Opened 6 months ago
Closed 6 months ago
#17785 closed defect (fixed)
Combine into existing ID
| Reported by: | Owned by: | Eric Pettersen | |
|---|---|---|---|
| Priority: | normal | Milestone: | |
| Component: | Structure Editing | Version: | |
| Keywords: | Cc: | ||
| Blocked By: | Blocking: | ||
| Notify when closed: | Platform: | all | |
| Project: | ChimeraX |
Description
The following bug report has been submitted:
Platform: macOS-15.5-arm64-arm-64bit
ChimeraX Version: 1.9 (2024-12-11 19:11:19 UTC)
Description
Replace this text with list of actions that caused this problem to occur
Log:
UCSF ChimeraX version: 1.9 (2024-12-11)
© 2016-2024 Regents of the University of California. All rights reserved.
> open "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/_HT-KIF5B[1-560] on Tubulin.cxs"
Log from Fri May 23 18:50:52 2025UCSF ChimeraX version: 1.9 (2024-12-11)
© 2016-2024 Regents of the University of California. All rights reserved.
> open "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs" format
> session
Log from Fri May 23 18:38:32 2025UCSF ChimeraX version: 1.9 (2024-12-11)
© 2016-2024 Regents of the University of California. All rights reserved.
> open "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs" format
> session
Log from Fri May 23 17:49:00 2025UCSF ChimeraX version: 1.9 (2024-12-11)
© 2016-2024 Regents of the University of California. All rights reserved.
> open "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
Log from Fri May 23 16:10:45 2025UCSF ChimeraX version: 1.9 (2024-12-11)
© 2016-2024 Regents of the University of California. All rights reserved.
> open "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs" format
> session
Log from Fri May 23 15:23:39 2025UCSF ChimeraX version: 1.9 (2024-12-11)
© 2016-2024 Regents of the University of California. All rights reserved.
> open "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
Log from Wed Mar 12 17:10:07 2025UCSF ChimeraX version: 1.9 (2024-12-11)
© 2016-2024 Regents of the University of California. All rights reserved.
> open "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/HT-KIF560 on Tubulin.cxs" format session
Log from Wed Mar 12 16:11:25 2025UCSF ChimeraX version: 1.9 (2024-12-11)
© 2016-2024 Regents of the University of California. All rights reserved.
> open "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/Kinesin Q2PQA9.1.A on Tubulin.cxs" format session
Log from Wed Mar 12 14:42:57 2025UCSF ChimeraX version: 1.9 (2024-12-11)
© 2016-2024 Regents of the University of California. All rights reserved.
> open "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/Kinesin-Tubulin.cxs"
Log from Wed Mar 12 14:08:56 2025UCSF ChimeraX version: 1.9 (2024-12-11)
© 2016-2024 Regents of the University of California. All rights reserved.
> open "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/Kinesin-Tubulin.cxs" format session
Log from Mon Mar 10 18:49:05 2025 Startup Messages
---
warning | QCoreApplication::postEvent: Unexpected null receiver
note | available bundle cache has not been initialized yet
You can double click a model's Name or ID in the model panel to edit those
fields
UCSF ChimeraX version: 1.9 (2024-12-11)
© 2016-2024 Regents of the University of California. All rights reserved.
How to cite UCSF ChimeraX
> help help:quickstart
> open /Users/nukakola/Downloads/4hna.cif
Summary of feedback from opening /Users/nukakola/Downloads/4hna.cif
---
notes | Fetching CCD ADP from https://files.wwpdb.org/pub/pdb/refdata/chem_comp/P/ADP/ADP.cif
Fetching CCD ALF from
https://files.wwpdb.org/pub/pdb/refdata/chem_comp/F/ALF/ALF.cif
Fetching CCD GDP from
https://files.wwpdb.org/pub/pdb/refdata/chem_comp/P/GDP/GDP.cif
Fetching CCD GTP from
https://files.wwpdb.org/pub/pdb/refdata/chem_comp/P/GTP/GTP.cif
Fetching CCD MG from
https://files.wwpdb.org/pub/pdb/refdata/chem_comp/G/MG/MG.cif
4hna.cif title:
Kinesin motor domain in the ADP-MG-ALFX state in complex with tubulin and a
DARPIN [more info...]
Chain information for 4hna.cif #1
---
Chain | Description | UniProt
A | Tubulin alpha chain | D0VWZ0_SHEEP 1-451
B | Tubulin beta chain | D0VWY9_SHEEP 1-455
D | DESIGNED ANKYRIN REPEAT PROTEIN (DARPIN) D2 |
K | Kinesin-1 heavy chain | KINH_HUMAN 1-349
Non-standard residues in 4hna.cif #1
---
ADP — adenosine-5'-diphosphate
ALF — tetrafluoroaluminate ion
GDP — guanosine-5'-diphosphate
GTP — guanosine-5'-triphosphate
MG — magnesium ion
> hide atoms
> show atoms
> hide atoms
> show cartoons
> hide cartoons
> show cartoons
> style stick
Changed 10607 atom styles
> style sphere
Changed 10607 atom styles
> style ball
Changed 10607 atom styles
> hide atoms
> show atoms
> style sphere
Changed 10607 atom styles
> style stick
Changed 10607 atom styles
> hide cartoons
> style sphere
Changed 10607 atom styles
> style ball
Changed 10607 atom styles
> style stick
Changed 10607 atom styles
> hide atoms
> show cartoons
> select /D
1185 atoms, 1200 bonds, 159 residues, 1 model selected
> select /K
2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected
> select sequence 1-10
Nothing selected
> select /D
1185 atoms, 1200 bonds, 159 residues, 1 model selected
> coulombic sel
The following heavy (non-hydrogen) atoms are missing, which may result in
inaccurate electrostatics:
/D SER 12 OG
/D ASN 169 OXT
Using Amber 20 recommended default charges and atom types for standard
residues
Coulombic values for 4hna.cif_D SES surface #1.3: minimum, -19.96, mean -6.63,
maximum 8.31
To also show corresponding color key, enter the above coulombic command and
add key true
> rainbow sel
> color bfactor sel
1185 atoms, 159 residues, 1 surfaces, atom bfactor range 42.2 to 180
> color sel byhetero
> style sel ball
Changed 1185 atom styles
> style sel sphere
Changed 1185 atom styles
> style sel stick
Changed 1185 atom styles
> hide sel atoms
> show sel cartoons
> hide sel cartoons
> hide sel surfaces
> show sel cartoons
> show sel surfaces
> hide sel surfaces
> color sel bychain
> color #1 #919191ff
Cell requested for row 0 is out of bounds for table with 5 rows! Resizing
table model.
> select add #1
10607 atoms, 10809 bonds, 13 pseudobonds, 1363 residues, 5 models selected
> select subtract #1
1 model selected
> select add #1
10607 atoms, 10809 bonds, 13 pseudobonds, 1363 residues, 4 models selected
> select subtract #1.1
10607 atoms, 10809 bonds, 1 pseudobond, 1363 residues, 4 models selected
> select subtract #1.2
10607 atoms, 10809 bonds, 1363 residues, 2 models selected
> select subtract #1.3
9422 atoms, 9609 bonds, 1204 residues, 2 models selected
> select add #1
10607 atoms, 10809 bonds, 13 pseudobonds, 1363 residues, 4 models selected
> select subtract #1
1 model selected
> select add #1.1
12 pseudobonds, 1 model selected
> select subtract #1.1
Nothing selected
> select add #1.1
12 pseudobonds, 1 model selected
> select subtract #1.1
Nothing selected
> select add #1.1
12 pseudobonds, 1 model selected
> select subtract #1.1
Nothing selected
> select add #1.2
1 pseudobond, 2 models selected
> select subtract #1.2
Nothing selected
> select add #1.2
1 pseudobond, 2 models selected
> select subtract #1.2
Nothing selected
> select add #1.3
1185 atoms, 159 residues, 1 model selected
> select subtract #1.3
1 model selected
> select /D
1185 atoms, 1200 bonds, 159 residues, 1 model selected
> color #1.3 #8efa00ff
> color #1.3 #00f900ff
> color sel bynucleotide
Alignment identifier is 1/D
> hide #1.3 target m
> close #1.3
> lighting simple
> lighting soft
> lighting full
> lighting simple
> lighting soft
> ui tool show "Selection Inspector"
> select /D
1185 atoms, 1200 bonds, 159 residues, 1 model selected
> color sel forest green
> select /A
3382 atoms, 3458 bonds, 3 pseudobonds, 432 residues, 3 models selected
> color (#!1 & sel) lime
> select /B
3412 atoms, 3486 bonds, 3 pseudobonds, 434 residues, 2 models selected
> color (#!1 & sel) #009051ff
> select /A
3382 atoms, 3458 bonds, 3 pseudobonds, 432 residues, 3 models selected
> color (#!1 & sel) #00f900ff
> color (#!1 & sel) #8efa00ff
> color (#!1 & sel) #d4fb79ff
> color (#!1 & sel) #73fa79ff
> color (#!1 & sel) #fffc79ff
> color (#!1 & sel) #d4fb79ff
> color (#!1 & sel) #73fa79ff
> select /D
1185 atoms, 1200 bonds, 159 residues, 1 model selected
> color sel #d6d6d6ff
> color sel #ffffffff
> color sel #212121ff
> color sel #424242ff
> color sel #797979ff
> select /K
2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected
> color (#!1 & sel) #0096ffff
> select /A
3382 atoms, 3458 bonds, 3 pseudobonds, 432 residues, 3 models selected
> show sel surfaces
> hide sel cartoons
> hide sel atoms
> select /B
3412 atoms, 3486 bonds, 3 pseudobonds, 434 residues, 2 models selected
> show sel surfaces
> hide sel cartoons
> hide sel atoms
> select /D
1185 atoms, 1200 bonds, 159 residues, 1 model selected
> hide sel cartoons
> hide #!1.2 models
> close #1.2
> select /K:85-92
52 atoms, 51 bonds, 8 residues, 1 model selected
> color sel red
> save "/Users/nukakola/Desktop/_Analysis Local Copies/Kinesin-Tubulin.cxs"
> select /K
2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected
> show sel surfaces
> hide sel surfaces
> show sel atoms
> hide sel atoms
> select /K:85-92
52 atoms, 51 bonds, 8 residues, 1 model selected
> show sel surfaces
> hide sel surfaces
> show sel surfaces
> color (#!1 & sel) red
> select up
133 atoms, 135 bonds, 18 residues, 2 models selected
> select up
2593 atoms, 2632 bonds, 333 residues, 2 models selected
> select up
2628 atoms, 2665 bonds, 338 residues, 2 models selected
> select up
10607 atoms, 10809 bonds, 1363 residues, 2 models selected
> select up
10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected
> select down
10607 atoms, 10809 bonds, 1363 residues, 4 models selected
> select up
10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected
> select up
10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected
> select up
10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected
> select up
10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected
> select up
10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected
> select up
10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected
> select down
12 pseudobonds, 4 models selected
> select down
Nothing selected
> select /K
2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected
> show sel surfaces
> save "/Users/nukakola/Desktop/_Analysis Local Copies/Kinesin-Tubulin.cxs"
> hide sel surfaces
> ui tool show "Side View"
[Repeated 1 time(s)]
> graphics silhouettes true
> graphics silhouettes false
> graphics silhouettes true
> graphics silhouettes false
> volume style surface
No volumes specified
> volume style mesh
No volumes specified
> volume planes z style image imageMode "full region"
No volumes specified
> ui mousemode right select
> select /A:437@C
1 atom, 1 residue, 1 model selected
Drag select of 4hna.cif_A SES surface, 306 of 328216 triangles, 4hna.cif_B SES
surface, 822 of 322588 triangles
> ui mousemode right translate
> ui mousemode right select
> select sequence 1-10
Nothing selected
> ui tool show "Show Sequence Viewer"
> sequence chain /K
Alignment identifier is 1/K
> select
> /K:10-15,32-34,38-41,44-47,51-52,79-85,126-138,141-144,154-157,163-166,171-173,192-193,201-202,205-216,222-231,295-302
728 atoms, 731 bonds, 88 residues, 1 model selected
> select /K:19-24,57-76,90-96,106-122,175-188,237-242,245-271,276-292,305-324
1022 atoms, 1024 bonds, 134 residues, 1 model selected
> select
> /K:10-15,32-34,38-41,44-47,51-52,79-85,126-138,141-144,154-157,163-166,171-173,192-193,201-202,205-216,222-231,295-302
728 atoms, 731 bonds, 88 residues, 1 model selected
> select /K:19-24,57-76,90-96,106-122,175-188,237-242,245-271,276-292,305-324
1022 atoms, 1024 bonds, 134 residues, 1 model selected
> select /K:11
7 atoms, 6 bonds, 1 residue, 1 model selected
> select /K:19-24,57-76,90-96,106-122,175-188,237-242,245-271,276-292,305-324
1022 atoms, 1024 bonds, 134 residues, 1 model selected
> select clear
> select
> /K:10-15,32-34,38-41,44-47,51-52,79-85,126-138,141-144,154-157,163-166,171-173,192-193,201-202,205-216,222-231,295-302
728 atoms, 731 bonds, 88 residues, 1 model selected
> select /K:19-24,57-76,90-96,106-122,175-188,237-242,245-271,276-292,305-324
1022 atoms, 1024 bonds, 134 residues, 1 model selected
> select clear
[Repeated 2 time(s)]
> select /K:337
5 atoms, 4 bonds, 1 residue, 1 model selected
> select /K:337
5 atoms, 4 bonds, 1 residue, 1 model selected
> select /K:5-6
14 atoms, 13 bonds, 2 residues, 1 model selected
> select /K:5-6
14 atoms, 13 bonds, 2 residues, 1 model selected
> select /K:246:270
14 atoms, 12 bonds, 2 residues, 1 model selected
> select /K:246-270
177 atoms, 176 bonds, 25 residues, 1 model selected
> ui tool show "Selection Inspector"
> style sel ball
Changed 177 atom styles
> style sel sphere
Changed 177 atom styles
> style sel stick
Changed 177 atom styles
> show sel atoms
> style sel ball
Changed 177 atom styles
> style sel sphere
Changed 177 atom styles
> style sel stick
Changed 177 atom styles
> style sel ball
Changed 177 atom styles
> hide sel atoms
> select /K:1
Nothing selected
> select /K:12
8 atoms, 7 bonds, 1 residue, 1 model selected
> select /K:2
Nothing selected
> select /K:1-2
Nothing selected
> select /K:3
Nothing selected
> select /K:4
Nothing selected
> select /K:5
5 atoms, 4 bonds, 1 residue, 1 model selected
> style sel sphere
Changed 5 atom styles
> show sel cartoons
> hide sel atoms
> show sel atoms
> style sel ball
Changed 5 atom styles
> style sel sphere
Changed 5 atom styles
> style sel stick
Changed 5 atom styles
> style sel sphere
Changed 5 atom styles
> style sel ball
Changed 5 atom styles
> style sel sphere
Changed 5 atom styles
> color (#!1 & sel) hot pink
> hide sel cartoons
> show sel cartoons
> hide sel cartoons
> show sel atoms
> hide sel atoms
> show sel atoms
> hide sel cartoons
> show sel cartoons
> hide sel cartoons
> lighting simple
> lighting full
> lighting soft
Drag select of 4hna.cif_A SES surface, 22618 of 328216 triangles, 4hna.cif_B
SES surface, 18965 of 322588 triangles
Drag select of 4hna.cif_A SES surface, 2789 of 328216 triangles, 4hna.cif_B
SES surface, 9239 of 322588 triangles
> ui mousemode right translate
> ui tool show "Render/Select by Attribute"
> color byattribute a:charge #!1 target s palette
> -0.8188,blue:-0.0056,white:0.8076,red
3 surfaces, atom charge range -0.819 to 0.808
> select /K
2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected
> ui tool show "Render/Select by Attribute"
> color byattribute a:charge #!1 target cabs palette
> -0.8188,blue:-0.0056,white:0.8076,red
10607 atoms, 1363 residues, 3 surfaces, atom charge range -0.819 to 0.808
> show sel surfaces
> hide sel surfaces
> show sel cartoons
> hide sel cartoons
> show sel cartoons
> select /K:5
5 atoms, 4 bonds, 1 residue, 1 model selected
> hide sel cartoons
> undo
[Repeated 9 time(s)]
> select clear
[Repeated 1 time(s)]
> select /K:102
7 atoms, 7 bonds, 1 residue, 1 model selected
> select /K:97:105
12 atoms, 10 bonds, 2 residues, 1 model selected
> select /K:97-105
67 atoms, 68 bonds, 9 residues, 1 model selected
> select /K:97-106
71 atoms, 72 bonds, 10 residues, 1 model selected
> select /K:97-105
67 atoms, 68 bonds, 9 residues, 1 model selected
> color (#!1 & sel) yellow
> select /K:124
9 atoms, 8 bonds, 1 residue, 1 model selected
> select /K:123-125
25 atoms, 24 bonds, 3 residues, 1 model selected
> color (#!1 & sel) yellow
> select /K:5-6
14 atoms, 13 bonds, 2 residues, 1 model selected
> select clear
> select /K:5-16
99 atoms, 99 bonds, 12 residues, 1 model selected
> select clear
> select /K:5-8
28 atoms, 27 bonds, 4 residues, 1 model selected
> select /K:5-8
28 atoms, 27 bonds, 4 residues, 1 model selected
> select clear
> select /K:97-98
13 atoms, 12 bonds, 2 residues, 1 model selected
> select /K:97-105
67 atoms, 68 bonds, 9 residues, 1 model selected
> select /K:89
6 atoms, 5 bonds, 1 residue, 1 model selected
> select /K:86-89
28 atoms, 27 bonds, 4 residues, 1 model selected
> select /K:139
8 atoms, 7 bonds, 1 residue, 1 model selected
> select /K:139-140
16 atoms, 15 bonds, 2 residues, 1 model selected
> select /K:145-146
16 atoms, 15 bonds, 2 residues, 1 model selected
> select /K:145-150
46 atoms, 45 bonds, 6 residues, 1 model selected
> select /K:158-159
17 atoms, 16 bonds, 2 residues, 1 model selected
> select /K:158-162
43 atoms, 42 bonds, 5 residues, 1 model selected
> select /K:232
8 atoms, 7 bonds, 1 residue, 1 model selected
> select /K:232-236
32 atoms, 31 bonds, 5 residues, 1 model selected
> select /K:217
7 atoms, 6 bonds, 1 residue, 1 model selected
> select /K:217-221
41 atoms, 40 bonds, 5 residues, 1 model selected
> color (#!1 & sel) yellow
> select /K:219
7 atoms, 6 bonds, 1 residue, 1 model selected
> select clear
> select /K:221
9 atoms, 8 bonds, 1 residue, 1 model selected
> select /K:216
8 atoms, 7 bonds, 1 residue, 1 model selected
> select clear
> open /Users/nukakola/Downloads/Q2PQA9.1.A.pdb
Summary of feedback from opening /Users/nukakola/Downloads/Q2PQA9.1.A.pdb
---
warnings | Ignored bad PDB record found on line 2
REMARK File generated by Swiss-PdbViewer 3.70b19
Ignored bad PDB record found on line 3
REMARK http://www.expasy.org/spdbv/
Ignored bad PDB record found on line 4469
SPDBVf
Ignored bad PDB record found on line 4470
SPDBVa 0 1 2 3 4 5 6 7 8 9
Ignored bad PDB record found on line 4471
SPDBVa 10 11 12 13 14 15 16 17 18 19
59 messages similar to the above omitted
Duplicate atom serial number found: 1
Duplicate atom serial number found: 2
Duplicate atom serial number found: 3
Duplicate atom serial number found: 4
Duplicate atom serial number found: 5
4459 messages similar to the above omitted
Ignored bad PDB record found on line 12203
SPDBVf
Ignored bad PDB record found on line 12204
SPDBVa 0 1 2 3 4 5 6 7 8 9
Ignored bad PDB record found on line 12205
SPDBVa 10 11 12 13 14 15 16 17 18 19
Ignored bad PDB record found on line 12206
SPDBVa 20 21 22 23 24 25 26 27 28 29
Ignored bad PDB record found on line 12207
SPDBVa 30 31 32 33 34 35 36 37 38 39
94 messages similar to the above omitted
note | Combining 8 symmetry atoms into LEU /A:4 CD1
Chain information for Q2PQA9.1.A.pdb #2
---
Chain | Description
A | No description available
Computing secondary structure
> lighting soft
> ui tool show Matchmaker
> lighting full
> lighting soft
> select sequence 1-10
Nothing selected
> help help:user/findseq.html
> select #2/A:1-560
8908 atoms, 9016 bonds, 1120 residues, 1 model selected
> select #2/A:1-260
4109 atoms, 4175 bonds, 520 residues, 1 model selected
> select #2/A:1-300
4709 atoms, 4781 bonds, 600 residues, 1 model selected
> select #2/A:1-350
5515 atoms, 5599 bonds, 700 residues, 1 model selected
> select #2/A:1-330
5163 atoms, 5241 bonds, 660 residues, 1 model selected
> select #2/A:1-340
5329 atoms, 5411 bonds, 680 residues, 1 model selected
> select #2/A:1-340
5329 atoms, 5411 bonds, 680 residues, 1 model selected
> select #2/A:1-330
5163 atoms, 5241 bonds, 660 residues, 1 model selected
> align #2/A:1-330@ca toAtoms #1/K:1-330@ca
Unequal number of atoms to pair, 660 and 326
> align #2/A:1-330 toAtoms #1/K:1-330
Unequal number of atoms to pair, 5163 and 2551
> ui tool show Matchmaker
> matchmaker #2 to #1/K pairing bs
Computing secondary structure
[Repeated 1 time(s)] Parameters
---
Chain pairing | bs
Alignment algorithm | Needleman-Wunsch
Similarity matrix | BLOSUM-62
SS fraction | 0.3
Gap open (HH/SS/other) | 18/18/6
Gap extend | 1
SS matrix | | | H | S | O
---|---|---|---
H | 6 | -9 | -6
S | | 6 | -6
O | | | 4
Iteration cutoff | 2
Matchmaker 4hna.cif, chain K (#1) with Q2PQA9.1.A.pdb, chain A (#2), sequence
alignment score = 1336.7
RMSD between 296 pruned atom pairs is 0.661 angstroms; (across all 333 pairs:
2.327)
> select #2/A:416-5000
5575 atoms, 5608 bonds, 693 residues, 1 model selected
> hide sel cartoons
> select #2/A:1-420
6642 atoms, 6742 bonds, 840 residues, 1 model selected
> show sel cartoons
> color sel #0096ffff
> color sel #0096fff2
> color sel #0096ffec
> color sel #0096ffdc
> color sel #0096ffd6
> color sel #0096ffd2
> color sel #0096ffcf
> color sel #0096ffcc
> color sel #0096ffcb
> color sel #0096ffc9
> color sel #0096ffc8
[Repeated 1 time(s)]
> color sel #0096ffc7
[Repeated 1 time(s)]
> color sel #0096ffc6
[Repeated 1 time(s)]
> color sel #0096ffc5
> color sel #0096ffc4
[Repeated 2 time(s)]
> color sel #0096ffc3
[Repeated 1 time(s)]
> color sel #0096ffc1
> color sel #0096ffc0
> color sel #0096ffbe
> color sel #0096ffbb
> color sel #0096ffb9
> color sel #0096ffb6
> color sel #0096ffb0
> color sel #0096ffab
> color sel #0096ffa7
> color sel #0096ffa3
> color sel #0096ff9f
> color sel #0096ff9d
> color sel #0096ff9b
> color sel #0096ff99
> color sel #0096ff96
> color sel #0096ff95
> color sel #0096ff93
> color sel #0096ff91
> color sel #0096ff90
> color sel #0096ff8e
> color sel #0096ff8d
> color sel #0096ff8c
> color sel #0096ff8b
> color sel #0096ff8a
> color sel #0096ff88
> color sel #0096ff86
> color sel #0096ff84
> color sel #0096ff83
> color sel #0096ff81
> color sel #0096ff80
> color sel #0096ff76
> color sel #0096ff71
> color sel #0096ff69
> color sel #0096ff64
> color sel #0096ff62
> color sel #0096ff5e
> color sel #0096ff5c
> color sel #0096ff59
> color sel #0096ff56
> color sel #0096ff53
> color sel #0096ff51
> color sel #0096ff4e
> color sel #0096ff4b
> color sel #0096ff48
> color sel #0096ff47
> color sel #0096ff45
> color sel #0096ff44
> color sel #0096ff43
> color sel #0096ff41
> color sel #0096ff3e
> color sel #0096ff3b
> color sel #0096ff38
> color sel #0096ff35
> color sel #0096ff33
> color sel #0096ff31
> color sel #0096ff30
> color sel #0096ff2e
> color sel #0096ff2b
> color sel #0096ff29
> color sel #0096ff28
> color sel #0096ff27
[Repeated 1 time(s)]
> color sel #0096ff25
> color sel #0096ff24
[Repeated 1 time(s)]
> color sel #0096ff23
> color sel #0096ff22
[Repeated 1 time(s)]
> color sel #0096ff21
> color sel #0096ff20
> color sel #0096ff1f
> color sel #0096ff1d
> color sel #0096ff1c
> color sel #0096ff1a
> color sel #0096ff18
> color sel #0096ff16
> color sel #0096ff14
> color sel #0096ff12
> color sel #0096ff10
> color sel #0096ff0d
> color sel #0096ff0b
> color sel #0096ff08
> color sel #0096ff06
> color sel #0096ff03
> color sel #0096ff01
> color sel #0096ff00
> color sel #0096ff0b
> color sel #0096ff12
> color sel #0096ff19
> color sel #0096ff24
> color sel #0096ff29
> color sel #0096ff2f
> color sel #0096ff38
> color sel #0096ff3d
> color sel #0096ff44
> color sel #0096ff49
> color sel #0096ff4c
> color sel #0096ff4d
> color sel #0096ff4e
> color sel #0096ff4f
> color sel #0096ff50
[Repeated 1 time(s)]
> color sel #0096ff51
[Repeated 1 time(s)]
> color sel #0096ff52
> color sel #0096ff53
> color sel #73fdffff
[Repeated 1 time(s)]
> color sel #73fdfffa
> color sel #73fdfff2
> color sel #73fdffeb
> color sel #73fdffe6
> color sel #73fdffe1
> color sel #73fdffdd
> color sel #73fdffd9
> color sel #73fdffd6
> color sel #73fdffd3
> color sel #73fdffd1
> color sel #73fdffcf
> color sel #73fdffcc
> color sel #73fdffcb
> color sel #73fdffc7
> color sel #73fdffc4
> color sel #73fdffc1
> color sel #73fdffbd
> color sel #73fdffb9
> color sel #73fdffb5
> color sel #73fdffb3
> color sel #73fdffb0
> color sel #73fdffae
> color sel #73fdffac
> color sel #73fdffa9
> color sel #73fdffa7
> color sel #73fdffa4
> color sel #73fdffa2
> color sel #73fdffa0
> color sel #73fdff9c
> color sel #73fdff98
> color sel #73fdff93
> color sel #73fdff8f
> color sel #73fdff89
> color sel #73fdff84
> color sel #73fdff81
> color sel #73fdff7c
> color sel #73fdff78
> color sel #73fdff75
> color sel #73fdff71
> color sel #73fdff6e
> color sel #73fdff6b
> color sel #73fdff69
> color sel #73fdff67
> color sel #73fdff66
> color sel #73fdff65
> color sel #73fdff63
> color sel #73fdff61
> color sel #73fdff5f
> color sel #73fdff5d
> color sel #73fdff59
> color sel #73fdff56
> color sel #73fdff54
> color sel #73fdff53
> color sel #73fdff50
> color sel #73fdff4f
> color sel #73fdff4e
> color sel #73fdff4c
> color sel #73fdff4b
> color sel #73fdff4a
> color sel #73fdff49
> color sel #73fdff48
> color sel #73fdff47
> color sel #73fdff46
> color sel #73fdff45
> color sel #73fdff44
> color sel #73fdff43
> color sel #73fdff42
[Repeated 1 time(s)]
> color sel #73fdff40
> color sel #73fdff3f
[Repeated 1 time(s)]
> color sel #73fdff3e
[Repeated 2 time(s)]
> color sel #73fdff3d
[Repeated 1 time(s)]
> color sel #73fdff3c
> color sel #73fdff3b
> color sel #73fdff39
> color sel #73fdff38
> color sel #73fdff35
> color sel #73fdff31
> color sel #73fdff2c
> color sel #73fdff28
> color sel #73fdff25
> color sel #73fdff24
> color sel #73fdff23
> color sel #73fdff22
> color sel #73fdff20
> color sel #73fdff1e
> color sel #73fdff1b
> color sel #73fdff18
> color sel #73fdff16
> color sel #73fdff14
> color sel #73fdff12
> color sel #73fdff11
> color sel #73fdff10
> color sel #73fdff0f
> color sel #73fdff0e
> color sel #73fdff0c
> color sel #73fdff0a
> color sel #73fdff08
> color sel #73fdff07
> color sel #73fdff06
> color sel #73fdff05
> color sel #73fdff02
> color sel #73fdff00
> color sel #73fdff0c
> color sel #73fdff1b
> color sel #73fdff3a
> color sel #73fdff40
> color sel #73fdff42
> color sel #73fdff45
> color sel #73fdff49
> color sel #73fdff53
> color sel #73fdff5b
> color sel #73fdff66
> color sel #73fdff6e
> color sel #73fdff72
> color sel #73fdff75
[Repeated 2 time(s)]
> color sel #73fdff73
> color sel #73fdff6f
> color sel #73fdff6c
> color sel #73fdff68
> color sel #73fdff65
> color sel #73fdff62
> color sel #73fdff5e
> color sel #73fdff5a
> color sel #73fdff55
> color sel #73fdff51
> color sel #73fdff4c
> color sel #73fdff48
> color sel #73fdff44
> color sel #73fdff41
> color sel #73fdff40
[Repeated 4 time(s)]
> color sel #73fdff41
[Repeated 1 time(s)]
> color sel #73fdff42
> color sel #73fdff43
[Repeated 1 time(s)]
> color sel #73fdff44
> color sel #73fdff45
> color sel #73fdff46
> color sel #73fdff47
[Repeated 1 time(s)]
> color sel #73fdff48
[Repeated 2 time(s)]
> color sel #73fdff49
> save "/Users/nukakola/Desktop/_Analysis Local Copies/Kinesin-MT Binding Site
> Structure/Kinesin-Tubulin.cxs"
——— End of log from Mon Mar 10 18:49:05 2025 ———
opened ChimeraX session
> hide sel cartoons
> select
> #1/K:19-24,57-76,90-96,106-122,175-188,237-242,245-271,276-292,305-324
1022 atoms, 1024 bonds, 134 residues, 1 model selected
> select #1/k:96-222
1037 atoms, 1056 bonds, 127 residues, 1 model selected
> color sel deep sky blue
> color sel royal blue
> color sel dodger blue
> select #1/k:273:101
15 atoms, 13 bonds, 2 residues, 1 model selected
> style sel sphere
Changed 15 atom styles
> show sel atoms
> style sel stick
Changed 15 atom styles
> style sel ball
Changed 15 atom styles
> color sel lime
> select #1/k:28:53
18 atoms, 16 bonds, 2 residues, 1 model selected
> color sel yellow
> style sel ball
Changed 18 atom styles
> show sel atoms
> show sel cartoons
> select #1/k:220:74:41
25 atoms, 22 bonds, 3 residues, 1 model selected
> show sel atoms
> style sel ball
Changed 25 atom styles
> color sel tomato
> select #1/K:5@CB
1 atom, 1 residue, 1 model selected
> hide sel atoms
> show sel atoms
> style sel stick
Changed 1 atom style
> style sel stick
Changed 1 atom style
> style sel sphere
Changed 1 atom style
> hide sel cartoons
> show sel cartoons
> select #1/K:5@CA
1 atom, 1 residue, 1 model selected
> select #1/K:5@CB
1 atom, 1 residue, 1 model selected
> select #1/K:5@CA
1 atom, 1 residue, 1 model selected
> select #1/K:5@CB
1 atom, 1 residue, 1 model selected
> select ~sel & ##selected
10606 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 2 models selected
> select ~sel & ##selected
1 atom, 1 residue, 1 model selected
> select ~sel & ##selected
10606 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 2 models selected
> select ~sel & ##selected
1 atom, 1 residue, 1 model selected
> select up
5 atoms, 4 bonds, 1 residue, 2 models selected
> select down
1 atom, 1 residue, 2 models selected
> select up
5 atoms, 4 bonds, 1 residue, 2 models selected
> select up
36 atoms, 35 bonds, 5 residues, 2 models selected
> select up
2593 atoms, 2632 bonds, 333 residues, 2 models selected
> select down
36 atoms, 35 bonds, 5 residues, 2 models selected
> select down
5 atoms, 4 bonds, 1 residue, 2 models selected
> select down
1 atom, 1 residue, 2 models selected
> select down
1 atom, 1 residue, 2 models selected
> select up
5 atoms, 4 bonds, 1 residue, 2 models selected
> hide sel cartoons
> hide sel atoms
> show sel cartoons
> style sel ball
Changed 5 atom styles
> show sel atoms
> color sel purple
> rename #1 "4hna: KHC + TA/B"
> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/Kinesin-Tubulin.cxs"
——— End of log from Wed Mar 12 14:08:56 2025 ———
opened ChimeraX session
> select #1/K:73
7 atoms, 6 bonds, 1 residue, 1 model selected
> select up
78 atoms, 77 bonds, 10 residues, 2 models selected
> select up
2593 atoms, 2632 bonds, 333 residues, 2 models selected
> select up
2628 atoms, 2665 bonds, 338 residues, 2 models selected
> select up
10607 atoms, 10809 bonds, 1363 residues, 2 models selected
> select up
10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected
> select up
10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected
> select down
12 pseudobonds, 4 models selected
> select down
Nothing selected
> select #1/K:72
8 atoms, 7 bonds, 1 residue, 1 model selected
> select up
78 atoms, 77 bonds, 10 residues, 2 models selected
> select up
2593 atoms, 2632 bonds, 333 residues, 2 models selected
> hide sel
> hide sel target ca
> show sel target s
> hide sel target s
> select #2/A
12127 atoms, 12262 bonds, 1523 residues, 1 model selected
> show sel cartoons
> select color dodger blue
Expected an objects specifier or a keyword
> color dodger blue
> undo
> select ~sel & ##selected
Nothing selected
> select ~sel & ##selected
Nothing selected
> color sel dodger blue
> select #2/A:881
8 atoms, 7 bonds, 1 residue, 1 model selected
> select up
413 atoms, 414 bonds, 50 residues, 1 model selected
> select up
7670 atoms, 7753 bonds, 963 residues, 1 model selected
> color sel dodger blue
> color sel crimson
> color sel dodger blue
> color sel red
> color sel dodger blue
> ui tool show "Color Actions"
> color sel dodger blue
> color sel #747474ff
> color sel #747474d2
> color sel #747474d6
> color sel #747474eb
> color sel #747474f4
> color sel #747474fe
> color sel #747474ff
> color sel #744039ff
> color sel dodger blue
> lighting soft
> lighting simple
> lighting full
> lighting soft
> select clear
> select #2/A:443
12 atoms, 10 bonds, 2 residues, 1 model selected
> select up
2429 atoms, 2435 bonds, 301 residues, 1 model selected
> select up
12124 atoms, 12262 bonds, 1523 residues, 1 model selected
> color sel dodger blue
> select clear
> select #2/A:70
14 atoms, 12 bonds, 2 residues, 1 model selected
> select up
130 atoms, 128 bonds, 16 residues, 1 model selected
> select up
12124 atoms, 12262 bonds, 1523 residues, 1 model selected
> select clear
> select #2/A:122
16 atoms, 14 bonds, 2 residues, 1 model selected
> select clear
> toolshed show
> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/Kinesin Q2PQA9.1.A on Tubulin.cxs"
——— End of log from Wed Mar 12 14:42:57 2025 ———
opened ChimeraX session
> delete #2/A:
Missing or invalid "atoms" argument: only initial part "#2/A" of atom
specifier valid
> delete #2/:.A
Missing or invalid "atoms" argument: only initial part "#2" of atom specifier
valid
> delete :.A
Missing or invalid "atoms" argument: invalid atoms specifier
> select #2/A:114
16 atoms, 14 bonds, 2 residues, 1 model selected
> select up
210 atoms, 214 bonds, 24 residues, 1 model selected
> select up
12124 atoms, 12262 bonds, 1523 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select #2/A
3 atoms, 1 pseudobond, 2 residues, 2 models selected
> delete atoms (#!2 & sel)
> delete bonds (#!2 & sel)
> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/HT-KIF560 on Tubulin.cxs"
——— End of log from Wed Mar 12 16:11:25 2025 ———
opened ChimeraX session
> select /D
1185 atoms, 1200 bonds, 159 residues, 1 model selected
> delete atoms sel
> delete bonds sel
> select /K
2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected
> show sel cartoons
> select clear
> select /K:64
8 atoms, 7 bonds, 1 residue, 1 model selected
> select up
78 atoms, 78 bonds, 10 residues, 2 models selected
> select up
2593 atoms, 2632 bonds, 333 residues, 2 models selected
> color sel dodger blue
> select clear
> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/Kinesin on Tubulin Default.cxs"
> open "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/z_Original_Structures/HT-KIF560.cif"
Summary of feedback from opening /Users/nk/Desktop/_Analysis Local
Copies/_Structural Analysis of Kinesin HC and MTs/z_Original_Structures/HT-
KIF560.cif
---
warnings | Missing entity information. Treating each chain as a separate entity.
Atom H is not in the residue template for MET /A:1
Missing or incomplete sequence information. Inferred polymer connectivity.
Chain information for HT-KIF560.cif #2
---
Chain | Description
A | No description available
Color HT-KIF560.cif by residue attribute pLDDT_score
Computing secondary structure
> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/HT-KIF560 on Tubulin.cxs"
> align
Missing or invalid "atoms" argument: empty atom specifier
> select #1/K:128
11 atoms, 11 bonds, 1 residue, 1 model selected
> select #2/A:768
15 atoms, 14 bonds, 1 residue, 1 model selected
> align #2/A:1-315ca toAtoms #1/K:1-315@ca
Unequal number of atoms to pair, 0 and 311
> align #2/A:5-315ca toAtoms #1/K:5-315@ca
Unequal number of atoms to pair, 0 and 311
> select #1/K:5-315
2434 atoms, 2472 bonds, 311 residues, 1 model selected
> select #1/K:5-320
2474 atoms, 2513 bonds, 316 residues, 1 model selected
> select #1/K:324
7 atoms, 6 bonds, 1 residue, 1 model selected
> select #1/K:5-325
2514 atoms, 2553 bonds, 321 residues, 1 model selected
> select #2/A:5-325
5068 atoms, 5151 bonds, 321 residues, 1 model selected
> select sequence gagtgcaacatcaaagtgatgtgt
Nothing selected
> select sequence ECNIKVMC
125 atoms, 124 bonds, 8 residues, 1 model selected
> ui tool show "Show Sequence Viewer"
> sequence chain #2/A
Alignment identifier is 2/A
> select #1/K:321
11 atoms, 10 bonds, 1 residue, 1 model selected
> select sequence ECNIKVMC
125 atoms, 124 bonds, 8 residues, 1 model selected
> select #1/K:320
9 atoms, 8 bonds, 1 residue, 1 model selected
> ui tool show "Show Sequence Viewer"
> sequence chain #1/K
Alignment identifier is 1/K
> select
> #2/A:45-48,52-54,81-94,106-118,120-122,138-140,143-152,155-164,167-176,183-193,196-207,216-231,249-258,274-277,279-292,294-296,301-305,330-335,368-375,377-384,401-405,417-431,486-502,510-512,548-550,555-579,587-589,591-595,597-599,616-634,647-679,686-688,692-699,725-868
7368 atoms, 7399 bonds, 453 residues, 1 model selected
> select clear
> align #2/A:320-634@ca toAtoms #1/K:10-324@ca
RMSD between 315 atom pairs is 2.178 angstroms
> select #1/K
2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected
> hide sel cartoons
> select sequence EPTTEDLYFQSDN
198 atoms, 200 bonds, 13 residues, 1 model selected
> color sel yellow
> select A:1-297
Expected an objects specifier or a keyword
> select /A:1-297
6948 atoms, 7075 bonds, 587 residues, 2 models selected
> color sel hot pink
> undo
> select #2/A:1-297
4696 atoms, 4775 bonds, 297 residues, 1 model selected
> color sel salmon
> color sel indian red
> color sel coral
> color sel indian red
> color sel tomato
> color sel orange red
> color sel red
> color sel crimson
> color sel dark red
> color sel maroon
> color sel fire brick
> color sel crimson
> select clear
> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/HT-KIF560 on Tubulin.cxs"
> select #1/b:
Expected an objects specifier or a keyword
> select #1/B:
Expected an objects specifier or a keyword
> select #1/B
3412 atoms, 3486 bonds, 3 pseudobonds, 434 residues, 2 models selected
> hide sel surfaces
> turn z 30 center #2/A:646@ca atoms #2/A:647-
Invalid "atoms" argument: only initial part "#2/A:647" of atom specifier valid
> turn z 30 center #2/A:646@ca atoms #2/A:647
[Repeated 2 time(s)]
> undo
[Repeated 1 time(s)]
> turn z -30 center #2/A:646@ca atoms #2/A:647
[Repeated 3 time(s)]
> turn z 30 center #2/A:646@ca atoms #2/A:647
> turn z 30 center #2/A:646@ca atoms #2/A:5000
[Repeated 1 time(s)]
> select clear
[Repeated 1 time(s)]
> turn z 30 center #2/A:646@ca atoms #2/A:870
> turn z -30 center #2/A:646@ca atoms #2/A:870
> turn z -30 center #2/A:646@ca atoms #2/A:647-870
[Repeated 3 time(s)]
> turn z 30 center #2/A:646@ca atoms #2/A:647-870
[Repeated 3 time(s)]
> select #1/A
3382 atoms, 3458 bonds, 2 pseudobonds, 432 residues, 2 models selected
> select #1/B
3412 atoms, 3486 bonds, 3 pseudobonds, 434 residues, 2 models selected
> show sel surfaces
> select clear
> select #2/A:646
14 atoms, 13 bonds, 1 residue, 1 model selected
> turn z 30 center #2/A:646@ca atoms #2/A:647-870
[Repeated 7 time(s)]
> select clear
> select #2/A:717
19 atoms, 18 bonds, 1 residue, 1 model selected
> turn z 30 center #2/A:717@ca atoms #2/A:718-870
[Repeated 3 time(s)]
> turn z 330 center #2/A:717@ca atoms #2/A:718-870
> turn z -330 center #2/A:717@ca atoms #2/A:718-870
> turn z -30 center #2/A:717@ca atoms #2/A:718-870
[Repeated 7 time(s)]
> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/HT-KIF560 on Tubulin.cxs"
[Repeated 1 time(s)]
——— End of log from Wed Mar 12 17:10:07 2025 ———
opened ChimeraX session
> select #1/A:289@N
1 atom, 1 residue, 1 model selected
> select up
5 atoms, 4 bonds, 1 residue, 2 models selected
> select up
72 atoms, 72 bonds, 10 residues, 2 models selected
> select up
3061 atoms, 3130 bonds, 392 residues, 2 models selected
> select up
3127 atoms, 3197 bonds, 401 residues, 2 models selected
> select up
3349 atoms, 3424 bonds, 430 residues, 2 models selected
> select up
3382 atoms, 3458 bonds, 432 residues, 2 models selected
> select up
9422 atoms, 9609 bonds, 1204 residues, 2 models selected
> select up
9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 5 models selected
> select up
9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 5 models selected
> select down
12 pseudobonds, 4 models selected
> select up
9320 atoms, 12 pseudobonds, 1194 residues, 5 models selected
> select down
12 pseudobonds, 1 model selected
> ui tool show Toolbar
> hide surfaces
> show surfaces
> undo
[Repeated 9 time(s)]
> redo
[Repeated 9 time(s)]
> undo
[Repeated 1 time(s)]
> redo
[Repeated 2 time(s)]No redo action is available
> select #2/A:342@HD2
1 atom, 1 residue, 1 model selected
> select up
22 atoms, 21 bonds, 1 residue, 2 models selected
> select up
59 atoms, 59 bonds, 3 residues, 2 models selected
> select up
13791 atoms, 13929 bonds, 870 residues, 2 models selected
> select up
13791 atoms, 13929 bonds, 870 residues, 2 models selected
> select up
23213 atoms, 23538 bonds, 2074 residues, 3 models selected
> select down
13791 atoms, 13929 bonds, 870 residues, 5 models selected
> hide sel surfaces
> select #1/K:40@CG2
1 atom, 1 residue, 1 model selected
> select up
7 atoms, 6 bonds, 1 residue, 2 models selected
> select up
29 atoms, 28 bonds, 4 residues, 2 models selected
> select up
2593 atoms, 2632 bonds, 333 residues, 2 models selected
> hide sel surfaces
> select #1/A:348@CA
1 atom, 1 residue, 1 model selected
> hide #!2 models
> show #!2 models
> hide #!1 models
> show #!1 models
> hide #!1 models
> show #!1 models
> hide #1.1 models
> hide #1.2 models
> select subtract #1.3
1 model selected
> select add #1.3
3349 atoms, 430 residues, 1 model selected
> hide #1.3 models
> show #1.3 models
> hide #1.4 models
> show #1.4 models
> hide #2.1 models
> show #2.1 models
> hide #!2 models
> show #!2 models
> select #1.4/A
Nothing selected
> select #1.4/A:
Expected an objects specifier or a keyword
> select #1.4/A:
Expected an objects specifier or a keyword
> select #1/A:1-20
142 atoms, 142 bonds, 20 residues, 1 model selected
> select #1/A:2@NE
1 atom, 1 residue, 1 model selected
> select up
11 atoms, 10 bonds, 1 residue, 2 models selected
> select up
28 atoms, 27 bonds, 3 residues, 2 models selected
> select up
288 atoms, 294 bonds, 38 residues, 2 models selected
> select up
293 atoms, 298 bonds, 39 residues, 2 models selected
> select up
3349 atoms, 3424 bonds, 430 residues, 2 models selected
> select up
3382 atoms, 3458 bonds, 432 residues, 2 models selected
> select up
9422 atoms, 9609 bonds, 1204 residues, 2 models selected
> select down
3382 atoms, 3458 bonds, 432 residues, 4 models selected
> select down
3349 atoms, 3424 bonds, 430 residues, 2 models selected
> select clear
> select add #1.3
3349 atoms, 430 residues, 1 model selected
> hide sel surfaces
> show sel cartoons
> open
> /Users/nukakola/Downloads/fold_megfp_alpha_tubulin/fold_megfp_alpha_tubulin_model_0.cif
Chain information for fold_megfp_alpha_tubulin_model_0.cif #3
---
Chain | Description
A | .
Computing secondary structure
> select #3/A:681
4 atoms, 3 bonds, 1 residue, 1 model selected
> select #3/A:681
4 atoms, 3 bonds, 1 residue, 1 model selected
> select #3/A:292
8 atoms, 7 bonds, 1 residue, 1 model selected
> select #1/A:315
6 atoms, 5 bonds, 1 residue, 1 model selected
> select #1/B:342@CE2
1 atom, 1 residue, 1 model selected
> select clear
> select #1/A:435
7 atoms, 6 bonds, 1 residue, 1 model selected
> select #1/A:29
4 atoms, 3 bonds, 1 residue, 1 model selected
> select clear
> select #1/A:29
4 atoms, 3 bonds, 1 residue, 1 model selected
> select #1/A:81
4 atoms, 3 bonds, 1 residue, 1 model selected
> select #1/A:435
7 atoms, 6 bonds, 1 residue, 1 model selected
> align #3/A:249-261@ca toAtoms #1/A:3-435@ca
Unequal number of atoms to pair, 13 and 426
> select clear
> select #1/A:435
7 atoms, 6 bonds, 1 residue, 1 model selected
> select up
179 atoms, 180 bonds, 22 residues, 2 models selected
> select up
3061 atoms, 3130 bonds, 392 residues, 2 models selected
> select ~sel & ##selected
6361 atoms, 6479 bonds, 12 pseudobonds, 812 residues, 2 models selected
> select ~sel & ##selected
3061 atoms, 3130 bonds, 392 residues, 1 model selected
> select ~sel & ##selected
6361 atoms, 6479 bonds, 12 pseudobonds, 812 residues, 2 models selected
> select ~sel & ##selected
3061 atoms, 3130 bonds, 392 residues, 1 model selected
> select ~sel & ##selected
6361 atoms, 6479 bonds, 12 pseudobonds, 812 residues, 2 models selected
> align #3/A:291-681@ca toAtoms #1/A:45-435@ca
Unequal number of atoms to pair, 391 and 390
> align #3/A:292-681@ca toAtoms #1/A:45-435@ca
RMSD between 390 atom pairs is 3.899 angstroms
> align #3/A:291-680@ca toAtoms #1/A:45-435@ca
RMSD between 390 atom pairs is 1.166 angstroms
> hide #3 models
> select subtract #1.4
2983 atoms, 3027 bonds, 12 pseudobonds, 381 residues, 5 models selected
> select subtract #1.3
2695 atoms, 2733 bonds, 12 pseudobonds, 343 residues, 4 models selected
> select subtract #1.2
102 atoms, 101 bonds, 10 pseudobonds, 10 residues, 3 models selected
> select add #1.1
102 atoms, 101 bonds, 12 pseudobonds, 10 residues, 2 models selected
> show #1.1 models
> select subtract #1.1
102 atoms, 101 bonds, 10 residues, 1 model selected
> select add #1.1
102 atoms, 101 bonds, 12 pseudobonds, 10 residues, 2 models selected
> hide #!1 models
> hide #1.3 models
> hide #1.4 models
> hide #!2 models
> hide #2.1 models
> select subtract #1.1
102 atoms, 101 bonds, 10 residues, 1 model selected
> select add #1.1
102 atoms, 101 bonds, 12 pseudobonds, 10 residues, 2 models selected
> hide #1.1 models
> show #1.1 models
> hide #!1 models
> show #!1 models
> show #1.3 models
> hide #!1 models
> hide #1.3 models
> show #1.3 models
> hide #1.3 models
> hide #!1 models
> select add #1.2
2695 atoms, 101 bonds, 12 pseudobonds, 343 residues, 2 models selected
> show #1.2 models
> hide #!1 models
> hide #1.2 models
> hide #1.1 models
> show #1.3 models
> select subtract #1.1
2695 atoms, 101 bonds, 343 residues, 2 models selected
> select subtract #1.2
102 atoms, 101 bonds, 10 residues, 2 models selected
> select add #1.3
3451 atoms, 101 bonds, 440 residues, 1 model selected
> show sel surfaces
> hide sel surfaces
> show sel cartoons
> hide sel cartoons
> show sel atoms
> hide sel atoms
> show sel atoms
> select add #1.1
3451 atoms, 101 bonds, 12 pseudobonds, 440 residues, 3 models selected
> show #1.4 models
> hide #1.4 models
> select subtract #1.1
3451 atoms, 101 bonds, 440 residues, 2 models selected
> select subtract #1.3
102 atoms, 101 bonds, 10 residues, 2 models selected
> select add #1.2
2695 atoms, 101 bonds, 343 residues, 1 model selected
> select add #1.1
2695 atoms, 101 bonds, 12 pseudobonds, 343 residues, 3 models selected
> hide sel atoms
> show sel atoms
> select subtract #1.1
2695 atoms, 101 bonds, 343 residues, 2 models selected
> select add #1.1
2695 atoms, 101 bonds, 12 pseudobonds, 343 residues, 3 models selected
> select subtract #1.2
102 atoms, 101 bonds, 10 pseudobonds, 10 residues, 3 models selected
> select add #1.2
2695 atoms, 101 bonds, 10 pseudobonds, 343 residues, 2 models selected
> select subtract #1.2
102 atoms, 101 bonds, 10 pseudobonds, 10 residues, 3 models selected
> rename #1.1 "ADP and GTP"
> rename #1.1 "1xADP and 2xGDP"
> show #!2 models
> hide #!2 models
> show #!2 models
> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
> rename #1.2 "Kinesin from structure (hide)"
> rename #2.1 "HT-KIF560 from AF"
> rename #1.3 alpha-Tub
> rename #1.4 beta-Tub
> show #1.2 models
> select add #1.2
2695 atoms, 101 bonds, 10 pseudobonds, 343 residues, 2 models selected
> select add #1.1
2695 atoms, 101 bonds, 12 pseudobonds, 343 residues, 3 models selected
> hide #1.2 models
> select clear
> show #1.2 models
> hide #!1 models
> show #!1 models
> select add #1.2
2593 atoms, 333 residues, 1 model selected
> hide #1.2 models
> hide sel cartoons
> hide sel surfaces
> hide sel atoms
> hide sel cartoons
> select add #1.3
5942 atoms, 763 residues, 2 models selected
> select subtract #1.2
3349 atoms, 430 residues, 3 models selected
> select add #1.4
6727 atoms, 861 residues, 2 models selected
> show #1.4 models
> hide sel cartoons
> show sel surfaces
> hide sel cartoons
> hide sel atoms
> show #1.2 models
> select add #1.2
9320 atoms, 1194 residues, 3 models selected
> select subtract #1.3
5971 atoms, 764 residues, 4 models selected
> select subtract #1.4
2593 atoms, 333 residues, 3 models selected
> show sel cartoons
> hide #!2 models
> select add #1.1
2593 atoms, 12 pseudobonds, 333 residues, 3 models selected
> select subtract #1.2
10 pseudobonds, 2 models selected
> select #1/K:84
12 atoms, 12 bonds, 1 residue, 1 model selected
> select up
2 atoms, 1 bond, 1 residue, 1 model selected
> select up
27 atoms, 29 bonds, 1 residue, 1 model selected
> color #1.1 #ff9300ff models
> toolshed show
> view #1.1 clip false
No displayed objects specified.
> ui tool show "Color Actions"
> color sel orange
> color sel orange target acspfl
> select up
2628 atoms, 2665 bonds, 338 residues, 1 model selected
> select down
27 atoms, 29 bonds, 1 residue, 2 models selected
> select down
2 atoms, 1 bond, 1 residue, 1 model selected
> select up
27 atoms, 29 bonds, 1 residue, 1 model selected
> select up
2628 atoms, 2665 bonds, 338 residues, 1 model selected
> select down
27 atoms, 29 bonds, 1 residue, 2 models selected
> select #1/K:502@O
1 atom, 1 residue, 1 model selected
> select up
2628 atoms, 2665 bonds, 338 residues, 1 model selected
> select up
9422 atoms, 9609 bonds, 1204 residues, 2 models selected
> select up
9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 5 models selected
> select down
9422 atoms, 9609 bonds, 1204 residues, 4 models selected
> select down
2628 atoms, 2665 bonds, 338 residues, 4 models selected
> select subtract #1.2
35 atoms, 33 bonds, 5 residues, 2 models selected
> color sel orange target acspfl
> select clear
[Repeated 1 time(s)]
> select up
2 atoms, 1 bond, 1 residue, 1 model selected
> select up
5 atoms, 4 bonds, 1 residue, 1 model selected
> select up
3412 atoms, 3486 bonds, 434 residues, 1 model selected
> select down
5 atoms, 4 bonds, 1 residue, 2 models selected
> select up
2 atoms, 1 bond, 1 residue, 1 model selected
> select up
28 atoms, 30 bonds, 1 residue, 1 model selected
> select up
3412 atoms, 3486 bonds, 434 residues, 1 model selected
> select down
28 atoms, 30 bonds, 1 residue, 2 models selected
> select clear
> select add #1.3
3349 atoms, 430 residues, 1 model selected
> select add #1.4
6727 atoms, 861 residues, 2 models selected
> hide sel surfaces
Drag select of 34 atoms, 34 bonds
Drag select of 33 atoms, 34 bonds
> color sel red target acspfl
Drag select of 34 atoms, 34 bonds
> color sel red target acspfl
Cell requested for row 5 is out of bounds for table with 8 rows! Resizing
table model.
> show #!2 models
> hide #!2 models
> show #!2 models
> hide #!2 models
> show #!2 models
> hide #!2 models
> show #!2 models
> hide #!2 models
> show #!2 models
> hide #!2 models
> show #!2 models
> hide #!2 models
> show #!2 models
> hide #!2 models
> show #!2 models
> hide #!2 models
> show #!2 models
> hide #!2 models
> show #!2 models
> hide #!2 models
> show #!2 models
> hide #!2 models
> show #!2 models
> select clear
> select add #1.4
3378 atoms, 431 residues, 1 model selected
> select add #1.3
6727 atoms, 861 residues, 2 models selected
> show sel surfaces
> select clear
> rename #1.2 "K: Kinesin from structure (hide)"
> select #1.2
2593 atoms, 333 residues, 1 model selected
> select #1.2:1-20
Nothing selected
> select #1.2:50-100
Nothing selected
> select #1.2:50-100
Nothing selected
> hide #!2 models
> select #1/K:39
7 atoms, 6 bonds, 1 residue, 1 model selected
> select #1.2/K:50-100
Nothing selected
> select #1/K:50-100
397 atoms, 403 bonds, 51 residues, 1 model selected
> rename #1.3 "A: alpha-Tub"
> rename #1.4 "B: beta-Tub"
> select up
452 atoms, 460 bonds, 58 residues, 2 models selected
> select up
2593 atoms, 2632 bonds, 333 residues, 2 models selected
> hide sel cartoons
> show #!2 models
> hide #1.4 models
> show #1.4 models
> hide #1.3 models
> show #1.3 models
> hide #1.3 models
> show #1.3 models
> hide #1.3 models
> show #1.3 models
> hide #1.4 models
> show #1.4 models
> hide #1.4 models
> show #1.4 models
> hide #1.4 models
> show #1.4 models
> hide #!1 models
> show #!1 models
> hide #!1 models
> show #!1 models
> hide #!1 models
> show #!1 models
> show #1.1 models
> hide #!1 models
> show #!1 models
> hide #1.1 models
> show #1.1 models
> select add #1.1
2593 atoms, 2632 bonds, 12 pseudobonds, 333 residues, 3 models selected
> select subtract #1.2
10 pseudobonds, 2 models selected
> select add #1.1
12 pseudobonds, 1 model selected
> select subtract #1.1
Nothing selected
> show #3 models
> select add #1.3
3349 atoms, 430 residues, 1 model selected
> hide sel surfaces
> show sel cartoons
> hide #1.3 models
> show #1.3 models
> hide #1.4 models
> show #1.4 models
> hide #1.3 models
> show #1.3 models
> hide #1.3 models
> select clear
> show #1.3 models
> hide #1.3 models
> hide #1.3 ribbons
> hide #1.3 cartoons
> show #1.3 models
> select ~sel & ##selected
Nothing selected
> select ~sel & ##selected
Nothing selected
> hide #1.4
> hide #1.3
> show #1.4
> hide #1.3 ribbons
> hide #1.3 cartoons
> hide #1.3
> select #1.3
3349 atoms, 430 residues, 1 model selected
> hide selection
Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword
> selection hide
Unknown command: selection hide
> hide
> show
> undo
[Repeated 2 time(s)]
> select add #1.3
3349 atoms, 430 residues, 1 model selected
> hide sel cartoons
> show sel surfaces
> ui tool show "Show Sequence Viewer"
> sequence chain #1/A
Alignment identifier is 1/A
> ui tool show "Show Sequence Viewer"
Window position QRect(1985,916 575x191) outside any known screen, using
primary screen
> sequence chain #3/A
Alignment identifier is 3/A
> select #1/A:2-437
3341 atoms, 3416 bonds, 429 residues, 1 model selected
> align #3/A:291:682@ca toAtoms #1/A:46-437@ca
Unequal number of atoms to pair, 9 and 392
> align #3/A:291-682@ca toAtoms #1/A:46-437@ca
RMSD between 392 atom pairs is 1.173 angstroms
> select clear
> rename #3 "megfp_alpha_tubulin_model_0 from AF"
> show #2.1 models
> hide #2.1 models
> hide #!2 models
> show #!2 models
> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
> select #1/A:2-3
20 atoms, 19 bonds, 2 residues, 1 model selected
> select #1/A:2-15
103 atoms, 103 bonds, 14 residues, 1 model selected
> select sequence RECISIHV
130 atoms, 130 bonds, 16 residues, 2 models selected
> select #1/A:1-246
1867 atoms, 1905 bonds, 239 residues, 1 model selected
> select #3/A:1-246
1952 atoms, 1995 bonds, 246 residues, 1 model selected
> color sel lime target acspfl
> select #1/A
3382 atoms, 3458 bonds, 2 pseudobonds, 432 residues, 2 models selected
> color sel light gray target acspfl
> select #1/B
3412 atoms, 3486 bonds, 3 pseudobonds, 434 residues, 2 models selected
> color sel dark gray target acspfl
> color sel dim gray target acspfl
> color sel gray target acspfl
> select clear
> select #1/B:341@OG
1 atom, 1 residue, 1 model selected
> select up
6 atoms, 5 bonds, 1 residue, 2 models selected
> select #1/B
3412 atoms, 3486 bonds, 3 pseudobonds, 434 residues, 2 models selected
> color sel dim gray target acspfl
> select clear
> select up
2 atoms, 1 bond, 1 residue, 1 model selected
> select up
5 atoms, 4 bonds, 1 residue, 1 model selected
> select up
3412 atoms, 3486 bonds, 434 residues, 1 model selected
> select down
5 atoms, 4 bonds, 1 residue, 2 models selected
> select #1/B:69@OD2
1 atom, 1 residue, 1 model selected
> select #1/B:502@MG
1 atom, 1 residue, 1 model selected
> select up
3412 atoms, 3486 bonds, 434 residues, 1 model selected
> select down
1 atom, 1 residue, 2 models selected
> select down
1 atom, 1 residue, 1 model selected
> select up
3412 atoms, 3486 bonds, 434 residues, 1 model selected
> select up
9422 atoms, 9609 bonds, 1204 residues, 2 models selected
> select up
9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 5 models selected
> select up
9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 5 models selected
> select up
2 atoms, 1 bond, 1 residue, 1 model selected
> select up
5 atoms, 4 bonds, 1 residue, 1 model selected
> select up
3412 atoms, 3486 bonds, 434 residues, 1 model selected
> select up
2 atoms, 1 bond, 1 residue, 1 model selected
> select up
28 atoms, 30 bonds, 1 residue, 1 model selected
> color sel red target acspfl
> select up
2 atoms, 1 bond, 1 residue, 1 model selected
> select up
5 atoms, 4 bonds, 1 residue, 1 model selected
> color sel red target acspfl
> select clear
> select #3/A:247-696
3517 atoms, 3596 bonds, 450 residues, 1 model selected
> color sel light gray target acspfl
> split #3 atoms :1-246 atoms :247-696
Split megfp_alpha_tubulin_model_0 from AF (#3) into 2 models
Chain information for megfp_alpha_tubulin_model_0 from AF 1 #3.1
---
Chain | Description
A | No description available
Chain information for megfp_alpha_tubulin_model_0 from AF 2 #3.2
---
Chain | Description
A | No description available
> hide #1.3 models
> hide #3.2 models
> show #3.2 models
> hide #3.2 models
> show #3.2 models
> hide #3.1 models
> show #3.1 models
> undo
> redo
> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
——— End of log from Fri May 23 15:23:39 2025 ———
opened ChimeraX session
> select #1/B:345@CB
1 atom, 1 residue, 1 model selected
> select #3/B:681-700
Nothing selected
> select #3.1/A:681-700
Nothing selected
> select #3.1:681-700
Nothing selected
> select #3.2/A:681
4 atoms, 3 bonds, 1 residue, 1 model selected
> select #3.1/A:681-700
Nothing selected
> select #3.1/A:681-696
Nothing selected
> select #3.2/A:681
4 atoms, 3 bonds, 1 residue, 1 model selected
> select up
174 atoms, 175 bonds, 22 residues, 1 model selected
> select #3.2/A:682
7 atoms, 6 bonds, 1 residue, 1 model selected
> select up
116 atoms, 116 bonds, 15 residues, 1 model selected
> color sel magenta target acspfl
> select clear
> rename #3.1 mEGFP
> rename #3.2 alpha-Tubulin
> close #2.1
> hide #2 models
> show #2 models
> hide #3.1 models
> show #3.1 models
> hide #3.2 models
> show #3.2 models
> show #1.3 models
> hide #3.2 models
> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
> select clear
> select #2/A:311
17 atoms, 16 bonds, 1 residue, 1 model selected
> select #1/K:311-644
232 atoms, 230 bonds, 5 pseudobonds, 32 residues, 2 models selected
> select #2/A:311-644
5203 atoms, 5242 bonds, 334 residues, 1 model selected
> name motor_doman sel
> select motor_domain
Expected an objects specifier or a keyword
> color motor_domain red
Expected a color or one of 'byatom', 'bychain', 'byelement', 'byhetero',
'byidentity', 'bymodel', 'bynucleotide', 'bypolymer', 'fromatoms',
'fromcartoons', 'fromribbons', or 'random' or a keyword
> color motor_domain bychain red
Expected a color or one of 'byatom', 'bychain', 'byelement', 'byhetero',
'byidentity', 'bymodel', 'bynucleotide', 'bypolymer', 'fromatoms',
'fromcartoons', 'fromribbons', or 'random' or a keyword
> color bychain motor_domain red
Expected a collection of one of 'All', 'atoms', 'bonds', 'cartoons', 'labels',
'models', 'pseudobonds', 'ribbons', 'rings', or 'surfaces' or a keyword
> color bychain All motor_domain red
Expected ',' or a keyword
> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
——— End of log from Fri May 23 16:10:45 2025 ———
opened ChimeraX session
> select #2/A:295-310
235 atoms, 237 bonds, 16 residues, 1 model selected
> select #2/A:297-310
205 atoms, 207 bonds, 14 residues, 1 model selected
> select #2/A:298-310
198 atoms, 200 bonds, 13 residues, 1 model selected
> color sel white target acspfl
> rename #2 HT-KIF5B[1-560]
> select add #1.2
2791 atoms, 200 bonds, 346 residues, 2 models selected
> select subtract #1.2
198 atoms, 200 bonds, 13 residues, 2 models selected
> hide #1.2 models
> show #1.2 models
> select add #1.2
2791 atoms, 200 bonds, 346 residues, 2 models selected
> show sel cartoons
> hide sel cartoons
> show sel cartoons
> hide #1.2 models
> show #1.2 models
> hide #!1 models
> show #!1 models
> select subtract #1.2
198 atoms, 200 bonds, 13 residues, 2 models selected
> hide #1.2 models
> show #1.2 models
> hide #1.1 models
> show #1.1 models
> hide #1.3 models
> show #1.3 models
> hide #1.2 models
> show #1.2 models
> select add #1.2
2791 atoms, 200 bonds, 346 residues, 2 models selected
> hide sel surfaces
> hide sel cartoons
> hide sel atoms
> show sel cartoons
> show sel surfaces
> hide #1.2 models
> hide #1.1 models
> show #1.2 models
> hide #1.2 models
> show #1.2 models
> hide #1.2 models
> hide #!2 models
> show #1.2 models
> hide #1.2 models
> hide #1.4 models
> show #1.4 models
> hide #1.3 models
> show #3.2 models
> hide #3.2 models
> show #3.2 models
> show #1.3 models
> hide #1.3 models
> show #1.2 models
> hide #1.2 models
> select subtract #1.2
198 atoms, 200 bonds, 13 residues, 3 models selected
> select add #2
13791 atoms, 13929 bonds, 870 residues, 2 models selected
> select subtract #2
1 model selected
> show #!2 models
> show #1.2 models
> select add #1.2
2593 atoms, 333 residues, 1 model selected
> hide #1.2 models
> hide sel cartoons
> hide sel surfaces
> show #1.2 models
> hide #1.2 models
> select subtract #1.2
1 model selected
> select #2/A:307@O
1 atom, 1 residue, 1 model selected
> select up
17 atoms, 16 bonds, 1 residue, 2 models selected
> select up
132 atoms, 132 bonds, 9 residues, 2 models selected
> select up
13791 atoms, 13929 bonds, 870 residues, 2 models selected
> hide sel surfaces
> select clear
> hide #3.2 models
> show #1.3 models
> show #3.2 models
> hide #3.2 models
> show #3.2 models
> hide #3.2 models
> show #3.2 models
> hide #3.2 models
> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
> hide #!1 models
Cell requested for row 0 is out of bounds for table with 10 rows! Resizing
table model.
Cell requested for row 2 is out of bounds for table with 9 rows! Resizing
table model.
Cell requested for row 2 is out of bounds for table with 5 rows! Resizing
table model.
> hide #!3 models
> select #2/A:298-310
198 atoms, 200 bonds, 13 residues, 1 model selected
> select #2/A:311-464
2451 atoms, 2474 bonds, 154 residues, 1 model selected
> select #2/A:311-564
3991 atoms, 4024 bonds, 254 residues, 1 model selected
> select #2/A:311-644
5203 atoms, 5242 bonds, 334 residues, 1 model selected
> select #2/A:645-675
565 atoms, 569 bonds, 31 residues, 1 model selected
> select #2/A:645-678
627 atoms, 633 bonds, 34 residues, 1 model selected
> select #2/A:645-680
665 atoms, 671 bonds, 36 residues, 1 model selected
> color sel yellow target acspfl
> select #2/A:311-644
5203 atoms, 5242 bonds, 334 residues, 1 model selected
> color (#!2 & sel) #73ffffff
> color (#!2 & sel) #7370ffff
> color (#!2 & sel) #7370bbff
> select clear
> select #2/A:681-900
3029 atoms, 3037 bonds, 190 residues, 1 model selected
> select #2/A:681-870
3029 atoms, 3037 bonds, 190 residues, 1 model selected
> select #2/A:681-869
3006 atoms, 3014 bonds, 189 residues, 1 model selected
> select #2/A:681-870
3029 atoms, 3037 bonds, 190 residues, 1 model selected
> color sel gray target acspfl
> select clear
> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
> select
> #1/A:10-29,47-51,72-81,88-90,102-108,110-128,143-162,182-198,206-218,223-244,251-260,287-301,306-310,324-338,384-400,404-410,414-435
1798 atoms, 1819 bonds, 227 residues, 1 model selected
> ui tool show "Show Sequence Viewer"
> sequence chain #2/A
Alignment identifier is 2/A
> select
> #2/A:13-17,20-27,34-38,60-64,100-105,123-129,236-240,262-266,315-318,320-325,342-344,348-351,354-357,360-362,389-394,436-448,451-454,464-467,473-476,515-526,532-541,605-612,636-639
2289 atoms, 2296 bonds, 135 residues, 1 model selected
> select
> #2/A:45-48,52-54,81-94,106-118,120-122,138-140,143-152,155-164,167-176,183-193,196-207,216-231,249-258,274-277,279-292,294-296,301-305,330-335,368-375,377-384,401-405,417-431,486-502,510-512,548-550,555-579,587-589,591-595,597-599,616-634,647-679,686-688,692-699,725-868
7368 atoms, 7399 bonds, 453 residues, 1 model selected
> select
> #2/A:13-17,20-27,34-38,60-64,100-105,123-129,236-240,262-266,315-318,320-325,342-344,348-351,354-357,360-362,389-394,436-448,451-454,464-467,473-476,515-526,532-541,605-612,636-639
2289 atoms, 2296 bonds, 135 residues, 1 model selected
> select
> #2/A:45-48,52-54,81-94,106-118,120-122,138-140,143-152,155-164,167-176,183-193,196-207,216-231,249-258,274-277,279-292,294-296,301-305,330-335,368-375,377-384,401-405,417-431,486-502,510-512,548-550,555-579,587-589,591-595,597-599,616-634,647-679,686-688,692-699,725-868
7368 atoms, 7399 bonds, 453 residues, 1 model selected
> select clear
> select #2/A:645-900
3694 atoms, 3709 bonds, 226 residues, 1 model selected
> hide #2/A:645-900
> hide ribbons #2/A:645-900
Expected ',' or a keyword
> hide cartoons #2/A:645-900
Expected ',' or a keyword
> hide sel cartoons
> select #2/A:1-310
4894 atoms, 4976 bonds, 310 residues, 1 model selected
> hide sel cartoons
> select sequence RILQNNLQEVQKLLDYKDG
Nothing selected
> select sequnce RILQNNLQEVQKLL
Expected an objects specifier or a keyword
> select sequence RILQNNLQEVQKLL
Nothing selected
> select sequence QNNLQEVQKLL
Nothing selected
> select sequence QNNLQEV
Nothing selected
> select sequence LQEV
Nothing selected
> select sequence LQ
265 atoms, 255 bonds, 20 residues, 3 models selected
> select #2/A:611-631
312 atoms, 314 bonds, 21 residues, 1 model selected
> select #2/A:631-650
326 atoms, 327 bonds, 20 residues, 1 model selected
> color sel cyan target acspfl
> select #2/A
13791 atoms, 13929 bonds, 870 residues, 1 model selected
> show sel
> undo
> show sel cartoons
> select clear
> select #2/A:611-631
312 atoms, 314 bonds, 21 residues, 1 model selected
> select #2/A:631-650
326 atoms, 327 bonds, 20 residues, 1 model selected
> color sel yellow target acspfl
> select ~sel & ##selected
13465 atoms, 13602 bonds, 850 residues, 1 model selected
> select ~sel & ##selected
326 atoms, 327 bonds, 20 residues, 1 model selected
> select ~sel & ##selected
13465 atoms, 13602 bonds, 850 residues, 1 model selected
> select ~sel & ##selected
326 atoms, 327 bonds, 20 residues, 1 model selected
> select ~sel & ##selected
13465 atoms, 13602 bonds, 850 residues, 1 model selected
> select #2/A:631-633
56 atoms, 55 bonds, 3 residues, 1 model selected
> select #2/A:631-634
70 atoms, 69 bonds, 4 residues, 1 model selected
> color (#!2 & sel) #7370bbff
> select clear
> show #1.1 models
> hide #1.4 models
> hide #1.3 models
> show #!3 models
> hide #!3 models
> show #1.3 models
> show #1.4 models
> select helix
14048 atoms, 14141 bonds, 1297 residues, 4 models selected
> select helix6
Expected an objects specifier or a keyword
> dssp report true
> select add #1
18725 atoms, 18960 bonds, 12 pseudobonds, 1900 residues, 9 models selected
> select subtract #1
9303 atoms, 9351 bonds, 696 residues, 7 models selected
> select add #2
15726 atoms, 15881 bonds, 1113 residues, 4 models selected
> select add #3
19260 atoms, 19520 bonds, 1566 residues, 5 models selected
> select subtract #2
5469 atoms, 5591 bonds, 696 residues, 4 models selected
> select subtract #3
Nothing selected
> select add #1.2
2593 atoms, 333 residues, 1 model selected
> dssp report true
> show #1.2 models
> show sel cartoons
> dssp report true
> select
> #2/A:45-48,52-54,81-94,106-118,120-122,138-140,143-152,155-164,167-176,183-193,196-207,216-231,249-258,274-277,279-292,294-296,301-305,330-335,368-375,377-384,401-405,417-431,486-502,510-512,548-550,555-579,587-589,591-595,597-599,616-634,648-679,686-688,692-699,725-868
7358 atoms, 7389 bonds, 452 residues, 1 model selected
> dssp report true
> select add #1.2
9951 atoms, 7389 bonds, 785 residues, 3 models selected
> select subtract #1.2
7358 atoms, 7389 bonds, 452 residues, 3 models selected
> select add #1
16780 atoms, 16998 bonds, 12 pseudobonds, 1656 residues, 4 models selected
> select subtract #1
7358 atoms, 7389 bonds, 452 residues, 5 models selected
> select add #2
13791 atoms, 13929 bonds, 870 residues, 2 models selected
> select subtract #2
1 model selected
> select add #1.2
2593 atoms, 333 residues, 1 model selected
> hide sel cartoons
> list
Unknown command: list
> set bgColor white
> set bgColor #ffffff00
> set bgColor black
> set bgColor transparent
> select #1/B:437@CA
1 atom, 1 residue, 1 model selected
> select up
8 atoms, 7 bonds, 1 residue, 2 models selected
> select up
168 atoms, 170 bonds, 20 residues, 2 models selected
> select up
3378 atoms, 3452 bonds, 431 residues, 2 models selected
> color (#!1 & sel) #4bc76cff
[Repeated 1 time(s)]
> color (#!1 & sel) #45c769ff
> color (#!1 & sel) #3dc765ff
> color (#!1 & sel) #3cc764ff
> color (#!1 & sel) #38c763ff
> color (#!1 & sel) #32c763ff
> color (#!1 & sel) #2fc762ff
> color (#!1 & sel) #27c760ff
> color (#!1 & sel) #21c75fff
> color (#!1 & sel) #20c75fff
> color (#!1 & sel) #1dc75fff
> color (#!1 & sel) #1ac75fff
[Repeated 2 time(s)]
> color (#!1 & sel) #19c75fff
[Repeated 1 time(s)]
> color (#!1 & sel) #18c75fff
> color (#!1 & sel) #15c75dff
> color (#!1 & sel) #14c75cff
> color (#!1 & sel) #13c75aff
> color (#!1 & sel) #13c759ff
> color (#!1 & sel) #12c759ff
> color (#!1 & sel) #12c758ff
> color (#!1 & sel) #12c757ff
> color (#!1 & sel) #13c755ff
> color (#!1 & sel) #13c754ff
> color (#!1 & sel) #13c751ff
> color (#!1 & sel) #13c750ff
[Repeated 1 time(s)]
> color (#!1 & sel) #13c74fff
> color (#!1 & sel) #13c74eff
[Repeated 1 time(s)]
> color (#!1 & sel) #13c74dff
> color (#!1 & sel) #12c74cff
[Repeated 1 time(s)]
> color (#!1 & sel) #12c74bff
> color (#!1 & sel) #11c74aff
> color (#!1 & sel) #0fc747ff
> color (#!1 & sel) #0dc743ff
> color (#!1 & sel) #0bc73fff
> color (#!1 & sel) #0ac73dff
> color (#!1 & sel) #09c73cff
> color (#!1 & sel) #08c73aff
> color (#!1 & sel) #08c739ff
> color (#!1 & sel) #07c737ff
> color (#!1 & sel) #06c736ff
> color (#!1 & sel) #05c735ff
> color (#!1 & sel) #05c734ff
> color (#!1 & sel) #04c733ff
> color (#!1 & sel) #05c732ff
> color (#!1 & sel) #05c72eff
> color (#!1 & sel) #04c72dff
> color (#!1 & sel) #04c72cff
> color (#!1 & sel) #04c72fff
> color (#!1 & sel) #05c736ff
> color (#!1 & sel) #0bc745ff
> color (#!1 & sel) #0cc74bff
> color (#!1 & sel) #0ec752ff
> color (#!1 & sel) #0ec757ff
> color (#!1 & sel) #0dc75aff
> color (#!1 & sel) #0ac763ff
> color (#!1 & sel) #0ac767ff
> color (#!1 & sel) #0ac768ff
> color (#!1 & sel) #08c765ff
> color (#!1 & sel) #07c763ff
> color (#!1 & sel) #07c762ff
> color (#!1 & sel) #06c761ff
> color (#!1 & sel) #06c75fff
> color (#!1 & sel) #06c75eff
> color (#!1 & sel) #06c75aff
> color (#!1 & sel) #06c756ff
> color (#!1 & sel) #06c753ff
> color (#!1 & sel) #07c74cff
> color (#!1 & sel) #08c73fff
> color (#!1 & sel) #08c731ff
> color (#!1 & sel) #08c72aff
[Repeated 1 time(s)]
> color (#!1 & sel) #09c729ff
> color (#!1 & sel) #09c728ff
> color (#!1 & sel) #08c726ff
[Repeated 1 time(s)]
> color (#!1 & sel) #09c726ff
> color (#!1 & sel) #09c725ff
[Repeated 2 time(s)]
> color (#!1 & sel) #09c724ff
> color (#!1 & sel) #0ac724ff
[Repeated 1 time(s)]
> color (#!1 & sel) #0ac723ff
[Repeated 1 time(s)]
> color (#!1 & sel) #09c723ff
> color (#!1 & sel) #09c724ff
> color (#!1 & sel) #0bc72dff
> color (#!1 & sel) #0ec738ff
> color (#!1 & sel) #10c73eff
> color (#!1 & sel) #11c744ff
> color (#!1 & sel) #13c74bff
> color (#!1 & sel) #15c752ff
> color (#!1 & sel) #17c75aff
> color (#!1 & sel) #18c765ff
> color (#!1 & sel) #18c76cff
> color (#!1 & sel) #19c76eff
> color (#!1 & sel) #19c76fff
> color (#!1 & sel) #19c772ff
> color (#!1 & sel) #19c775ff
> color (#!1 & sel) #1ac77bff
> color (#!1 & sel) #1ac77cff
> color (#!1 & sel) #19c77cff
> color (#!1 & sel) #19c77bff
> color (#!1 & sel) #19c77aff
[Repeated 1 time(s)]
> color (#!1 & sel) #19c779ff
> color (#!1 & sel) #18c774ff
> color (#!1 & sel) #19c771ff
> color (#!1 & sel) #19c769ff
> color (#!1 & sel) #19c760ff
> color (#!1 & sel) #18c759ff
> color (#!1 & sel) #17c755ff
> color (#!1 & sel) #16c751ff
> color (#!1 & sel) #14c74dff
> color (#!1 & sel) #14c74cff
> color (#!1 & sel) #13c74bff
[Repeated 1 time(s)]
> color (#!1 & sel) #12c74bff
[Repeated 2 time(s)]
> color (#!1 & sel) #11c74bff
> color (#!1 & sel) #10c74bff
> color (#!1 & sel) #0fc74cff
> color (#!1 & sel) #0fc74dff
> color (#!1 & sel) #0fc74fff
> color (#!1 & sel) #0fc751ff
> color (#!1 & sel) #0fc753ff
> color (#!1 & sel) #0fc755ff
[Repeated 1 time(s)]
> color (#!1 & sel) #0fc756ff
> color (#!1 & sel) #10c757ff
> color (#!1 & sel) #0fc758ff
> color (#!1 & sel) #10c759ff
> color (#!1 & sel) #11c75bff
> color (#!1 & sel) #12c75eff
> color (#!1 & sel) #13c761ff
> color (#!1 & sel) #13c763ff
> color (#!1 & sel) #14c765ff
> color (#!1 & sel) #15c767ff
> color (#!1 & sel) #16c769ff
> color (#!1 & sel) #16c76aff
[Repeated 1 time(s)]
> color (#!1 & sel) #15c769ff
> color (#!1 & sel) #13c769ff
> color (#!1 & sel) #13c768ff
> color (#!1 & sel) #12c767ff
> color (#!1 & sel) #11c767ff
> color (#!1 & sel) #0fc767ff
> color (#!1 & sel) #0dc766ff
[Repeated 1 time(s)]
> color (#!1 & sel) #0cc765ff
> color (#!1 & sel) #0bc765ff
[Repeated 2 time(s)]
> color (#!1 & sel) #0ab75dff
> color (#!1 & sel) #09ab57ff
> color (#!1 & sel) #09a554ff
> color (#!1 & sel) #089e50ff
> color (#!1 & sel) #08914aff
> color (#!1 & sel) #078a46ff
> color (#!1 & sel) #078745ff
> color (#!1 & sel) #078644ff
> color (#!1 & sel) #078041ff
> color (#!1 & sel) #06773dff
> color (#!1 & sel) #06763cff
> color (#!1 & sel) #06753cff
> color (#!1 & sel) #06743bff
> color (#!1 & sel) #06733bff
> color (#!1 & sel) #06733aff
> color (#!1 & sel) #067039ff
> color (#!1 & sel) #066c37ff
> color (#!1 & sel) #066936ff
> color (#!1 & sel) #066734ff
> color (#!1 & sel) #056634ff
[Repeated 1 time(s)]
> color (#!1 & sel) #066835ff
> color (#!1 & sel) #066b37ff
> color (#!1 & sel) #067039ff
> color (#!1 & sel) #06743bff
> color (#!1 & sel) #06773cff
> color (#!1 & sel) #06773dff
> color (#!1 & sel) #06763cff
> color (#!1 & sel) #06753cff
> color (#!1 & sel) #06743bff
> color (#!1 & sel) #06733aff
> color (#!1 & sel) #06713aff
> color (#!1 & sel) #067039ff
[Repeated 1 time(s)]
> color (#!1 & sel) #066f39ff
[Repeated 1 time(s)]
> color (#!1 & sel) #be6f39ff
[Repeated 1 time(s)]
> color (#!1 & sel) #bedc39ff
[Repeated 1 time(s)]
> color (#!1 & sel) #bedcbeff
[Repeated 1 time(s)]
> color (#!1 & sel) #bedbbeff
> color (#!1 & sel) #bed8beff
> color (#!1 & sel) #bed3beff
> color (#!1 & sel) #becdbeff
> color (#!1 & sel) #bec7beff
> color (#!1 & sel) #bec5beff
> color (#!1 & sel) #bec3beff
> color (#!1 & sel) #bec0beff
> color (#!1 & sel) #bebcbeff
> color (#!1 & sel) #bebabeff
[Repeated 1 time(s)]
> color (#!1 & sel) #bebbbeff
> color (#!1 & sel) #bec0beff
> color (#!1 & sel) #bec3beff
> color (#!1 & sel) #becabeff
> color (#!1 & sel) #becdbeff
> color (#!1 & sel) #bed4beff
> color (#!1 & sel) #bed5beff
> color (#!1 & sel) #bed7beff
> color (#!1 & sel) #bed8beff
> color (#!1 & sel) #bedabeff
> color (#!1 & sel) #bedcbeff
> color (#!1 & sel) #bedfbeff
> color (#!1 & sel) #bee1beff
> color (#!1 & sel) #bee2beff
> color (#!1 & sel) #bee4beff
> color (#!1 & sel) #bee7beff
> color (#!1 & sel) #bee8beff
> color (#!1 & sel) #beebbeff
> color (#!1 & sel) #beefbeff
> color (#!1 & sel) #bef3beff
> color (#!1 & sel) #bef9beff
> color (#!1 & sel) #befdbeff
> color (#!1 & sel) #befebeff
> color (#!1 & sel) #beffbeff
[Repeated 1 time(s)]
> color (#!1 & sel) #befebeff
> color (#!1 & sel) #befdbeff
> color (#!1 & sel) #befcbeff
> color (#!1 & sel) #befbbeff
> color (#!1 & sel) #bef9beff
> color (#!1 & sel) #bef6beff
[Repeated 1 time(s)]
> color (#!1 & sel) #bef5beff
> color (#!1 & sel) #bef4beff
> color (#!1 & sel) #bef3beff
> color (#!1 & sel) #bef0beff
> color (#!1 & sel) #beedbeff
> color (#!1 & sel) #beecbeff
> color (#!1 & sel) #beedbeff
> color (#!1 & sel) #beeebeff
> color (#!1 & sel) #bef0beff
[Repeated 1 time(s)]
> color (#!1 & sel) #bef0b5ff
> color (#!1 & sel) #bef0b1ff
> color (#!1 & sel) #bef0afff
> color (#!1 & sel) #bef0aeff
> color (#!1 & sel) #bef0adff
> color (#!1 & sel) #bef0acff
> color (#!1 & sel) #bef0a8ff
> color (#!1 & sel) #bef0a4ff
> color (#!1 & sel) #bef0a0ff
> color (#!1 & sel) #bef09fff
> color (#!1 & sel) #bef09bff
> color (#!1 & sel) #bef093ff
> color (#!1 & sel) #bef092ff
> color (#!1 & sel) #bef094ff
> color (#!1 & sel) #bef097ff
> color (#!1 & sel) #bef09cff
> color (#!1 & sel) #bef0a2ff
> color (#!1 & sel) #bef0a8ff
> color (#!1 & sel) #bef0abff
> color (#!1 & sel) #bef0adff
> color (#!1 & sel) #bef0b1ff
> color (#!1 & sel) #bef0b3ff
> color (#!1 & sel) #bef0b6ff
> color (#!1 & sel) #bef0b8ff
[Repeated 3 time(s)]
> color (#!1 & sel) #b7f0b8ff
> color (#!1 & sel) #aff0b8ff
> color (#!1 & sel) #acf0b8ff
> color (#!1 & sel) #aaf0b8ff
> color (#!1 & sel) #a9f0b8ff
> color (#!1 & sel) #a6f0b8ff
> color (#!1 & sel) #a2f0b8ff
> color (#!1 & sel) #a0f0b8ff
> color (#!1 & sel) #a3f0b8ff
> color (#!1 & sel) #adf0b8ff
> color (#!1 & sel) #c1f0b8ff
> color (#!1 & sel) #d3f0b8ff
> color (#!1 & sel) #d7f0b8ff
> color (#!1 & sel) #dcf0b8ff
> color (#!1 & sel) #e1f0b8ff
> color (#!1 & sel) #e5f0b8ff
> color (#!1 & sel) #e9f0b8ff
> color (#!1 & sel) #edf0b8ff
> color (#!1 & sel) #eff0b8ff
> color (#!1 & sel) #f2f0b8ff
[Repeated 1 time(s)]
> color (#!1 & sel) #f1f0b8ff
> color (#!1 & sel) #e8f0b8ff
> color (#!1 & sel) #dbf0b8ff
> color (#!1 & sel) #d6f0b8ff
> color (#!1 & sel) #d3f0b8ff
> color (#!1 & sel) #d1f0b8ff
> color (#!1 & sel) #cff0b8ff
> color (#!1 & sel) #cdf0b8ff
> color (#!1 & sel) #cbf0b8ff
> color (#!1 & sel) #caf0b8ff
> color (#!1 & sel) #c8f0b8ff
> color (#!1 & sel) #c6f0b8ff
> color (#!1 & sel) #c3f0b8ff
> color (#!1 & sel) #c1f0b8ff
> color (#!1 & sel) #c0f0b8ff
> color (#!1 & sel) #bff0b8ff
> color (#!1 & sel) #bdf0b8ff
> color (#!1 & sel) #bcf0b8ff
> color (#!1 & sel) #bbf0b8ff
> color (#!1 & sel) #b9f0b8ff
> color (#!1 & sel) #b8f0b8ff
> color (#!1 & sel) #b7f0b8ff
[Repeated 1 time(s)]
> color (#!1 & sel) #b6f0b8ff
> color (#!1 & sel) #b5f0b8ff
> color (#!1 & sel) #b2f0b8ff
> color (#!1 & sel) #aef0b8ff
> color (#!1 & sel) #acf0b8ff
> color (#!1 & sel) #abf0b8ff
[Repeated 3 time(s)]
> color (#!1 & sel) #acf0b8ff
> color (#!1 & sel) #aff0b8ff
> color (#!1 & sel) #b3f0b8ff
> color (#!1 & sel) #b5f0b8ff
> color (#!1 & sel) #bcf0b8ff
> color (#!1 & sel) #bef0b8ff
> color (#!1 & sel) #bff0b8ff
> color (#!1 & sel) #c0f0b8ff
> color (#!1 & sel) #c1f0b8ff
[Repeated 1 time(s)]
> color (#!1 & sel) #c2f0b8ff
[Repeated 3 time(s)]
> color (#!1 & sel) #c0f0b8ff
> color (#!1 & sel) #bef0b8ff
> color (#!1 & sel) #bdf0b8ff
[Repeated 2 time(s)]
> select clear
> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
> select #2/A:339
21 atoms, 21 bonds, 1 residue, 1 model selected
> select #2/A:338
22 atoms, 21 bonds, 1 residue, 1 model selected
> select #2/A:365
11 atoms, 10 bonds, 1 residue, 1 model selected
> select #2/A:413
15 atoms, 14 bonds, 1 residue, 1 model selected
> select #2/A:338,365,413
48 atoms, 45 bonds, 3 residues, 1 model selected
> show sel atoms
> color sel red target acspfl
> style sel ball
Changed 48 atom styles
> style sel sphere
Changed 48 atom styles
> style sel stick
Changed 48 atom styles
> style sel ball
Changed 48 atom styles
> select clear
> select N
3718 atoms, 2763 residues, 4 models selected
> select clear
[Repeated 1 time(s)]
> select #2/A:648
15 atoms, 14 bonds, 1 residue, 1 model selected
> select #2/A:647
10 atoms, 9 bonds, 1 residue, 1 model selected
> turn z 5 center #2/A:646@ca atoms #2/A:647-870
> undo
[Repeated 1 time(s)]
> redo
> undo
> redo
[Repeated 2 time(s)]No redo action is available
> undo
> turn z -5 center #2/A:646@ca atoms #2/A:647-870
> turn y -5 center #2/A:646@ca atoms #2/A:647-870
> turn y 5 center #2/A:646@ca atoms #2/A:647-870
> turn x 20 center #2/A:646@ca atoms #2/A:647-870
[Repeated 1 time(s)]
> select #2/A:720
19 atoms, 18 bonds, 1 residue, 1 model selected
> turn x -40 center #2/A:720@ca atoms #2/A:721-870
> turn x 80 center #2/A:720@ca atoms #2/A:721-870
> turn x 40 center #2/A:720@ca atoms #2/A:721-870
> turn z 40 center #2/A:720@ca atoms #2/A:721-870
> select clear
> select #2/A:338,365,413
48 atoms, 45 bonds, 3 residues, 1 model selected
> color (#!2 & sel) #7370bbff
> hide sel atoms
> select clear
> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
> select #2/A:634
14 atoms, 13 bonds, 1 residue, 1 model selected
> select #2/A:619
15 atoms, 14 bonds, 1 residue, 1 model selected
> select clear
> select #2/A:532
22 atoms, 21 bonds, 1 residue, 1 model selected
> select clear
> select #2/A:531
17 atoms, 16 bonds, 1 residue, 1 model selected
> select #2/A:526
14 atoms, 13 bonds, 1 residue, 1 model selected
> select #2/A:527
14 atoms, 13 bonds, 1 residue, 1 model selected
> select #2/A:619-634,527-539
471 atoms, 471 bonds, 29 residues, 1 model selected
> select #2/A:619-634,537-539
313 atoms, 313 bonds, 19 residues, 1 model selected
> select #2/A:619-634,527-529
299 atoms, 298 bonds, 19 residues, 1 model selected
> select #2/A:619-634,527-531
331 atoms, 330 bonds, 21 residues, 1 model selected
> select #2/A:619-634,527-531
331 atoms, 330 bonds, 21 residues, 1 model selected
> color sel cyan target acspfl
> color sel #7370bbff
> select clear
> select #2/A:616
11 atoms, 10 bonds, 1 residue, 1 model selected
> select clear
> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
[Repeated 1 time(s)]
——— End of log from Fri May 23 17:49:00 2025 ———
opened ChimeraX session
> close #2.1
> split #2 atoms :1-310 atoms :311-634 atoms :635-870
Split HT-KIF5B[1-560] (#2) into 3 models
Chain information for HT-KIF5B[1-560] 1 #2.1
---
Chain | Description
A | No description available
Chain information for HT-KIF5B[1-560] 2 #2.2
---
Chain | Description
A | No description available
Chain information for HT-KIF5B[1-560] 3 #2.3
---
Chain | Description
A | No description available
> hide #!2 models
> hide #2.3 models
> hide #!1 models
> show #!1 models
> hide #1.4 models
> hide #1.3 models
Drag select of 35 atoms, 5 pseudobonds, 33 bonds
> combine sel modelId #2.2
Traceback (most recent call last):
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/cmd_line/tool.py", line 319, in execute
cmd.run(cmd_text)
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/commands/cli.py", line 3213, in run
result = ci.function(session, **kw_args)
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/atomic/cmd.py", line 174, in combine_cmd
session.models.add([combination])
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/models.py", line 758, in add
p = self._parent_for_added_model(model, parent, root_model = root_model)
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/models.py", line 828, in _parent_for_added_model
raise ValueError('Tried to add model %s with the same id as another model %s'
ValueError: Tried to add model copy of 4hna: KHC + TA/B #2.2 with the same id
as another model HT-KIF5B[1-560] 2 #2.2
ValueError: Tried to add model copy of 4hna: KHC + TA/B #2.2 with the same id
as another model HT-KIF5B[1-560] 2 #2.2
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/models.py", line 828, in _parent_for_added_model
raise ValueError('Tried to add model %s with the same id as another model %s'
See log for complete Python traceback.
> select add #2.2
5081 atoms, 5118 bonds, 5 pseudobonds, 329 residues, 3 models selected
> combine sel modelId #4
Remapping chain ID 'A' in HT-KIF5B[1-560] 2 #2.2 to 'C'
> select clear
> hide #!1 models
> show #!2 models
> hide #!2 models
> hide #2.1 models
> hide #2.2 models
> hide #1.1 models
> hide #1.2 models
> hide #!4 models
> show #!4 models
> hide #4.1 models
> show #4.1 models
> hide #4.1 models
> hide #!4 models
> show #!4 models
> show #4.1 models
> hide #4.1 models
> show #4.1 models
> hide #4.1 models
> show #4.1 models
> close#4.1
Unknown command: close#4.1
> close #4.1
> undo
> redo
> hide #4 models
> show #4 models
Drag select of 67 atoms, 68 bonds
> delete sel
> select clear
> close #2.2
> rename #4 #2.2
No name or id option specified for renaming
> rename #4 modelId #2.2
Expected a keyword
> rename #4 id #2.2
> show #!2 models
> show #2.1 models
> show #2.3 models
> hide #2.3 models
> show #2.3 models
> hide #2.3 models
> show #2.3 models
> hide #2.3 models
> show #2.3 models
> hide #2.3 models
> rename #2.3 "Neck Linker + Stalk"
> rename #2.2 "Motor Domain"
> rename #2.1 "HaloTag + Linker"
> hide #2.1 models
> show #2.1 models
> select up
2 atoms, 1 bond, 1 residue, 1 model selected
> select up
27 atoms, 29 bonds, 1 residue, 1 model selected
> select up
5 atoms, 4 bonds, 1 residue, 1 model selected
> select up
2628 atoms, 2665 bonds, 338 residues, 1 model selected
> show sel atoms
> select down
5 atoms, 4 bonds, 1 residue, 1 model selected
> undo
[Repeated 1 time(s)]
> select clear
> select up
2 atoms, 1 bond, 1 residue, 1 model selected
> select up
27 atoms, 29 bonds, 1 residue, 1 model selected
> select up
2628 atoms, 2665 bonds, 338 residues, 1 model selected
> delete sel
> select clear
> select #2.2/C:617
21 atoms, 21 bonds, 1 residue, 1 model selected
> select up
300 atoms, 301 bonds, 19 residues, 1 model selected
> select up
5046 atoms, 5085 bonds, 324 residues, 1 model selected
> select up
11773 atoms, 11961 bonds, 1185 residues, 1 model selected
> select up
20518 atoms, 20803 bonds, 1731 residues, 3 models selected
> select down
11773 atoms, 11961 bonds, 1185 residues, 1 model selected
> select up
20518 atoms, 20803 bonds, 1731 residues, 3 models selected
> select down
11773 atoms, 11961 bonds, 1185 residues, 1 model selected
> show sel cartoons
> select #2.2/C:627
19 atoms, 18 bonds, 1 residue, 1 model selected
> select up
300 atoms, 301 bonds, 19 residues, 1 model selected
> select up
5046 atoms, 5085 bonds, 324 residues, 1 model selected
> select ~sel & ##selected
6727 atoms, 6876 bonds, 861 residues, 1 model selected
> delete sel
> select #2.2/C:355
14 atoms, 14 bonds, 1 residue, 1 model selected
> select up
67 atoms, 68 bonds, 4 residues, 1 model selected
> select up
5046 atoms, 5085 bonds, 324 residues, 1 model selected
> select add #2.1
9940 atoms, 10061 bonds, 634 residues, 2 models selected
> select subtract #2.1
5046 atoms, 5085 bonds, 324 residues, 1 model selected
> hide #2.1 models
> show #2.1 models
> show #2.3 models
> hide #2.3 models
> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
> select clear
> show #2.3 models
> hide #2.1 models
> rename #3 mEGFP-alpha-Tubulin
> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
——— End of log from Fri May 23 18:38:32 2025 ———
opened ChimeraX session
> hide #!2 models
> show #!1 models
Drag select of 35 atoms, 33 bonds
> combine sel modelId #4
> hide #!1 models
> undo
> select clear
> delete #4
> hide #!1 models
> show #!1 models
> show #1.1 models
> show #1.2 models
> show #1.3 models
> show #1.4 models
> select add #1
9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 2 models selected
> show sel cartoons
> select #1/K:401@C1'
1 atom, 1 residue, 1 model selected
> select up
27 atoms, 29 bonds, 1 residue, 1 model selected
> select up
2628 atoms, 2665 bonds, 338 residues, 1 model selected
> combine sel #4 modelId
Expected a keyword
> combine sel modelId #4
> hide #!1 models
> select add #1
9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 3 models selected
> select subtract #1
3 models selected
> hide #1.1 models
> hide #1.2 models
> hide #1.3 models
> hide #1.4 models
> hide #!4 models
> show #!4 models
> hide #4.1 models
> show #4.1 models
> hide #4.1 models
> show #4.1 models
> select #4/A:424
8 atoms, 7 bonds, 1 residue, 1 model selected
> select up
141 atoms, 142 bonds, 17 residues, 1 model selected
> select up
3061 atoms, 3130 bonds, 392 residues, 1 model selected
> select up
3131 atoms, 3201 bonds, 402 residues, 1 model selected
> select up
3349 atoms, 3424 bonds, 430 residues, 1 model selected
> select up
3382 atoms, 3458 bonds, 432 residues, 1 model selected
> select up
9422 atoms, 9609 bonds, 1204 residues, 1 model selected
> select down
3382 atoms, 3458 bonds, 432 residues, 1 model selected
> delete sel
> select #4/B:253
11 atoms, 10 bonds, 1 residue, 1 model selected
> select up
64 atoms, 63 bonds, 8 residues, 1 model selected
> select up
3378 atoms, 3452 bonds, 431 residues, 1 model selected
> select up
3412 atoms, 3486 bonds, 434 residues, 1 model selected
> select up
6040 atoms, 6151 bonds, 772 residues, 1 model selected
> select down
3412 atoms, 3486 bonds, 434 residues, 1 model selected
> delete sel
> select #4/K:309
9 atoms, 8 bonds, 1 residue, 1 model selected
> select up
104 atoms, 104 bonds, 13 residues, 1 model selected
> select up
2593 atoms, 2632 bonds, 333 residues, 1 model selected
> delete sel
> select #4/K:401@PA
1 atom, 1 residue, 1 model selected
> select up
27 atoms, 29 bonds, 1 residue, 1 model selected
> select up
35 atoms, 33 bonds, 5 residues, 1 model selected
> select up
9457 atoms, 9642 bonds, 1209 residues, 4 models selected
> select up
9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected
> select up
9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected
> select up
9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected
> select down
9457 atoms, 9642 bonds, 1209 residues, 7 models selected
> select down
35 atoms, 33 bonds, 5 residues, 4 models selected
> select add #4
35 atoms, 33 bonds, 5 pseudobonds, 5 residues, 2 models selected
> select subtract #4
Nothing selected
> select add #4.1
5 pseudobonds, 1 model selected
> select up
35 atoms, 33 bonds, 5 pseudobonds, 5 residues, 2 models selected
> undo
[Repeated 10 time(s)]No undo action is available
> select up
9457 atoms, 9642 bonds, 1209 residues, 4 models selected
> select up
9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected
> select up
9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected
> select up
9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected
> select up
9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected
> select up
9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected
> select up
9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected
> select up
9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected
> select up
9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected
> show sel & #!4 atoms
[Repeated 1 time(s)]
> show #!1 models
> hide #!1 models
Cell requested for row 0 is out of bounds for table with 14 rows! Resizing
table model.
> show #!1 models
> show #!2 models
Cell requested for row 2 is out of bounds for table with 10 rows! Resizing
table model.
> show #!3 models
Cell requested for row 0 is out of bounds for table with 7 rows! Resizing
table model.
> select subtract #1
35 atoms, 33 bonds, 5 residues, 6 models selected
> select add #2
13826 atoms, 13960 bonds, 875 residues, 6 models selected
> select add #3
19295 atoms, 19551 bonds, 1571 residues, 8 models selected
> select add #1
28717 atoms, 29160 bonds, 12 pseudobonds, 2775 residues, 10 models selected
> select subtract #1
19295 atoms, 19551 bonds, 1571 residues, 11 models selected
> select subtract #2
5504 atoms, 5624 bonds, 701 residues, 4 models selected
> select add #2
19295 atoms, 19551 bonds, 1571 residues, 8 models selected
> select subtract #2
5504 atoms, 5624 bonds, 701 residues, 4 models selected
> select subtract #3
35 atoms, 33 bonds, 5 residues, 1 model selected
> select add #4
35 atoms, 33 bonds, 5 pseudobonds, 5 residues, 2 models selected
> select subtract #4
Nothing selected
> select add #4
35 atoms, 33 bonds, 5 pseudobonds, 5 residues, 2 models selected
> rename #4.1 id #5
> hide #5 models
> show #5 models
> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"
——— End of log from Fri May 23 18:50:52 2025 ———
opened ChimeraX session
> delete #4
Traceback (most recent call last):
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/triggerset.py", line 149, in invoke
return self._func(self._name, data)
^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/model_panel/tool.py", line 214, in <lambda>
lambda *args, ft=self._fill_tree, ar=always_rebuild: ft(always_rebuild=ar))
^^^^^^^^^^^^^^^^^^^^^
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/model_panel/tool.py", line 247, in _fill_tree
all_selected_models = self.session.selection.models(all_selected=True)
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/selection.py", line 40, in models
return [m for m in self._all_models if m.get_selected(include_children=True,
fully=True)]
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/selection.py", line 40, in <listcomp>
return [m for m in self._all_models if m.get_selected(include_children=True,
fully=True)]
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/atomic/pbgroup.py", line 108, in get_selected
if self.pseudobonds.num_selected < self.num_pseudobonds:
^^^^^^^^^^^^^^^^
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/atomic/molc.py", line 174, in get_prop
vcount = getattr(self, value_count)
^^^^^^^^^^^^^^^^^^^^^^^^^^
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/atomic/molc.py", line 106, in get_prop
cget(self._c_pointer_ref, 1, v_ref)
^^^^^^^^^^^^^^^^^^^
AttributeError: 'PseudobondGroup' object has no attribute '_c_pointer_ref'
Error processing trigger "new frame":
AttributeError: 'PseudobondGroup' object has no attribute '_c_pointer_ref'
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/atomic/molc.py", line 106, in get_prop
cget(self._c_pointer_ref, 1, v_ref)
^^^^^^^^^^^^^^^^^^^
See log for complete Python traceback.
OpenGL version: 4.1 Metal - 89.4
OpenGL renderer: Apple M1 Max
OpenGL vendor: Apple
Python: 3.11.4
Locale: en_US.UTF-8
Qt version: PyQt6 6.7.1, Qt 6.7.1
Qt runtime version: 6.7.3
Qt platform: cocoa
Hardware:
Hardware Overview:
Model Name: MacBook Pro
Model Identifier: MacBookPro18,2
Model Number: Z14X000HQLL/A
Chip: Apple M1 Max
Total Number of Cores: 10 (8 performance and 2 efficiency)
Memory: 64 GB
System Firmware Version: 11881.121.1
OS Loader Version: 11881.121.1
Software:
System Software Overview:
System Version: macOS 15.5 (24F74)
Kernel Version: Darwin 24.5.0
Time since boot: 3 days, 9 hours, 25 minutes
Graphics/Displays:
Apple M1 Max:
Chipset Model: Apple M1 Max
Type: GPU
Bus: Built-In
Total Number of Cores: 32
Vendor: Apple (0x106b)
Metal Support: Metal 3
Displays:
Color LCD:
Display Type: Built-in Liquid Retina XDR Display
Resolution: 3456 x 2234 Retina
Main Display: Yes
Mirror: Off
Online: Yes
Automatically Adjust Brightness: No
Connection Type: Internal
Installed Packages:
alabaster: 1.0.0
anyio: 4.7.0
appdirs: 1.4.4
appnope: 0.1.4
asttokens: 3.0.0
auditwheel: 6.1.0
babel: 2.16.0
beautifulsoup4: 4.12.3
blockdiag: 3.0.0
blosc2: 3.0.0
build: 1.2.1
certifi: 2023.11.17
cftime: 1.6.4.post1
charset-normalizer: 3.4.0
ChimeraX-AddCharge: 1.5.18
ChimeraX-AddH: 2.2.6
ChimeraX-AlignmentAlgorithms: 2.0.2
ChimeraX-AlignmentHdrs: 3.5
ChimeraX-AlignmentMatrices: 2.1
ChimeraX-Alignments: 2.16.1
ChimeraX-AlphaFold: 1.0.1
ChimeraX-AltlocExplorer: 1.1.2
ChimeraX-AmberInfo: 1.0
ChimeraX-Arrays: 1.1
ChimeraX-Atomic: 1.58.8
ChimeraX-AtomicLibrary: 14.1.11
ChimeraX-AtomSearch: 2.0.1
ChimeraX-AxesPlanes: 2.4
ChimeraX-BasicActions: 1.1.2
ChimeraX-BILD: 1.0
ChimeraX-BlastProtein: 3.0.0
ChimeraX-BondRot: 2.0.4
ChimeraX-BugReporter: 1.0.1
ChimeraX-BuildStructure: 2.13.1
ChimeraX-Bumps: 1.0
ChimeraX-BundleBuilder: 1.4.0
ChimeraX-ButtonPanel: 1.0.1
ChimeraX-CageBuilder: 1.0.1
ChimeraX-CellPack: 1.0
ChimeraX-Centroids: 1.4
ChimeraX-ChangeChains: 1.1
ChimeraX-CheckWaters: 1.4
ChimeraX-ChemGroup: 2.0.1
ChimeraX-Clashes: 2.3
ChimeraX-ColorActions: 1.0.5
ChimeraX-ColorGlobe: 1.0
ChimeraX-ColorKey: 1.5.6
ChimeraX-CommandLine: 1.2.5
ChimeraX-ConnectStructure: 2.0.1
ChimeraX-Contacts: 1.0.1
ChimeraX-Core: 1.9
ChimeraX-CoreFormats: 1.2
ChimeraX-coulombic: 1.4.4
ChimeraX-Crosslinks: 1.0
ChimeraX-Crystal: 1.0
ChimeraX-CrystalContacts: 1.0.1
ChimeraX-DataFormats: 1.2.3
ChimeraX-Dicom: 1.2.6
ChimeraX-DistMonitor: 1.4.2
ChimeraX-DockPrep: 1.1.3
ChimeraX-Dssp: 2.0
ChimeraX-EMDB-SFF: 1.0
ChimeraX-ESMFold: 1.0
ChimeraX-FileHistory: 1.0.1
ChimeraX-FunctionKey: 1.0.1
ChimeraX-Geometry: 1.3
ChimeraX-gltf: 1.0
ChimeraX-Graphics: 1.4.1
ChimeraX-Hbonds: 2.5
ChimeraX-Help: 1.3
ChimeraX-HKCage: 1.3
ChimeraX-IHM: 1.1
ChimeraX-ImageFormats: 1.2
ChimeraX-IMOD: 1.0
ChimeraX-IO: 1.0.3
ChimeraX-ItemsInspection: 1.0.1
ChimeraX-IUPAC: 1.0
ChimeraX-KVFinder: 1.2.1
ChimeraX-Label: 1.1.14
ChimeraX-ListInfo: 1.2.2
ChimeraX-Log: 1.2
ChimeraX-LookingGlass: 1.1
ChimeraX-Maestro: 1.9.1
ChimeraX-Map: 1.3
ChimeraX-MapData: 2.0
ChimeraX-MapEraser: 1.0.1
ChimeraX-MapFilter: 2.0.1
ChimeraX-MapFit: 2.0
ChimeraX-MapSeries: 2.1.1
ChimeraX-Markers: 1.0.1
ChimeraX-Mask: 1.0.2
ChimeraX-MatchMaker: 2.1.6
ChimeraX-MCopy: 1.0
ChimeraX-MDcrds: 2.7.2
ChimeraX-MedicalToolbar: 1.1
ChimeraX-Meeting: 1.0.1
ChimeraX-MLP: 1.1.1
ChimeraX-mmCIF: 2.14.2
ChimeraX-MMTF: 2.2
ChimeraX-ModelArchive: 1.0
ChimeraX-Modeller: 1.5.18
ChimeraX-ModelPanel: 1.5
ChimeraX-ModelSeries: 1.0.1
ChimeraX-Mol2: 2.0.3
ChimeraX-Mole: 1.0
ChimeraX-Morph: 1.0.2
ChimeraX-MouseModes: 1.2
ChimeraX-Movie: 1.0
ChimeraX-MutationScores: 1.0
ChimeraX-Neuron: 1.0
ChimeraX-Nifti: 1.2
ChimeraX-NMRSTAR: 1.0.2
ChimeraX-NRRD: 1.2
ChimeraX-Nucleotides: 2.0.3
ChimeraX-OpenCommand: 1.14
ChimeraX-OrthoPick: 1.0.1
ChimeraX-PDB: 2.7.6
ChimeraX-PDBBio: 1.0.1
ChimeraX-PDBLibrary: 1.0.4
ChimeraX-PDBMatrices: 1.0
ChimeraX-PickBlobs: 1.0.1
ChimeraX-Positions: 1.0
ChimeraX-PresetMgr: 1.1.2
ChimeraX-PubChem: 2.2
ChimeraX-ReadPbonds: 1.0.1
ChimeraX-Registration: 1.1.2
ChimeraX-RemoteControl: 1.0
ChimeraX-RenderByAttr: 1.6.2
ChimeraX-RenumberResidues: 1.1
ChimeraX-ResidueFit: 1.0.1
ChimeraX-RestServer: 1.3.1
ChimeraX-RNALayout: 1.0
ChimeraX-RotamerLibMgr: 4.0
ChimeraX-RotamerLibsDunbrack: 2.0
ChimeraX-RotamerLibsDynameomics: 2.0
ChimeraX-RotamerLibsRichardson: 2.0
ChimeraX-SaveCommand: 1.5.1
ChimeraX-SchemeMgr: 1.0
ChimeraX-SDF: 2.0.2
ChimeraX-Segger: 1.0
ChimeraX-Segment: 1.0.1
ChimeraX-Segmentations: 3.5.6
ChimeraX-SelInspector: 1.0
ChimeraX-SeqView: 2.14
ChimeraX-Shape: 1.0.1
ChimeraX-Shell: 1.0.1
ChimeraX-Shortcuts: 1.2.0
ChimeraX-ShowSequences: 1.0.3
ChimeraX-SideView: 1.0.1
ChimeraX-SimilarStructures: 1.0.1
ChimeraX-Smiles: 2.1.2
ChimeraX-SmoothLines: 1.0
ChimeraX-SpaceNavigator: 1.0
ChimeraX-StdCommands: 1.18.1
ChimeraX-STL: 1.0.1
ChimeraX-Storm: 1.0
ChimeraX-StructMeasure: 1.2.1
ChimeraX-Struts: 1.0.1
ChimeraX-Surface: 1.0.1
ChimeraX-SwapAA: 2.0.1
ChimeraX-SwapRes: 2.5
ChimeraX-TapeMeasure: 1.0
ChimeraX-TaskManager: 1.0
ChimeraX-Test: 1.0
ChimeraX-Toolbar: 1.2.3
ChimeraX-ToolshedUtils: 1.2.4
ChimeraX-Topography: 1.0
ChimeraX-ToQuest: 1.0
ChimeraX-Tug: 1.0.1
ChimeraX-UI: 1.41
ChimeraX-Umap: 1.0
ChimeraX-uniprot: 2.3.1
ChimeraX-UnitCell: 1.0.1
ChimeraX-ViewDockX: 1.4.4
ChimeraX-VIPERdb: 1.0
ChimeraX-Vive: 1.1
ChimeraX-VolumeMenu: 1.0.1
ChimeraX-vrml: 1.0
ChimeraX-VTK: 1.0
ChimeraX-WavefrontOBJ: 1.0
ChimeraX-WebCam: 1.0.2
ChimeraX-WebServices: 1.1.4
ChimeraX-Zone: 1.0.1
colorama: 0.4.6
comm: 0.2.2
contourpy: 1.3.1
cxservices: 1.2.3
cycler: 0.12.1
Cython: 3.0.10
debugpy: 1.8.9
decorator: 5.1.1
docutils: 0.21.2
executing: 2.1.0
filelock: 3.15.4
fonttools: 4.55.3
funcparserlib: 2.0.0a0
glfw: 2.8.0
grako: 3.16.5
h11: 0.14.0
h5py: 3.12.1
html2text: 2024.2.26
httpcore: 1.0.7
httpx: 0.28.1
idna: 3.10
ihm: 1.3
imagecodecs: 2024.6.1
imagesize: 1.4.1
ipykernel: 6.29.5
ipython: 8.26.0
ipywidgets: 8.1.5
jedi: 0.19.1
Jinja2: 3.1.4
jupyter_client: 8.6.2
jupyter_core: 5.7.2
jupyterlab_widgets: 3.0.13
kiwisolver: 1.4.7
line_profiler: 4.1.3
lxml: 5.2.2
lz4: 4.3.3
MarkupSafe: 3.0.2
matplotlib: 3.9.2
matplotlib-inline: 0.1.7
msgpack: 1.0.8
ndindex: 1.9.2
nest-asyncio: 1.6.0
netCDF4: 1.6.5
networkx: 3.3
nibabel: 5.2.0
nptyping: 2.5.0
numexpr: 2.10.2
numpy: 1.26.4
openvr: 1.26.701
packaging: 23.2
ParmEd: 4.2.2
parso: 0.8.4
pep517: 0.13.1
pexpect: 4.9.0
pillow: 10.4.0
pip: 24.2
pkginfo: 1.11.1
platformdirs: 4.3.6
prompt_toolkit: 3.0.48
psutil: 6.0.0
ptyprocess: 0.7.0
pure_eval: 0.2.3
py-cpuinfo: 9.0.0
pycollada: 0.8
pydicom: 2.4.4
pyelftools: 0.31
Pygments: 2.18.0
pynmrstar: 3.3.4
pynrrd: 1.0.0
PyOpenGL: 3.1.7
PyOpenGL-accelerate: 3.1.7
pyopenxr: 1.0.3401
pyparsing: 3.2.0
pyproject_hooks: 1.2.0
PyQt6-commercial: 6.7.1
PyQt6-Qt6: 6.7.3
PyQt6-WebEngine-commercial: 6.7.0
PyQt6-WebEngine-Qt6: 6.7.3
PyQt6-WebEngineSubwheel-Qt6: 6.7.3
PyQt6_sip: 13.8.0
python-dateutil: 2.9.0.post0
pytz: 2024.2
pyzmq: 26.2.0
qtconsole: 5.5.2
QtPy: 2.4.2
qtshim: 1.0
RandomWords: 0.4.0
requests: 2.32.3
scipy: 1.14.0
setuptools: 72.1.0
sfftk-rw: 0.8.1
six: 1.16.0
sniffio: 1.3.1
snowballstemmer: 2.2.0
sortedcontainers: 2.4.0
soupsieve: 2.6
Sphinx: 8.0.2
sphinx-autodoc-typehints: 2.2.3
sphinxcontrib-applehelp: 2.0.0
sphinxcontrib-blockdiag: 3.0.0
sphinxcontrib-devhelp: 2.0.0
sphinxcontrib-htmlhelp: 2.1.0
sphinxcontrib-jsmath: 1.0.1
sphinxcontrib-qthelp: 2.0.0
sphinxcontrib-serializinghtml: 2.0.0
stack-data: 0.6.3
superqt: 0.6.3
tables: 3.10.1
tcia_utils: 1.5.1
tifffile: 2024.7.24
tinyarray: 1.2.4
tornado: 6.4.2
traitlets: 5.14.3
typing_extensions: 4.12.2
tzdata: 2024.2
urllib3: 2.2.3
wcwidth: 0.2.13
webcolors: 24.6.0
wheel: 0.43.0
wheel-filename: 1.4.1
widgetsnbextension: 4.0.13
Change History (2)
comment:1 by , 6 months ago
| Component: | Unassigned → Structure Editing |
|---|---|
| Owner: | set to |
| Platform: | → all |
| Project: | → ChimeraX |
| Status: | new → accepted |
| Summary: | ChimeraX bug report submission → Combine into existing ID |
comment:2 by , 6 months ago
| Resolution: | → fixed |
|---|---|
| Status: | accepted → closed |
Note:
See TracTickets
for help on using tickets.
Convert the ValueError (and make it a subclass of ValueError) into a UserError instead of a traceback (and dispose of the model).