts: 1.0
ChimeraX-ShowAttr: 1.0
ChimeraX-ShowSequences: 1.0
ChimeraX-SideView: 1.0
ChimeraX-Smiles: 2.0.1
ChimeraX-SmoothLines: 1.0
ChimeraX-SpaceNavigator: 1.0
ChimeraX-StdCommands: 1.3.1
ChimeraX-STL: 1.0
ChimeraX-Storm: 1.0
ChimeraX-Struts: 1.0
ChimeraX-Surface: 1.0
ChimeraX-SwapAA: 2.0
ChimeraX-SwapRes: 2.1
ChimeraX-TapeMeasure: 1.0
ChimeraX-Test: 1.0
ChimeraX-Toolbar: 1.0.1
ChimeraX-ToolshedUtils: 1.2
ChimeraX-Tug: 1.0
ChimeraX-UI: 1.7.3
ChimeraX-uniprot: 2.1
ChimeraX-UnitCell: 1.0
ChimeraX-ViewDockX: 1.0
ChimeraX-Vive: 1.1
ChimeraX-VolumeMenu: 1.0
ChimeraX-VTK: 1.0
ChimeraX-WavefrontOBJ: 1.0
ChimeraX-WebCam: 1.0
ChimeraX-WebServices: 1.0
ChimeraX-Zone: 1.0
colorama: 0.4.3
comtypes: 1.1.7
cxservices: 1.0
cycler: 0.10.0
Cython: 0.29.21
decorator: 5.0.7
distlib: 0.3.1
docutils: 0.16
filelock: 3.0.12
funcparserlib: 0.3.6
grako: 3.16.5
h5py: 2.10.0
html2text: 2020.1.16
idna: 2.10
ihm: 0.17
imagecodecs: 2020.5.30
imagesize: 1.2.0
ipykernel: 5.3.4
ipython: 7.18.1
ipython-genutils: 0.2.0
jedi: 0.17.2
Jinja2: 2.11.2
jupyter-client: 6.1.7
jupyter-core: 4.7.1
kiwisolver: 1.3.1
line-profiler: 2.1.2
lxml: 4.6.2
lz4: 3.1.0
MarkupSafe: 1.1.1
matplotlib: 3.3.2
MolecularDynamicsViewer: 1.2
msgpack: 1.0.0
netCDF4: 1.5.4
networkx: 2.5
numexpr: 2.7.3
numpy: 1.19.2
numpydoc: 1.1.0
openvr: 1.14.1501
packaging: 20.9
ParmEd: 3.2.0
parso: 0.7.1
pickleshare: 0.7.5
Pillow: 7.2.0
pip: 21.0.1
pkginfo: 1.5.0.1
prompt-toolkit: 3.0.18
psutil: 5.7.2
pycollada: 0.7.1
pydicom: 2.0.0
Pygments: 2.7.1
PyOpenGL: 3.1.5
PyOpenGL-accelerate: 3.1.5
pyparsing: 2.4.7
PyQt5-commercial: 5.15.2
PyQt5-sip: 12.8.1
PyQtWebEngine-commercial: 5.15.2
python-dateutil: 2.8.1
pytz: 2021.1
pywin32: 228
pyzmq: 22.0.3
qtconsole: 4.7.7
QtPy: 1.9.0
RandomWords: 0.3.0
requests: 2.24.0
scipy: 1.5.2
Send2Trash: 1.5.0
SEQCROW: 1.4.2
setuptools: 50.3.2
sfftk-rw: 0.6.7.dev1
six: 1.15.0
snowballstemmer: 2.1.0
sortedcontainers: 2.2.2
Sphinx: 3.2.1
sphinxcontrib-applehelp: 1.0.2
sphinxcontrib-blockdiag: 2.0.0
sphinxcontrib-devhelp: 1.0.2
sphinxcontrib-htmlhelp: 1.0.3
sphinxcontrib-jsmath: 1.0.1
sphinxcontrib-qthelp: 1.0.3
sphinxcontrib-serializinghtml: 1.1.4
suds-jurko: 0.6
tables: 3.6.1
tifffile: 2020.9.3
tinyarray: 1.2.3
tornado: 6.1
traitlets: 5.0.5
urllib3: 1.25.11
wcwidth: 0.2.5
webcolors: 1.11.1
wheel: 0.36.0
wheel-filename: 1.3.0
WMI: 1.5.1
Change History (2)
comment:1 by , 3 years ago
| Cc: | added |
|---|---|
| Component: | Unassigned → Core |
| Owner: | set to |
| Platform: | → all |
| Project: | → ChimeraX |
| Status: | new → accepted |
| Summary: | ChimeraX bug report submission → Crash in event loop |
comment:2 by , 3 years ago
| Resolution: | → can't reproduce |
|---|---|
| Status: | accepted → closed |
Note:
See TracTickets
for help on using tickets.
