[Chimera-users] CHIMERA clarification / mis-alignment?

[Anand K S Rao]

Greetings to all CHIMERA Forum members / users / bug-fixers

I am PhD student working on trying to identify F-box domains in plant
proteomes, primarily via sequence based approaches like HMM profile based
discovery. In order to build the profile HMM, I am building my seed
alignment with the use of a structural alignment of solved crystal
structures of human F-box proteins.

Specifically, I seek some help from you or any of your lab members
regarding what might possibly be a bug in your CHIMERA, and also help with
protocol / parameter choice for both Matchmaker and Match->Align work I am
doing. The PDBs trimmed to just the domain regions of my interest are
attached as zipped folder #1.

When I use default parameters for Matchmaker followed by default parameters
for Match->Align, I obtain a multiple sequence alignment that appears well
conserved except at the N and C terminals (based on RMSD track in the
output EPS file) - However, for 2E31-A, the LW di-peptide (in the 2nd row
of the alignment) is matched with the rest of the multipel sequence
alignment. Please see attachment #2 - this mismatch in the MSA, is actually
a structural match as seen via CHIMERA and PyMOL.
So my *question #1* is how can I be sure that other residues have been
accurately aligned in 3D and then accurately aligned in the 2D MSA? If this
even an artifact, is it caused more by some error in my choice of methods /
parameters or is this indeed a mis-alignment that should be all alignment
LW at those two positions? (which is how it looked even in PyMol after
structural superposition)

And my *question #2* is what are the most appropriate parameters to be used
for the purposes for my Match -> Align work? Should I use iteration for
Matchmaker or not, if so how many or until convergence, if yes or
otherwise, what should the residue RMSD not exceed? Should I retain it as
the default 5A or do down to a conservative 1A instead?

Thanks for any help in this regard.
Sincerely,
Anand

-- 
Anand K.S. Rao
PhD candidate
Plant Biology Graduate Group
President
Indian Graduate Student Association @ UCDavis
University of California at Davis
Davis, CA - 95616 USA
--------------------------------------------
CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT
(translate THAT!)





-- 
Anand K.S. Rao
PhD candidate
Plant Biology Graduate Group
President
Indian Graduate Student Association @ UCDavis
University of California at Davis
Davis, CA - 95616 USA
--------------------------------------------
CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT
(translate THAT!)




-- 
Anand K.S. Rao
PhD candidate
Plant Biology Graduate Group
President
Indian Graduate Student Association @ UCDavis
University of California at Davis
Davis, CA - 95616 USA
--------------------------------------------
CTTATTGTTGAACTTOAATGGTGCTAATGATCCTCGTOTCTCCTGAACGT
(translate THAT!)
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://plato.cgl.ucsf.edu/pipermail/chimera-users/attachments/20120720/98dbb9d5/attachment.html>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: trimmed_PDBs_PF00646.zip
Type: application/zip
Size: 54481 bytes
Desc: not available
URL: <http://plato.cgl.ucsf.edu/pipermail/chimera-users/attachments/20120720/98dbb9d5/attachment.zip>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: Match -> Align (6 models) 6FBD default Matchmaker default Match2Align.jpg
Type: image/jpeg
Size: 186245 bytes
Desc: not available
URL: <http://plato.cgl.ucsf.edu/pipermail/chimera-users/attachments/20120720/98dbb9d5/attachment.jpg>