MatchMaker specific chain-chain pairing: wrapped C/C++ object of type ChainMenuButton has been deleted

[chimerax-bug-report@…]

The following bug report has been submitted:
Platform:        Darwin-20.2.0-x86_64-i386-64bit
ChimeraX Version: 1.1.1 (2020-10-07 08:32:49 UTC)
Description
(Describe the actions that caused this problem to occur here)

Log:
UCSF ChimeraX version: 1.1.1 (2020-10-07)  
© 2016-2020 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  

> open 6qil

Summary of feedback from opening 6qil fetched from pdb  
---  
notes | Fetching compressed mmCIF 6qil from
http://files.rcsb.org/download/6qil.cif  
Fetching CCD MN from http://ligand-expo.rcsb.org/reports/M/MN/MN.cif  
Fetching CCD MES from http://ligand-expo.rcsb.org/reports/M/MES/MES.cif  
  
6qil title:  
The complex structure of hsRosR-S1 (VNG0258H/RosR-S1) [more info...]  
  
Chain information for 6qil #1  
---  
Chain | Description  
A B C D | DNA binding protein  
E G | DNA (28-mer)  
F H | DNA (28-mer)  
  
Non-standard residues in 6qil #1  
---  
MES — 2-(N-morpholino)-ethanesulfonic acid  
MN — manganese (II) ion  
SO4 — sulfate ion  
  
6qil mmCIF Assemblies  
---  
1| software_defined_assembly  
2| software_defined_assembly  
  

> select /E:1-28

897 atoms, 966 bonds, 28 residues, 1 model selected  

> hide #1.1 models

> hide #1.2 models

> select /E:1-28

897 atoms, 966 bonds, 28 residues, 1 model selected  

> hide sel cartoons

> select #1

10943 atoms, 11137 bonds, 143 pseudobonds, 697 residues, 3 models selected  

> show sel cartoons

> show sel cartoons

> hide sel cartoons

> show sel cartoons

> style sel sphere

Changed 10943 atom styles  

> style sel sphere

Changed 10943 atom styles  

> style sel stick

Changed 10943 atom styles  

> hide sel atoms

> open 5dtd

Summary of feedback from opening 5dtd fetched from pdb  
---  
note | Fetching compressed mmCIF 5dtd from
http://files.rcsb.org/download/5dtd.cif  
  
5dtd title:  
Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)
[more info...]  
  
Chain information for 5dtd #2  
---  
Chain | Description  
A B | DNA-binding protein Fis  
C | DNA (27-mer)  
D | DNA (27-mer)  
  

> ui tool show Matchmaker

> matchmaker #2/A to #1/A pairing ss

Parameters  
---  
Chain pairing | ss  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker 6qil, chain A (#1) with 5dtd, chain A (#2), sequence alignment
score = 55.5  
RMSD between 10 pruned atom pairs is 1.599 angstroms; (across all 57 pairs:
9.672)  
  

> select /E:1-28

897 atoms, 966 bonds, 28 residues, 1 model selected  

> select /E:1-28

897 atoms, 966 bonds, 28 residues, 1 model selected  

> select /E:1-28

897 atoms, 966 bonds, 28 residues, 1 model selected  

> hide sel cartoons

> select /G:1-28

897 atoms, 966 bonds, 28 residues, 1 model selected  

> hide sel cartoons

> select /F:1-28

884 atoms, 953 bonds, 28 residues, 1 model selected  

> hide sel cartoons

> select /H:1-28

885 atoms, 954 bonds, 28 residues, 1 model selected  

> hide sel cartoons

> select #2/C:1-27

553 atoms, 619 bonds, 27 residues, 1 model selected  

> hide sel cartoons

> hide sel cartoons

> hide sel atoms

> select #2/D:1-27

548 atoms, 615 bonds, 27 residues, 1 model selected  

> hide sel cartoons

> hide sel atoms

> set bgColor white

> lighting soft

> ui tool show Matchmaker

> select #2/A:8-98

721 atoms, 727 bonds, 91 residues, 1 model selected  

> select #2/B:1-98

784 atoms, 791 bonds, 98 residues, 1 model selected  

> select #2/A:8-98

721 atoms, 727 bonds, 91 residues, 1 model selected  

> select #2/B:1-98

784 atoms, 791 bonds, 98 residues, 1 model selected  

> select /B:6-121

2551 atoms, 2569 bonds, 209 residues, 2 models selected  

> select /C:10-121

2132 atoms, 2186 bonds, 131 residues, 2 models selected  

> select /D:8-121

2201 atoms, 2260 bonds, 135 residues, 2 models selected  

> select /C:10-121

2132 atoms, 2186 bonds, 131 residues, 2 models selected  

> select /B:6-121

2551 atoms, 2569 bonds, 209 residues, 2 models selected  

> select /B:6-121

2551 atoms, 2569 bonds, 209 residues, 2 models selected  

> ui tool show Matchmaker

> matchmaker #2/C to #1/B pairing ss

Match chain (5dtd (#2) chain C) not compatible with BLOSUM-62 similarity
matrix  

> matchmaker #2/B to #1/C pairing ss

Parameters  
---  
Chain pairing | ss  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker 6qil, chain C (#1) with 5dtd, chain B (#2), sequence alignment
score = 49.9  
RMSD between 13 pruned atom pairs is 0.753 angstroms; (across all 49 pairs:
5.544)  
  
Traceback (most recent call last):  
File
"/Applications/ChimeraX-1.1.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.7/lib/python3.7/site-
packages/chimerax/core/triggerset.py", line 130, in invoke  
return self._func(self._name, data)  
File
"/Applications/ChimeraX-1.1.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.7/lib/python3.7/site-
packages/chimerax/ui/widgets/item_chooser.py", line 305, in _items_change  
if not hasattr(self, '_recursion'):  
RuntimeError: wrapped C/C++ object of type ChainMenuButton has been deleted  
  
Error processing trigger "changes":  
RuntimeError: wrapped C/C++ object of type ChainMenuButton has been deleted  
  
File
"/Applications/ChimeraX-1.1.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.7/lib/python3.7/site-
packages/chimerax/ui/widgets/item_chooser.py", line 305, in _items_change  
if not hasattr(self, '_recursion'):  
  
See log for complete Python traceback.  
  




OpenGL version: 4.1 Metal - 71.0.7
OpenGL renderer: Apple M1
OpenGL vendor: AppleHardware:

    Hardware Overview:

      Model Name: MacBook Pro
      Model Identifier: MacBookPro17,1
      Processor Name: Unknown
      Processor Speed: 2,4 GHz
      Number of Processors: 1
      Total Number of Cores: 8
      L2 Cache (per Core): 4 MB
      Memory: 16 GB

Software:

    System Software Overview:

      System Version: macOS 11.1 (20C69)
      Kernel Version: Darwin 20.2.0
      Time since boot: 4 days 6:17

Graphics/Displays:

    Apple M1:

      Chipset Model: Apple M1
      Type: GPU
      Bus: Built-In
      Total Number of Cores: 8
      Vendor: Apple (0x106b)
      Metal Family: Supported, Metal GPUFamily Apple 7
      Displays:
        Color LCD:
          Display Type: Built-In Retina LCD
          Resolution: 2560 x 1600 Retina
          Main Display: Yes
          Mirror: Off
          Online: Yes
          Automatically Adjust Brightness: No
          Connection Type: Internal
        HP x23LED:
          Resolution: 1920 x 1080 (1080p FHD - Full High Definition)
          UI Looks like: 1920 x 1080 @ 60.00Hz
          Mirror: Off
          Online: Yes
          Automatically Adjust Brightness: Yes

PyQt version: 5.12.3
Compiled Qt version: 5.12.4
Runtime Qt version: 5.12.9
Installed Packages:
    alabaster: 0.7.12
    appdirs: 1.4.4
    appnope: 0.1.0
    Babel: 2.8.0
    backcall: 0.2.0
    blockdiag: 2.0.1
    certifi: 2020.6.20
    chardet: 3.0.4
    ChimeraX-AddH: 2.1.3
    ChimeraX-AlignmentAlgorithms: 2.0
    ChimeraX-AlignmentHdrs: 3.2
    ChimeraX-AlignmentMatrices: 2.0
    ChimeraX-Alignments: 2.1
    ChimeraX-Arrays: 1.0
    ChimeraX-Atomic: 1.6.1
    ChimeraX-AtomSearch: 2.0
    ChimeraX-AxesPlanes: 2.0
    ChimeraX-BasicActions: 1.1
    ChimeraX-BILD: 1.0
    ChimeraX-BlastProtein: 1.0.1
    ChimeraX-BondRot: 2.0
    ChimeraX-BugReporter: 1.0
    ChimeraX-BuildStructure: 2.0
    ChimeraX-Bumps: 1.0
    ChimeraX-BundleBuilder: 1.0
    ChimeraX-ButtonPanel: 1.0
    ChimeraX-CageBuilder: 1.0
    ChimeraX-CellPack: 1.0
    ChimeraX-Centroids: 1.1
    ChimeraX-ChemGroup: 2.0
    ChimeraX-Clashes: 2.0
    ChimeraX-ColorActions: 1.0
    ChimeraX-ColorGlobe: 1.0
    ChimeraX-CommandLine: 1.1.3
    ChimeraX-ConnectStructure: 2.0
    ChimeraX-Contacts: 1.0
    ChimeraX-Core: 1.1.1
    ChimeraX-CoreFormats: 1.0
    ChimeraX-coulombic: 1.0.1
    ChimeraX-Crosslinks: 1.0
    ChimeraX-Crystal: 1.0
    ChimeraX-DataFormats: 1.0
    ChimeraX-Dicom: 1.0
    ChimeraX-DistMonitor: 1.1
    ChimeraX-DistUI: 1.0
    ChimeraX-Dssp: 2.0
    ChimeraX-EMDB-SFF: 1.0
    ChimeraX-ExperimentalCommands: 1.0
    ChimeraX-FileHistory: 1.0
    ChimeraX-FunctionKey: 1.0
    ChimeraX-Geometry: 1.1
    ChimeraX-gltf: 1.0
    ChimeraX-Graphics: 1.0
    ChimeraX-Hbonds: 2.0
    ChimeraX-Help: 1.0
    ChimeraX-HKCage: 1.3
    ChimeraX-IHM: 1.0
    ChimeraX-ImageFormats: 1.0
    ChimeraX-IMOD: 1.0
    ChimeraX-IO: 1.0
    ChimeraX-Label: 1.0
    ChimeraX-ListInfo: 1.0
    ChimeraX-Log: 1.1.1
    ChimeraX-LookingGlass: 1.1
    ChimeraX-Map: 1.0.1
    ChimeraX-MapData: 2.0
    ChimeraX-MapEraser: 1.0
    ChimeraX-MapFilter: 2.0
    ChimeraX-MapFit: 2.0
    ChimeraX-MapSeries: 2.0
    ChimeraX-Markers: 1.0
    ChimeraX-Mask: 1.0
    ChimeraX-MatchMaker: 1.1
    ChimeraX-MDcrds: 2.0
    ChimeraX-MedicalToolbar: 1.0.1
    ChimeraX-Meeting: 1.0
    ChimeraX-MLP: 1.0
    ChimeraX-mmCIF: 2.2
    ChimeraX-MMTF: 2.0
    ChimeraX-Modeller: 1.0
    ChimeraX-ModelPanel: 1.0
    ChimeraX-ModelSeries: 1.0
    ChimeraX-Mol2: 2.0
    ChimeraX-Morph: 1.0
    ChimeraX-MouseModes: 1.0
    ChimeraX-Movie: 1.0
    ChimeraX-Neuron: 1.0
    ChimeraX-Nucleotides: 2.0
    ChimeraX-OpenCommand: 1.2.1
    ChimeraX-PDB: 2.1
    ChimeraX-PDBBio: 1.0
    ChimeraX-PickBlobs: 1.0
    ChimeraX-Positions: 1.0
    ChimeraX-PresetMgr: 1.0
    ChimeraX-PubChem: 2.0
    ChimeraX-Read-Pbonds: 1.0
    ChimeraX-Registration: 1.1
    ChimeraX-RemoteControl: 1.0
    ChimeraX-ResidueFit: 1.0
    ChimeraX-RestServer: 1.0
    ChimeraX-RNALayout: 1.0
    ChimeraX-RotamerLibMgr: 2.0
    ChimeraX-RotamerLibsDunbrack: 2.0
    ChimeraX-RotamerLibsDynameomics: 2.0
    ChimeraX-RotamerLibsRichardson: 2.0
    ChimeraX-SaveCommand: 1.2
    ChimeraX-SchemeMgr: 1.0
    ChimeraX-SDF: 2.0
    ChimeraX-Segger: 1.0
    ChimeraX-Segment: 1.0
    ChimeraX-SeqView: 2.2
    ChimeraX-Shape: 1.0.1
    ChimeraX-Shell: 1.0
    ChimeraX-Shortcuts: 1.0
    ChimeraX-ShowAttr: 1.0
    ChimeraX-ShowSequences: 1.0
    ChimeraX-SideView: 1.0
    ChimeraX-Smiles: 2.0
    ChimeraX-SmoothLines: 1.0
    ChimeraX-SpaceNavigator: 1.0
    ChimeraX-StdCommands: 1.0.4
    ChimeraX-STL: 1.0
    ChimeraX-Storm: 1.0
    ChimeraX-Struts: 1.0
    ChimeraX-Surface: 1.0
    ChimeraX-SwapAA: 2.0
    ChimeraX-SwapRes: 2.0
    ChimeraX-TapeMeasure: 1.0
    ChimeraX-Test: 1.0
    ChimeraX-Toolbar: 1.0
    ChimeraX-ToolshedUtils: 1.0
    ChimeraX-Tug: 1.0
    ChimeraX-UI: 1.2.3
    ChimeraX-uniprot: 2.0
    ChimeraX-ViewDockX: 1.0
    ChimeraX-Vive: 1.1
    ChimeraX-VolumeMenu: 1.0
    ChimeraX-VTK: 1.0
    ChimeraX-WavefrontOBJ: 1.0
    ChimeraX-WebCam: 1.0
    ChimeraX-WebServices: 1.0
    ChimeraX-Zone: 1.0
    colorama: 0.4.3
    comtypes: 1.1.7
    cxservices: 1.0
    cycler: 0.10.0
    Cython: 0.29.20
    decorator: 4.4.2
    distlib: 0.3.1
    docutils: 0.16
    filelock: 3.0.12
    funcparserlib: 0.3.6
    grako: 3.16.5
    h5py: 2.10.0
    html2text: 2020.1.16
    idna: 2.10
    ihm: 0.16
    imagecodecs: 2020.5.30
    imagecodecs-lite: 2020.1.31
    imagesize: 1.2.0
    ipykernel: 5.3.0
    ipython: 7.15.0
    ipython-genutils: 0.2.0
    jedi: 0.17.2
    Jinja2: 2.11.2
    jupyter-client: 6.1.3
    jupyter-core: 4.6.3
    kiwisolver: 1.2.0
    line-profiler: 2.1.2
    lxml: 4.5.1
    MarkupSafe: 1.1.1
    matplotlib: 3.2.1
    msgpack: 1.0.0
    netifaces: 0.10.9
    networkx: 2.4
    numexpr: 2.7.1
    numpy: 1.18.5
    numpydoc: 1.0.0
    openvr: 1.12.501
    packaging: 20.4
    parso: 0.7.1
    pexpect: 4.8.0
    pickleshare: 0.7.5
    Pillow: 7.1.2
    pip: 20.2.2
    pkginfo: 1.5.0.1
    prompt-toolkit: 3.0.7
    psutil: 5.7.0
    ptyprocess: 0.6.0
    pycollada: 0.7.1
    pydicom: 2.0.0
    Pygments: 2.6.1
    PyOpenGL: 3.1.5
    PyOpenGL-accelerate: 3.1.5
    pyparsing: 2.4.7
    PyQt5-commercial: 5.12.3
    PyQt5-sip: 4.19.19
    PyQtWebEngine-commercial: 5.12.1
    python-dateutil: 2.8.1
    pytz: 2020.1
    pyzmq: 19.0.2
    qtconsole: 4.7.4
    QtPy: 1.9.0
    RandomWords: 0.3.0
    requests: 2.24.0
    scipy: 1.4.1
    setuptools: 49.4.0
    sfftk-rw: 0.6.6.dev0
    six: 1.15.0
    snowballstemmer: 2.0.0
    sortedcontainers: 2.2.2
    Sphinx: 3.1.1
    sphinxcontrib-applehelp: 1.0.2
    sphinxcontrib-blockdiag: 2.0.0
    sphinxcontrib-devhelp: 1.0.2
    sphinxcontrib-htmlhelp: 1.0.3
    sphinxcontrib-jsmath: 1.0.1
    sphinxcontrib-qthelp: 1.0.3
    sphinxcontrib-serializinghtml: 1.1.4
    suds-jurko: 0.6
    tables: 3.6.1
    tifffile: 2020.6.3
    tinyarray: 1.2.2
    tornado: 6.0.4
    traitlets: 5.0.4
    urllib3: 1.25.10
    wcwidth: 0.2.5
    webcolors: 1.11.1
    wheel: 0.34.2

[Eric Pettersen]

I believe this has already been fixed.