﻿id	summary	reporter	owner	description	type	status	priority	milestone	component	version	resolution	keywords	cc	blockedby	blocking	notify_on_close	platform	project
5694	Build Structure: second chain numbered wrong	jaremko@…	Eric Pettersen	"{{{
The following bug report has been submitted:
Platform:        macOS-10.16-x86_64-i386-64bit
ChimeraX Version: 1.2.5 (2021-05-24 04:13:57 UTC)
Description
When building DNA,  the second chain of the double helix is corrupt(?) and you can not manipulate or select individual residues

Log:
> ui mousemode right zoom

> set bgColor white

> graphics silhouettes true

> graphics silhouettes width 3

> hide all atoms

> style stick

Changed 0 atom styles  

> style ions sphere

Changed 0 atom styles  

> style ions sphere

Changed 0 atom styles  

> show all cartoons

> show ligand target ab

> show ions atoms

> show sidechain & (ligand | ions) :< 3.5 target ab

> color /a #55c087

> color /b #ffe255

> color /c #f6986c

> color /d #6b80bc

> color /e #aa7fba

> color /g #FFC0CB

> color /h #b2b2b2

> color /i red

> color byhetero

> lighting soft

> lighting depthCue false

> cartoon suppressBackboneDisplay false

UCSF ChimeraX version: 1.2.5 (2021-05-24)  
© 2016-2021 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  

> ui tool show ""Build Structure""

> build start nucleic ""custom built""
> CCTGCAGGCCTTTTGAAAAGCAAGCATAAAAGATCTAAACATAAAATCTGTAAAATAACA type dna form B

Chain information for custom built #1  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select /B:59-59,

Expected an objects specifier or a keyword  

> select /A:1-60

1230 atoms, 1385 bonds, 60 residues, 1 model selected  

> select /A:1-60

1230 atoms, 1385 bonds, 60 residues, 1 model selected  

> select clear

> select clear

> select clear

> select /B:59@C5'

60 atoms, 60 residues, 1 model selected  

> select /B:59-59,

Expected an objects specifier or a keyword  

> select clear

> select /B:59@C1'

60 atoms, 60 residues, 1 model selected  

> select clear




OpenGL version: 4.1 ATI-4.7.29
OpenGL renderer: AMD Radeon Pro 5500M OpenGL Engine
OpenGL vendor: ATI Technologies Inc.Hardware:

    Hardware Overview:

      Model Name: MacBook Pro
      Model Identifier: MacBookPro16,1
      Processor Name: 8-Core Intel Core i9
      Processor Speed: 2.4 GHz
      Number of Processors: 1
      Total Number of Cores: 8
      L2 Cache (per Core): 256 KB
      L3 Cache: 16 MB
      Hyper-Threading Technology: Enabled
      Memory: 32 GB
      System Firmware Version: 1715.40.15.0.0 (iBridge: 19.16.10549.0.0,0)
      OS Loader Version: 540.40.4~45

Software:

    System Software Overview:

      System Version: macOS 12.0.1 (21A559)
      Kernel Version: Darwin 21.1.0
      Time since boot: 4 days 23:33

Graphics/Displays:

    Intel UHD Graphics 630:

      Chipset Model: Intel UHD Graphics 630
      Type: GPU
      Bus: Built-In
      VRAM (Dynamic, Max): 1536 MB
      Vendor: Intel
      Device ID: 0x3e9b
      Revision ID: 0x0002
      Automatic Graphics Switching: Supported
      gMux Version: 5.0.0
      Metal Family: Supported, Metal GPUFamily macOS 2

    AMD Radeon Pro 5500M:

      Chipset Model: AMD Radeon Pro 5500M
      Type: GPU
      Bus: PCIe
      PCIe Lane Width: x16
      VRAM (Total): 8 GB
      Vendor: AMD (0x1002)
      Device ID: 0x7340
      Revision ID: 0x0040
      ROM Revision: 113-D3220E-190
      VBIOS Version: 113-D32206U1-020
      Option ROM Version: 113-D32206U1-020
      EFI Driver Version: 01.A1.190
      Automatic Graphics Switching: Supported
      gMux Version: 5.0.0
      Metal Family: Supported, Metal GPUFamily macOS 2
      Displays:
        Color LCD:
          Display Type: Built-In Retina LCD
          Resolution: 3072 x 1920 Retina
          Framebuffer Depth: 24-Bit Color (ARGB8888)
          Main Display: Yes
          Mirror: Off
          Online: Yes
          Automatically Adjust Brightness: Yes
          Connection Type: Internal

Locale: (None, 'UTF-8')
PyQt5 5.15.2, Qt 5.15.2
Installed Packages:
    alabaster: 0.7.12
    appdirs: 1.4.4
    appnope: 0.1.2
    Babel: 2.9.1
    backcall: 0.2.0
    blockdiag: 2.0.1
    certifi: 2020.12.5
    cftime: 1.5.0
    chardet: 3.0.4
    ChimeraX-AddCharge: 1.0.1
    ChimeraX-AddH: 2.1.6
    ChimeraX-AlignmentAlgorithms: 2.0
    ChimeraX-AlignmentHdrs: 3.2
    ChimeraX-AlignmentMatrices: 2.0
    ChimeraX-Alignments: 2.1
    ChimeraX-AmberInfo: 1.0
    ChimeraX-Arrays: 1.0
    ChimeraX-Atomic: 1.13.2
    ChimeraX-AtomicLibrary: 3.1.3
    ChimeraX-AtomSearch: 2.0
    ChimeraX-AtomSearchLibrary: 1.0
    ChimeraX-AxesPlanes: 2.0
    ChimeraX-BasicActions: 1.1
    ChimeraX-BILD: 1.0
    ChimeraX-BlastProtein: 1.1
    ChimeraX-BondRot: 2.0
    ChimeraX-BugReporter: 1.0
    ChimeraX-BuildStructure: 2.5.2
    ChimeraX-Bumps: 1.0
    ChimeraX-BundleBuilder: 1.1
    ChimeraX-ButtonPanel: 1.0
    ChimeraX-CageBuilder: 1.0
    ChimeraX-CellPack: 1.0
    ChimeraX-Centroids: 1.1
    ChimeraX-ChemGroup: 2.0
    ChimeraX-Clashes: 2.1
    ChimeraX-Clipper: 0.16.1
    ChimeraX-ColorActions: 1.0
    ChimeraX-ColorGlobe: 1.0
    ChimeraX-ColorKey: 1.2.1
    ChimeraX-CommandLine: 1.1.4
    ChimeraX-ConnectStructure: 2.0
    ChimeraX-Contacts: 1.0
    ChimeraX-Core: 1.2.5
    ChimeraX-CoreFormats: 1.0
    ChimeraX-coulombic: 1.1.1
    ChimeraX-Crosslinks: 1.0
    ChimeraX-Crystal: 1.0
    ChimeraX-CrystalContacts: 1.0
    ChimeraX-DataFormats: 1.1
    ChimeraX-Dicom: 1.0
    ChimeraX-DistMonitor: 1.1.3
    ChimeraX-DistUI: 1.0
    ChimeraX-Dssp: 2.0
    ChimeraX-EMDB-SFF: 1.0
    ChimeraX-ExperimentalCommands: 1.0
    ChimeraX-FileHistory: 1.0
    ChimeraX-FunctionKey: 1.0
    ChimeraX-Geometry: 1.1
    ChimeraX-gltf: 1.0
    ChimeraX-Graphics: 1.0
    ChimeraX-Hbonds: 2.1
    ChimeraX-Help: 1.1
    ChimeraX-HKCage: 1.3
    ChimeraX-IHM: 1.0
    ChimeraX-ImageFormats: 1.1
    ChimeraX-IMOD: 1.0
    ChimeraX-IO: 1.0.1
    ChimeraX-ISOLDE: 1.2.2
    ChimeraX-Label: 1.0
    ChimeraX-ListInfo: 1.1.1
    ChimeraX-Log: 1.1.2
    ChimeraX-LookingGlass: 1.1
    ChimeraX-Maestro: 1.8.1
    ChimeraX-Map: 1.0.2
    ChimeraX-MapData: 2.0
    ChimeraX-MapEraser: 1.0
    ChimeraX-MapFilter: 2.0
    ChimeraX-MapFit: 2.0
    ChimeraX-MapSeries: 2.0
    ChimeraX-Markers: 1.0
    ChimeraX-Mask: 1.0
    ChimeraX-MatchMaker: 1.2.1
    ChimeraX-MDcrds: 2.2
    ChimeraX-MedicalToolbar: 1.0.1
    ChimeraX-Meeting: 1.0
    ChimeraX-MLP: 1.1
    ChimeraX-mmCIF: 2.3
    ChimeraX-MMTF: 2.1
    ChimeraX-Modeller: 1.0.1
    ChimeraX-ModelPanel: 1.0.1
    ChimeraX-ModelSeries: 1.0
    ChimeraX-Mol2: 2.0
    ChimeraX-Morph: 1.0
    ChimeraX-MouseModes: 1.1
    ChimeraX-Movie: 1.0
    ChimeraX-Neuron: 1.0
    ChimeraX-Nucleotides: 2.0.1
    ChimeraX-OpenCommand: 1.5
    ChimeraX-PDB: 2.4.1
    ChimeraX-PDBBio: 1.0
    ChimeraX-PDBLibrary: 1.0.1
    ChimeraX-PDBMatrices: 1.0
    ChimeraX-PickBlobs: 1.0
    ChimeraX-Positions: 1.0
    ChimeraX-PresetMgr: 1.0.1
    ChimeraX-PubChem: 2.0.1
    ChimeraX-ReadPbonds: 1.0
    ChimeraX-Registration: 1.1
    ChimeraX-RemoteControl: 1.0
    ChimeraX-ResidueFit: 1.0
    ChimeraX-RestServer: 1.1
    ChimeraX-RNALayout: 1.0
    ChimeraX-RotamerLibMgr: 2.0
    ChimeraX-RotamerLibsDunbrack: 2.0
    ChimeraX-RotamerLibsDynameomics: 2.0
    ChimeraX-RotamerLibsRichardson: 2.0
    ChimeraX-SaveCommand: 1.4
    ChimeraX-SchemeMgr: 1.0
    ChimeraX-SDF: 2.0
    ChimeraX-Segger: 1.0
    ChimeraX-Segment: 1.0
    ChimeraX-SeqView: 2.3
    ChimeraX-Shape: 1.0.1
    ChimeraX-Shell: 1.0
    ChimeraX-Shortcuts: 1.0
    ChimeraX-ShowAttr: 1.0
    ChimeraX-ShowSequences: 1.0
    ChimeraX-SideView: 1.0
    ChimeraX-Smiles: 2.0.1
    ChimeraX-SmoothLines: 1.0
    ChimeraX-SpaceNavigator: 1.0
    ChimeraX-StdCommands: 1.3.1
    ChimeraX-STL: 1.0
    ChimeraX-Storm: 1.0
    ChimeraX-Struts: 1.0
    ChimeraX-Surface: 1.0
    ChimeraX-SwapAA: 2.0
    ChimeraX-SwapRes: 2.1
    ChimeraX-TapeMeasure: 1.0
    ChimeraX-Test: 1.0
    ChimeraX-Toolbar: 1.0.1
    ChimeraX-ToolshedUtils: 1.2
    ChimeraX-Tug: 1.0
    ChimeraX-UI: 1.7.6
    ChimeraX-uniprot: 2.1
    ChimeraX-UnitCell: 1.0
    ChimeraX-ViewDockX: 1.0
    ChimeraX-Vive: 1.1
    ChimeraX-VolumeMenu: 1.0
    ChimeraX-VTK: 1.0
    ChimeraX-WavefrontOBJ: 1.0
    ChimeraX-WebCam: 1.0
    ChimeraX-WebServices: 1.0
    ChimeraX-Zone: 1.0
    colorama: 0.4.3
    comtypes: 1.1.7
    cxservices: 1.0
    cycler: 0.10.0
    Cython: 0.29.21
    decorator: 5.0.9
    distlib: 0.3.1
    docutils: 0.16
    filelock: 3.0.12
    funcparserlib: 0.3.6
    grako: 3.16.5
    h5py: 2.10.0
    html2text: 2020.1.16
    idna: 2.10
    ihm: 0.17
    imagecodecs: 2020.5.30
    imagesize: 1.2.0
    ipykernel: 5.3.4
    ipython: 7.18.1
    ipython-genutils: 0.2.0
    jedi: 0.17.2
    Jinja2: 2.11.2
    jupyter-client: 6.1.7
    jupyter-core: 4.7.1
    kiwisolver: 1.3.1
    line-profiler: 2.1.2
    lxml: 4.6.2
    lz4: 3.1.0
    MarkupSafe: 2.0.1
    matplotlib: 3.3.2
    matplotlib-inline: 0.1.2
    msgpack: 1.0.0
    netCDF4: 1.5.4
    networkx: 2.5
    numexpr: 2.7.3
    numpy: 1.19.2
    numpydoc: 1.1.0
    openvr: 1.14.1501
    packaging: 20.9
    ParmEd: 3.2.0
    parso: 0.7.1
    pexpect: 4.8.0
    pickleshare: 0.7.5
    Pillow: 7.2.0
    pip: 21.0.1
    pkginfo: 1.5.0.1
    prompt-toolkit: 3.0.18
    psutil: 5.7.2
    ptyprocess: 0.7.0
    pycollada: 0.7.1
    pydicom: 2.0.0
    Pygments: 2.7.1
    PyOpenGL: 3.1.5
    PyOpenGL-accelerate: 3.1.5
    pyparsing: 2.4.7
    PyQt5-commercial: 5.15.2
    PyQt5-sip: 12.8.1
    PyQtWebEngine-commercial: 5.15.2
    python-dateutil: 2.8.1
    pytz: 2021.1
    pyzmq: 22.0.3
    qtconsole: 4.7.7
    QtPy: 1.9.0
    RandomWords: 0.3.0
    requests: 2.24.0
    scipy: 1.5.2
    setuptools: 50.3.2
    sfftk-rw: 0.6.7.dev1
    six: 1.15.0
    snowballstemmer: 2.1.0
    sortedcontainers: 2.2.2
    Sphinx: 3.2.1
    sphinxcontrib-applehelp: 1.0.2
    sphinxcontrib-blockdiag: 2.0.0
    sphinxcontrib-devhelp: 1.0.2
    sphinxcontrib-htmlhelp: 2.0.0
    sphinxcontrib-jsmath: 1.0.1
    sphinxcontrib-qthelp: 1.0.3
    sphinxcontrib-serializinghtml: 1.1.5
    suds-jurko: 0.6
    tables: 3.6.1
    tifffile: 2020.9.3
    tinyarray: 1.2.3
    tornado: 6.1
    traitlets: 5.0.5
    urllib3: 1.25.11
    wcwidth: 0.2.5
    webcolors: 1.11.1
    wheel: 0.36.0
    wheel-filename: 1.3.0

}}}
"	defect	closed	normal		Structure Editing		fixed						all	ChimeraX
